ID: 1105664960

View in Genome Browser
Species Human (GRCh38)
Location 13:22543809-22543831
Sequence CTCCTACGATTCAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105664960 Original CRISPR CTCCTACGATTCAGAAAAAA AGG (reversed) Intergenic
902490022 1:16774836-16774858 CTCGCACCATTCAGAAAAGATGG - Intronic
904220754 1:28966857-28966879 TTCCTGCCATTCAGAATAAAGGG - Intronic
904817462 1:33216299-33216321 CTCTTAAGAAACAGAAAAAAGGG + Intergenic
908336765 1:63133649-63133671 CTCATATAAGTCAGAAAAAAGGG + Intergenic
917135831 1:171787246-171787268 CTCCTAAGGTTCAGAAAAGTGGG + Intronic
918450218 1:184650415-184650437 CTCCTACCACGCAGAAAGAAGGG + Intergenic
918900115 1:190405085-190405107 ATCCTAAGATTCAGAAAATGTGG - Intronic
919551880 1:199000799-199000821 CTCCTTTGATCCACAAAAAAAGG - Intergenic
919574286 1:199287515-199287537 CTTCTAAAATTTAGAAAAAAAGG + Intergenic
919752355 1:201045921-201045943 CTCAAATGGTTCAGAAAAAAAGG + Intronic
920648368 1:207819327-207819349 CTGCTGAGATTCAGAAAGAAGGG + Intergenic
923530416 1:234807694-234807716 CTCGCACCATTCAGAAAAGATGG + Intergenic
1063886111 10:10580757-10580779 CTCCTGAGAATCAGAGAAAAGGG + Intergenic
1067133573 10:43588109-43588131 CTGCTATGATTCCGAAAAATTGG + Intergenic
1068151657 10:53140094-53140116 ATCCTATGATTCAGAAACACTGG - Intergenic
1068987362 10:63119731-63119753 CTTCTGCAACTCAGAAAAAATGG - Intergenic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1069994520 10:72334361-72334383 CTCCTAGGATACAGAAACCATGG - Exonic
1072563962 10:96602229-96602251 CCCCTAGGATTCAGAGATAAGGG + Intronic
1074144101 10:110701397-110701419 CGAGTACCATTCAGAAAAAAAGG - Intronic
1074782132 10:116809655-116809677 CTCCTGGGATTCAGGAAAATTGG + Intergenic
1075237100 10:120740562-120740584 TTCCTAGGAATCATAAAAAAAGG - Intergenic
1078764380 11:14280273-14280295 CTCTTACCATTAAAAAAAAATGG + Intronic
1078841361 11:15078171-15078193 ATCCTAAGATACTGAAAAAAGGG + Intronic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1087632500 11:100666997-100667019 CTCCTGAGATACAGAAGAAATGG - Intergenic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1090516847 11:127437859-127437881 CTCCTCTGATACAGAAGAAAAGG - Intergenic
1090637127 11:128696175-128696197 CTCCTACCACCCACAAAAAAAGG - Intronic
1090960828 11:131555305-131555327 CTCCTAAGAACCAGACAAAAAGG - Intronic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1092369587 12:7905692-7905714 ATCCTACCATTCAGAAAAGCTGG + Intergenic
1093889704 12:24505168-24505190 CTTTTAAGATTCAGAAATAATGG + Intergenic
1093982880 12:25494064-25494086 CTCCTACTATGCAGAAAACAAGG - Intronic
1094637160 12:32237738-32237760 GACCTACCACTCAGAAAAAAAGG + Intronic
1099062856 12:77933990-77934012 CTCCTACTATACAGAGAAAGAGG - Intronic
1099791128 12:87335273-87335295 TTCCTAAAATTCAGGAAAAATGG + Intergenic
1100003489 12:89865895-89865917 ATTCTACCAATCAGAAAAAATGG + Intergenic
1102647395 12:114412664-114412686 CTCCTTCCATTTAGAAGAAATGG - Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105664960 13:22543809-22543831 CTCCTACGATTCAGAAAAAAAGG - Intergenic
1107860861 13:44659970-44659992 CTCCAAAGAAACAGAAAAAAGGG - Intergenic
1108865500 13:54918180-54918202 CTGCTATGATTCTGAAAAATTGG - Intergenic
1109077566 13:57857151-57857173 TTCCCACACTTCAGAAAAAATGG - Intergenic
1109222762 13:59657380-59657402 CTCCCTAAATTCAGAAAAAAGGG + Intergenic
1109465278 13:62723668-62723690 CTCCTACAACTCAATAAAAAGGG - Intergenic
1109664630 13:65517172-65517194 CTCCTAGCATTCAGTAATAAAGG + Intergenic
1109925891 13:69138274-69138296 CTCCTTCAGTTCAGAAAGAAAGG - Intergenic
1111507282 13:89208695-89208717 CTGGTTCGATCCAGAAAAAAGGG - Intergenic
1112755535 13:102628623-102628645 CTACTACTATGAAGAAAAAAAGG - Intronic
1112792609 13:103019396-103019418 CACCTACAATCCAGAAGAAAAGG - Intergenic
1113145865 13:107206614-107206636 TTCCTATTATTCACAAAAAAGGG - Intronic
1114824212 14:26057430-26057452 CTCCTAGGCTTCAGATAAGAAGG + Intergenic
1114855717 14:26439859-26439881 GTCCTACTATTCAGAAAAAGAGG + Intergenic
1117594246 14:57310229-57310251 CCCCTAAGATTCTGGAAAAATGG - Intergenic
1122386285 14:101350481-101350503 CTCCTGCTGCTCAGAAAAAAGGG + Intergenic
1123788821 15:23699463-23699485 CTGCTATGATTCCGAAAAAATGG - Intergenic
1130029527 15:80298955-80298977 CTCCTACTTTACAGAGAAAATGG - Intergenic
1130157593 15:81365370-81365392 CTCTTAAGAAACAGAAAAAAGGG + Intronic
1131037994 15:89237873-89237895 CTGCTATGATTCAAAAAAATTGG - Intergenic
1131879871 15:96851284-96851306 CTCCTAAGGTACAGAATAAAGGG - Intergenic
1133953764 16:10421962-10421984 CTGCTATGATTCTGAAAAATTGG - Intronic
1136406644 16:30052064-30052086 CTCTAAAAATTCAGAAAAAAAGG + Intronic
1136921910 16:34339449-34339471 CTGCTATGATTCTGAAAAATTGG + Intergenic
1136982663 16:35072357-35072379 CTGCTATGATTCTGAAAAATTGG - Intergenic
1139223767 16:65213930-65213952 CTCCTACGGTTTAGGAAAAAAGG - Intergenic
1142958951 17:3540375-3540397 CTCCCACCATTCAGAGAAAGAGG + Intronic
1146016010 17:29234161-29234183 CTCTTAGAAGTCAGAAAAAAAGG + Intergenic
1151738177 17:75959469-75959491 CTCTGACGTTTCAGAAAAACTGG - Intronic
1155570799 18:27191411-27191433 CTCCTAATATTTAGAAAAGAAGG + Intergenic
1156669582 18:39452100-39452122 CTCCTAAGACTCAGAATAATTGG + Intergenic
1157254163 18:46123279-46123301 CTCCTACAATTACCAAAAAAAGG - Exonic
1158350840 18:56563263-56563285 GTCCTAGGATTCAGCAAGAAAGG + Intergenic
1164269773 19:23661732-23661754 CTCATACGTTTCAGACAAGATGG + Intronic
925335071 2:3091755-3091777 CTCACTCGATACAGAAAAAAAGG + Intergenic
926418820 2:12677483-12677505 CCTCTACCTTTCAGAAAAAAAGG - Intergenic
927800928 2:26098642-26098664 TTCCTACAATGCAGAAAAAAAGG - Exonic
927908811 2:26881732-26881754 GTCTTACGACTCAGAAATAAAGG + Intronic
930354969 2:50306699-50306721 CTCCTACACTTCAGCTAAAATGG + Intronic
931300248 2:60972668-60972690 CTTCTACGTGTCACAAAAAAAGG + Intronic
931545136 2:63374674-63374696 CACTTAGAATTCAGAAAAAAAGG - Intronic
933764977 2:85701063-85701085 CTGAAATGATTCAGAAAAAAAGG + Intergenic
935025674 2:99274748-99274770 CTGCTATGATTCCGAAAAATTGG - Intronic
935765350 2:106361411-106361433 CTCAGAAGATTCAGAAAAATAGG - Intergenic
935915574 2:107946233-107946255 CTGCTATGATTCTGAAAAATTGG - Intergenic
938342122 2:130542588-130542610 CTCCTATGATTCAGAATGAAAGG + Intronic
938347710 2:130578123-130578145 CTCCTATGATTCAGAATGAAAGG - Intronic
940577783 2:155535109-155535131 CTCATACAATTCATAAGAAAAGG + Intergenic
941503570 2:166311498-166311520 CCCCTACTATGCAGACAAAAAGG - Exonic
944075675 2:195728139-195728161 CTCCTGCAATTAAGAAACAATGG - Exonic
944532220 2:200678562-200678584 TTCTTACTATTCAGAAATAATGG + Intergenic
944780340 2:203011014-203011036 CTCCTAGGAGACAGAAAGAAGGG + Intronic
945208815 2:207360844-207360866 CTCCAATGATTAAAAAAAAAAGG - Intergenic
946935107 2:224712012-224712034 TTCCTACGATTCAGTATCAAGGG - Intergenic
1171075705 20:22120840-22120862 CTCCTACGAGTGAGAACATACGG - Intergenic
1175637969 20:60601385-60601407 CTACTAGGATTCTGTAAAAAAGG + Intergenic
1176220940 20:63969226-63969248 CTCCCAGGCTTCAGAAAAATTGG - Intronic
1177848661 21:26321072-26321094 CTCCTAGGAAACAGAAATAAGGG - Intergenic
949582369 3:5401457-5401479 TTCCTAGAATTCAGAGAAAAGGG + Intergenic
950652722 3:14417363-14417385 CCCCAATGATTCAGCAAAAATGG - Intronic
952682273 3:36107402-36107424 CCCTAACAATTCAGAAAAAAAGG + Intergenic
954232753 3:49230329-49230351 CTGCTATGATTCCGAAAAACTGG + Intronic
957986682 3:87580897-87580919 TTCTAACGATTCAGAAAGAAGGG + Intergenic
961200952 3:125044934-125044956 CTGATACGATTTAGAAGAAAGGG + Intronic
966785129 3:183616561-183616583 CTCTTCCGACTCAGAACAAAAGG + Intergenic
970614754 4:17758646-17758668 CTCCTACGGTGAAGAAAAAGAGG + Intronic
971233760 4:24822563-24822585 TCCCTAGGATTCTGAAAAAAGGG + Exonic
974636121 4:64565754-64565776 CTGCTATGATTCTGAAAAAATGG + Intergenic
977176291 4:93824384-93824406 CTCAAAGTATTCAGAAAAAATGG - Intergenic
977327079 4:95587605-95587627 CTCTTACACTTCACAAAAAAGGG + Intergenic
977816735 4:101422813-101422835 CTCTTACTTTTAAGAAAAAATGG - Intronic
978151188 4:105437289-105437311 CTTCTAGGAGTGAGAAAAAAGGG + Intronic
978935418 4:114368932-114368954 CTCCTGGGAGTCAGAAAATAGGG - Intergenic
980117924 4:128697799-128697821 CACCTTAAATTCAGAAAAAATGG - Intergenic
980393555 4:132177689-132177711 CTCCTAAAATTTAAAAAAAATGG + Intergenic
982336048 4:154239481-154239503 GTCCCTGGATTCAGAAAAAAAGG + Intronic
988956721 5:36327624-36327646 TTCCTAAGATTGAGAGAAAATGG - Intergenic
990255346 5:53963094-53963116 CTCCTAGGATATAGACAAAAAGG + Intronic
992806854 5:80346067-80346089 CTCCTAGGTCTCAGAAAATAGGG + Intergenic
993148304 5:84125707-84125729 ATCCTATGATTCTGAAAAACTGG + Intronic
993748181 5:91628696-91628718 GTCCTAGGATTCAGGAAAAGAGG + Intergenic
994397110 5:99234204-99234226 CTCCTAATATTCAGAGAAGAAGG + Intergenic
997999360 5:138611494-138611516 CCCCAAAGTTTCAGAAAAAATGG + Intronic
1000491499 5:161920106-161920128 CTCCTACCATTTAGAGAAATAGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003433728 6:6066412-6066434 CTGCTATGATTCCAAAAAAATGG - Intergenic
1004816141 6:19313520-19313542 CTCCTAATATTCAGAAACTATGG - Intergenic
1005167796 6:22945214-22945236 CTCCTAGGAATCAGAAAAGGTGG + Intergenic
1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG + Intronic
1011007157 6:82658857-82658879 CTCCAACGATTCTGGAAAAATGG - Intergenic
1015208123 6:130665327-130665349 ATTCTACGATGAAGAAAAAAAGG + Intergenic
1016149105 6:140716712-140716734 CAACAAAGATTCAGAAAAAATGG - Intergenic
1019798131 7:3067231-3067253 CTCCTAGGAACCAGAAACAAGGG - Intergenic
1020694850 7:11400777-11400799 CTCCTACTTTTCAGTAAGAAAGG + Intronic
1020767995 7:12349651-12349673 CTCCTACAAATCAATAAAAAAGG + Intronic
1021586150 7:22210795-22210817 CTCCTACATTTAAAAAAAAATGG - Intronic
1022020065 7:26390482-26390504 CTGCTAGGATTCATAAAAATTGG - Intergenic
1023003379 7:35836384-35836406 TTCCTAGGATTCAGAATAATAGG - Intronic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031235703 7:119173599-119173621 CTCCCAACATTCAGAAAATAAGG - Intergenic
1032463616 7:132129684-132129706 CTACTAGGATTCAGATGAAAAGG + Exonic
1033095435 7:138426317-138426339 GTCCTAAGTTTGAGAAAAAAAGG - Intergenic
1033304756 7:140216751-140216773 TCTCTATGATTCAGAAAAAAAGG + Intergenic
1034595214 7:152183452-152183474 CTCCTTCAATTTAGAAAGAAGGG + Intronic
1035134723 7:156690955-156690977 CACCAACAATTAAGAAAAAATGG + Intronic
1037254506 8:16938166-16938188 CTACTAAGACTAAGAAAAAAAGG + Intergenic
1040319042 8:46281180-46281202 CTGCTATGATTCTGAAAAATTGG + Intergenic
1040669234 8:49667712-49667734 CACCTACAATTCAGTAACAATGG - Intergenic
1041823563 8:62066362-62066384 CTCAAACTATTCAGAAAAATAGG + Intergenic
1042983470 8:74556466-74556488 CTCCACTGAGTCAGAAAAAAGGG + Intergenic
1043490980 8:80748866-80748888 CTCCTACTCCCCAGAAAAAAGGG - Intronic
1044114969 8:88324852-88324874 CTCCTACAATCTAAAAAAAAGGG + Intronic
1048233843 8:132671018-132671040 CCCGTAAGAATCAGAAAAAAAGG + Intronic
1049572995 8:143378304-143378326 CTCCTACGAGGCAGAAATCAGGG + Exonic
1052348498 9:27434522-27434544 GGCCTGGGATTCAGAAAAAAAGG - Intronic
1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG + Intergenic
1054896661 9:70321129-70321151 CTCCTACCATTCAGAACTCAAGG - Intronic
1057709958 9:97431059-97431081 CTCCTACCTTCTAGAAAAAATGG - Exonic
1061969503 9:134036269-134036291 CTCCTACGACTCAGAGGAAGAGG - Exonic
1186610454 X:11133577-11133599 CTCCAACTATTCTGATAAAATGG + Intergenic
1187287493 X:17919565-17919587 ATCCTCATATTCAGAAAAAAAGG + Intergenic
1188522128 X:31050405-31050427 TTCCTATCATTCAGATAAAAAGG + Intergenic
1188560551 X:31463554-31463576 CTCCTACCGTTCAGTAAAACAGG - Intronic
1190034550 X:47009429-47009451 CCCCTACTGTTCAGATAAAAAGG + Intronic
1194439385 X:93911916-93911938 ATTCTACCATTCATAAAAAATGG + Intergenic
1195274678 X:103270073-103270095 TTCCTACAATTCAAAATAAAAGG + Intergenic
1195798138 X:108676079-108676101 CTCTTAAGATTCAGAATCAATGG - Intronic
1195980656 X:110574677-110574699 TTCCAAGGATTCTGAAAAAATGG + Intergenic
1196471857 X:116037399-116037421 CTGCTACGATTCCAAAAAACTGG + Intergenic
1196568256 X:117233841-117233863 CTTCTTCTATTTAGAAAAAAAGG - Intergenic
1198019557 X:132644769-132644791 CTCCCACCAATCAGAAACAAAGG + Intronic
1198092570 X:133346165-133346187 CTCCTGCCATGCAGAAAAAGGGG + Intronic
1199324677 X:146483663-146483685 TGGCTAAGATTCAGAAAAAAAGG - Intergenic
1200486365 Y:3773423-3773445 CTCCGACCCTTCAGAAATAAAGG - Intergenic
1200699432 Y:6389642-6389664 CTCCTTCTATTCAGAGAACAGGG - Intergenic
1201034679 Y:9775056-9775078 CTCCTTCTATTCAGAGAACAGGG + Intergenic
1201708967 Y:16968267-16968289 CTCATAAGATTCAGAAAATGTGG - Intergenic