ID: 1105672920

View in Genome Browser
Species Human (GRCh38)
Location 13:22640814-22640836
Sequence CTGTGACTATTGAGGAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105672920 Original CRISPR CTGTGACTATTGAGGAAAGA CGG (reversed) Intergenic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
907182493 1:52583152-52583174 CTGGTAATATTAAGGAAAGAAGG + Intergenic
907549069 1:55288710-55288732 CTATGACTGATGAGGATAGAAGG - Intergenic
908037965 1:60076035-60076057 ATGTGACAATGGAGGCAAGAGGG + Intergenic
909744011 1:79070229-79070251 ATGTTACCATTGAGGAAAAATGG + Intergenic
912547832 1:110463807-110463829 CTGGGTCTAGTGAGGACAGAGGG + Intergenic
912600165 1:110922918-110922940 CTTTGACTATGGAGGAGATAAGG - Intergenic
914678927 1:149925742-149925764 CTGTTACTGTTGAGGAACAAAGG + Intronic
915040588 1:152965278-152965300 CTGTGGATATTGAGCAAAGGAGG + Intergenic
918273415 1:182925769-182925791 TTTTGACTATTGGGGAAAGTGGG - Intronic
919563928 1:199160362-199160384 CTGAGTCTATTGAGGCAAGTTGG + Intergenic
919956348 1:202420778-202420800 CTGAGACTATAAGGGAAAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924376756 1:243418316-243418338 CTGTGAAATTTCAGGAAAGAAGG + Intronic
924421287 1:243912404-243912426 CTGTCTCTATGAAGGAAAGAAGG + Intergenic
1065062121 10:21913151-21913173 CTGTTAGTAATGAGAAAAGATGG + Intronic
1065072977 10:22046752-22046774 CTGTGTCTATTGAGATAATATGG - Intergenic
1066002045 10:31113869-31113891 CTGTGCCTGTTGAACAAAGAAGG + Intergenic
1067040762 10:42952034-42952056 CTGGGACTATTTAGGGAGGAGGG + Intergenic
1068383068 10:56284175-56284197 ATGTGAGTATTGAGAAGAGAAGG - Intergenic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1069681170 10:70286480-70286502 ATGTGGCTGCTGAGGAAAGAAGG - Intergenic
1071847166 10:89532814-89532836 CTATGAATATGGAGGAAAGTGGG + Intronic
1072855002 10:98937091-98937113 CTGTGACAATGGAGCCAAGATGG + Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074507972 10:114087973-114087995 GAGTGTCTATTGTGGAAAGATGG + Intergenic
1075149613 10:119915327-119915349 CTGTGACTAATGAGGAACTGAGG + Intronic
1077483198 11:2826238-2826260 CTGTGACTTGGAAGGAAAGAGGG + Intronic
1077765121 11:5150504-5150526 CTCTGATTCTTGAGGAATGATGG - Intergenic
1078635631 11:13047082-13047104 CTATGAATATTCATGAAAGAGGG - Intergenic
1079793743 11:24772303-24772325 GTGTGTTTATTGAGGCAAGAAGG - Intronic
1080042252 11:27771135-27771157 GTGTGACCAGTGAGAAAAGAAGG + Intergenic
1080195588 11:29604734-29604756 CTGTGACTAAAGGGGAAATAAGG + Intergenic
1080793100 11:35538674-35538696 CTGTGACTCTTGAGGGCACAAGG - Intergenic
1081613025 11:44574584-44574606 TTCTGATTATTGAAGAAAGAGGG + Intronic
1084934942 11:72581819-72581841 ATGTGACAGTAGAGGAAAGAGGG + Intronic
1085995356 11:81906009-81906031 ATCTGACTCTTCAGGAAAGATGG + Intergenic
1087339210 11:96881229-96881251 ATGTGTCTCATGAGGAAAGAAGG - Intergenic
1087896793 11:103595025-103595047 CTGTGAAGATTGAATAAAGATGG + Intergenic
1087902046 11:103651814-103651836 CTGTGACGCTAGAGGTAAGATGG - Intergenic
1089634016 11:119800869-119800891 CTGTGCATTGTGAGGAAAGAAGG - Intergenic
1090045723 11:123331204-123331226 CTGTGCATATTGAGCAAAGTGGG + Intergenic
1090730775 11:129571953-129571975 CTCTGCCTATTGTTGAAAGAGGG - Intergenic
1091714211 12:2765525-2765547 CAGTGACTGAGGAGGAAAGAGGG + Intergenic
1092032390 12:5298135-5298157 CTTTGTCTATTTAGGAATGATGG + Intergenic
1092107031 12:5928543-5928565 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107037 12:5928617-5928639 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107043 12:5928691-5928713 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107049 12:5928765-5928787 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107055 12:5928839-5928861 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107061 12:5928913-5928935 AAGTGACTAATGAGGAAATAAGG - Intronic
1092107067 12:5928987-5929009 AAGTGACTAATGAGGAAAGAAGG - Intronic
1092107073 12:5929061-5929083 AAGTGACTAATGAGGAAAGAAGG - Intronic
1092107079 12:5929135-5929157 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107086 12:5929209-5929231 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107092 12:5929279-5929301 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107098 12:5929353-5929375 GAGTGACTAATAAGGAAAGAAGG - Intronic
1092107104 12:5929427-5929449 GAGTGACTAATAAGGAAAGAAGG - Intronic
1092107110 12:5929501-5929523 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107117 12:5929575-5929597 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107130 12:5929719-5929741 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107138 12:5929793-5929815 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107145 12:5929867-5929889 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107152 12:5929941-5929963 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107159 12:5930015-5930037 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107166 12:5930089-5930111 AAGTGACTAATAAGGAAAGAAGG - Intronic
1092107398 12:5931549-5931571 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107404 12:5931623-5931645 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107410 12:5931697-5931719 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107416 12:5931771-5931793 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107422 12:5931845-5931867 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107428 12:5931919-5931941 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107434 12:5931993-5932015 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107440 12:5932063-5932085 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107446 12:5932137-5932159 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107452 12:5932207-5932229 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107459 12:5932281-5932303 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107471 12:5932429-5932451 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107478 12:5932503-5932525 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107485 12:5932577-5932599 AAGTGACTAATAAGGAAAGAAGG + Intronic
1092107491 12:5932651-5932673 AAGTGACTAATAAGGAAAGAAGG + Intronic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1094390247 12:29941123-29941145 CTGTGACAATTTAAGCAAGAGGG + Intergenic
1095430152 12:42125431-42125453 CTGTGACTATTCAGGGAATGGGG + Intronic
1099488966 12:83264446-83264468 ATATGACTATAGAGGAAGGAAGG + Intergenic
1099950053 12:89291888-89291910 GTGTGACTGCTGTGGAAAGAAGG + Intergenic
1100385014 12:94098058-94098080 CCGAGGCTATTCAGGAAAGAGGG - Intergenic
1102397233 12:112597178-112597200 CTGTGATTGTTGAGAAAAGACGG + Intronic
1102483496 12:113240318-113240340 GTGTGTCTATTGAGGAGTGATGG + Intronic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1106606269 13:31232001-31232023 CTGTCAGGATTGAGGCAAGATGG + Intronic
1108838951 13:54587650-54587672 CTATGAATACTGAGGATAGAAGG + Intergenic
1109942026 13:69381067-69381089 CCATGACTATTGAGGAATAAAGG + Intergenic
1110261038 13:73485599-73485621 CTCAGACTCTTCAGGAAAGAAGG + Intergenic
1110760854 13:79228868-79228890 CTGTGACAAAGGGGGAAAGATGG - Intergenic
1113878860 13:113611416-113611438 CTGTGCTGTTTGAGGAAAGATGG + Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1118026227 14:61771789-61771811 CTTTGAAACTTGAGGAAAGAAGG + Intronic
1119920723 14:78443519-78443541 CTGTAACTCTTAAGGAGAGAAGG - Intronic
1120533060 14:85657311-85657333 CTGTGACTACTGAGATAAAAGGG + Intergenic
1121641853 14:95490007-95490029 CTCTGACCATTGAGGAAACTGGG - Intergenic
1121958739 14:98239164-98239186 CTGTGACTTATATGGAAAGAAGG + Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1125509704 15:40286371-40286393 TGGTGACACTTGAGGAAAGAAGG - Intronic
1125745848 15:41996736-41996758 GAGAGACAATTGAGGAAAGAAGG + Intronic
1126420166 15:48464187-48464209 GTGTGCCTTTTGAGGAAAGAGGG + Intronic
1128578280 15:68790954-68790976 CTGTGACTTCTGGGGAGAGAGGG - Intronic
1130098931 15:80877292-80877314 CTGTGTCTCTTGAGCAAAGAAGG - Intronic
1131666484 15:94576550-94576572 CTGAGACAAATGAGCAAAGACGG + Intergenic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1133071323 16:3248629-3248651 CGGTGACTACTGCAGAAAGATGG - Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1137740044 16:50760433-50760455 CTGTGACTAGTGAGAAACGAAGG - Intronic
1138614766 16:58156688-58156710 AAGTGACTATGGAGGAAAGCAGG - Intergenic
1140140561 16:72252648-72252670 CTGTGACTATTGTCAAATGATGG - Intergenic
1142158774 16:88546576-88546598 GTGTGACTGTTGTGGAAAGTAGG - Intergenic
1144995846 17:19267925-19267947 TTGTTACTATTGAGAAGAGATGG + Intronic
1146791031 17:35750609-35750631 CTGTGACTGTGGATGAGAGAAGG + Intronic
1147369165 17:39980028-39980050 TTGGGAGTGTTGAGGAAAGAGGG - Intergenic
1150525443 17:65917694-65917716 CTGTGCCTCGTGAGAAAAGAAGG - Intronic
1151178844 17:72311235-72311257 ATGTGACTTTTTTGGAAAGAGGG + Intergenic
1155276193 18:24189829-24189851 CTGTGAGGACTGAGGACAGAAGG - Intronic
1155421179 18:25658286-25658308 CTATGAGGATTGAGGAAAAAGGG - Intergenic
1156164649 18:34403627-34403649 TAGTGACTCTTGAGGGAAGAAGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158872590 18:61702762-61702784 ATGAAACTATTCAGGAAAGAAGG + Intergenic
1159387282 18:67742459-67742481 CTGTGCCCATTGAGGAGGGATGG - Intergenic
1159617953 18:70603382-70603404 CTGTAAAGATTGAGGAGAGAGGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1162494452 19:11015632-11015654 CTGAAATTATTGAGGAAAGTAGG - Intronic
1165423186 19:35732375-35732397 CTGTGACGACTGAGGTAGGAGGG - Exonic
1165706754 19:37981774-37981796 CCGTGAGTATTTAGGAAAGGAGG + Intronic
1168195682 19:54772090-54772112 CTGTGACTATTTATGATATAGGG + Intronic
1168592619 19:57649970-57649992 ATGTTACTATTGGGGAAAGTAGG + Intergenic
925994696 2:9282805-9282827 CTGTGACAAATCAGGAAAGCAGG - Intronic
926457239 2:13081891-13081913 CTGGGACTATGGAGAAATGAAGG - Intergenic
927494032 2:23540504-23540526 ATGTGACTCTTTGGGAAAGAGGG - Intronic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
928061739 2:28120617-28120639 TAGTGACTATTGAGTAAACACGG + Intronic
931772775 2:65512997-65513019 CTGTGACCATGCAAGAAAGAAGG + Intergenic
932143090 2:69296831-69296853 CTGTGGCTGGTGTGGAAAGAGGG - Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
935822404 2:106907337-106907359 CTGTTACTCTTTAGGAAATAGGG - Intergenic
936627480 2:114163848-114163870 CTGTGACTATGGGGGAGAGAAGG + Intergenic
939999447 2:148952105-148952127 CTGAGACCCTTGAGGAAAGTAGG - Intronic
943435193 2:187856881-187856903 CTGTGACTTTGGGAGAAAGAAGG + Intergenic
943744923 2:191452265-191452287 CTGTGAGGCCTGAGGAAAGAAGG + Intergenic
944946192 2:204688662-204688684 ATATGTCTATTGTGGAAAGAAGG + Intronic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1170748687 20:19124460-19124482 CTGAGAGTATTGAGGAATGCGGG + Intergenic
1171006787 20:21474026-21474048 CTGTCCATATTGAGAAAAGATGG - Intergenic
1173141565 20:40489430-40489452 CTGTGCCAATTTAGCAAAGATGG - Intergenic
1174044567 20:47724378-47724400 CTGTGGCTATTGAGGAAGACTGG + Intronic
1174876848 20:54235819-54235841 CTGTGCCTATTGAAGAAATGTGG + Intergenic
1175991788 20:62793510-62793532 CTGTGCCTATTGAGAAAAGATGG - Intergenic
1181655083 22:24290360-24290382 TTATGACTTATGAGGAAAGATGG - Intronic
1182846118 22:33432321-33432343 CAGTGACTATTGAAGACACAGGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183457956 22:37932953-37932975 CTGTTACTGATGAGGGAAGAGGG - Intronic
949821868 3:8124384-8124406 CTGTGAATATTCATGAAAGGGGG + Intergenic
951408889 3:22337605-22337627 CTGTGACTATTAAGCAAATTGGG - Intronic
953486499 3:43302574-43302596 CTGGGGATATTGAGGAGAGAAGG + Intronic
955367584 3:58324976-58324998 CTAAGGCTAATGAGGAAAGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
960519992 3:118643677-118643699 CTGTGACTATACAAGAAAGATGG - Intergenic
960573752 3:119209614-119209636 TTCTGACTCTTGAGGTAAGAGGG - Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962363271 3:134759296-134759318 CTGTGACTTTTTAGGAATCAGGG + Intronic
964225071 3:154389197-154389219 TTGTTTCCATTGAGGAAAGATGG - Intronic
964668786 3:159202879-159202901 GTGTGCCTTTTGAGGAAAGGAGG + Intronic
967407057 3:189128286-189128308 CTGTCAGTATTGTGCAAAGACGG + Intronic
967930995 3:194690000-194690022 CTGGAACCATAGAGGAAAGAGGG + Intergenic
971260221 4:25050299-25050321 CCGTGAATATCGAGGAAAAATGG - Intergenic
972280922 4:37601554-37601576 CTGTGCCAATCCAGGAAAGATGG + Intronic
973913220 4:55605033-55605055 CTGTGGACATTGAGGAAAGCTGG - Intronic
974968598 4:68797218-68797240 CTTTGACTATTGAGATAAGTAGG + Intergenic
975001761 4:69232881-69232903 CTTTGACTATTGAGATAAGTAGG - Intergenic
975003683 4:69259213-69259235 CTTTGACTATTGAGATAAGTAGG + Intergenic
975012044 4:69367809-69367831 CTTTGACTATTGAGATAAGTAGG + Intronic
978160626 4:105543195-105543217 CTGTGACCAAAGTGGAAAGAAGG + Intergenic
978778986 4:112530297-112530319 CTGTGACTATCTAGGAATCAAGG - Intergenic
979102360 4:116635824-116635846 GTGTTATTATTGAGTAAAGAGGG - Intergenic
980006357 4:127546850-127546872 CTGTTACTGTTGAGGAGAGATGG - Intergenic
981113399 4:140960695-140960717 CCCTGACTCTTGAGTAAAGATGG + Intronic
982236314 4:153254077-153254099 GTGTGACTAGGGAGGACAGAAGG + Intronic
985177554 4:187217578-187217600 ATGTTACTATTGAGGAAAATTGG + Intergenic
986888480 5:12270268-12270290 CTGAAAGTATTGAGGAAAAAGGG + Intergenic
990864151 5:60362086-60362108 CTGGGAATAGTGAGGAGAGAAGG + Intronic
992127589 5:73657707-73657729 CTTTGATGAGTGAGGAAAGAAGG - Intronic
996428412 5:123341323-123341345 CTGTGACTAATTTGCAAAGAAGG - Intergenic
996770211 5:127077774-127077796 CTGACACTGTTGAGGAAAGATGG + Intergenic
996919020 5:128745649-128745671 CTATGATTGTTTAGGAAAGAAGG + Intronic
996924994 5:128814401-128814423 CTCTGACTTTTGAGGAAGTATGG - Intronic
1003162096 6:3644802-3644824 CTGTGACTTCTGAAGAAGGAAGG + Intergenic
1005384839 6:25275604-25275626 CTATGACAAGTGAGGAAATAAGG - Intergenic
1007181443 6:39932048-39932070 CTGTGAGGATTGCGGAAAGGGGG - Intronic
1007296970 6:40831046-40831068 ATGTTACCATTGAGGGAAGATGG + Intergenic
1008346918 6:50438897-50438919 GAGTGGCTAATGAGGAAAGAGGG + Intergenic
1009307931 6:62114907-62114929 CTCTCACTATTGAGAAAACATGG + Intronic
1012739408 6:102995840-102995862 GTGTGATGATTGATGAAAGATGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014259192 6:119196891-119196913 TTGTTACTATTGAGGCCAGATGG - Intronic
1015960614 6:138645339-138645361 AGGTGACTTTTGAGCAAAGATGG - Intronic
1016047962 6:139499719-139499741 CTGTCAATATAGAGGAAACAGGG - Intergenic
1016290527 6:142524014-142524036 CTTTCACTATTGGGGAAAAAGGG - Intergenic
1017198186 6:151724335-151724357 CTGTCAGTCTTGAGGAAGGAGGG - Intronic
1017315484 6:153026516-153026538 CTGTGAGGAATGAAGAAAGAGGG - Exonic
1019566682 7:1685150-1685172 CAGAAACTATGGAGGAAAGAAGG - Intergenic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1021662455 7:22933746-22933768 CTTTGATTAATGAGTAAAGATGG - Intergenic
1021863702 7:24932964-24932986 ATTTGAATATGGAGGAAAGACGG - Intronic
1022611625 7:31880746-31880768 CTGTGTATATTGATGAAACAAGG - Exonic
1024592184 7:50897961-50897983 CTGTGTCTATTGAGAAAATCAGG - Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1027632147 7:80620296-80620318 TTGTGACTAGTGTTGAAAGAAGG - Intronic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1032557201 7:132848886-132848908 CTGGGAGCATTGAGTAAAGACGG - Intronic
1032836253 7:135677595-135677617 GTGTGACTATAGAGAAAAGTAGG + Intronic
1034040239 7:147870242-147870264 CTGACCCTATGGAGGAAAGAGGG + Intronic
1034050422 7:147978198-147978220 ATATGAATATAGAGGAAAGATGG - Intronic
1036630831 8:10513716-10513738 CAGTGACATTTGAGGAAAGATGG + Intergenic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1044351036 8:91166965-91166987 CTGTGACTATCCAGCAAAGTGGG - Intronic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1047027565 8:120840661-120840683 CTGGGACTATTGAGAGCAGAGGG + Intergenic
1047495429 8:125405426-125405448 CTGAGACTCCTGAGGACAGAGGG + Intergenic
1047801526 8:128315222-128315244 TTCAGCCTATTGAGGAAAGACGG - Intergenic
1048235803 8:132689091-132689113 ATGTGATTAGAGAGGAAAGATGG + Intronic
1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG + Intergenic
1050493478 9:6214653-6214675 TTGTGAGTAATGAAGAAAGATGG - Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1052776516 9:32738612-32738634 CTCAGACTATTGTGAAAAGAGGG - Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053444307 9:38140030-38140052 CTGTGACTCTTGATGATAAAAGG - Intergenic
1056394341 9:86167966-86167988 CTGTGAATATTTATGAAAGAGGG + Intergenic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1185846267 X:3440943-3440965 CCCTGACCATTGAGGAAGGATGG + Intergenic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1188799187 X:34505978-34506000 CTGTGACTATAGAGGAGAAAAGG - Intergenic
1189236157 X:39488956-39488978 CTATGCCTATTTAGGAAAGGTGG - Intergenic
1189686685 X:43571880-43571902 TAGTGAATATTGAGGAATGAAGG + Intergenic
1190388757 X:49911117-49911139 ATGTGACTATTGGGGAAATCTGG - Intergenic
1191909105 X:66128264-66128286 CTGTGTCTATTGAGATAATAAGG + Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193292737 X:79795248-79795270 CTAAGACTCTTGGGGAAAGATGG + Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193552329 X:82911270-82911292 GTGTGTCTTTTGAGGAAAGAAGG - Intergenic
1195388971 X:104341284-104341306 ATGTGATTCTTGAGGATAGAGGG + Intergenic
1195505148 X:105647745-105647767 TTGTGACTATTGAGGAGAAAGGG - Intronic
1198422695 X:136483288-136483310 CAGGGAATATTTAGGAAAGATGG - Intergenic
1199713862 X:150492012-150492034 CTGTCACTGTTGAGGACAGTGGG + Intronic
1200870429 Y:8092266-8092288 ATGTCACTATTCAGGAAAGCAGG + Intergenic
1200890161 Y:8314828-8314850 ATGTCACTATTCAGGAAAGCAGG - Intergenic
1202245216 Y:22813057-22813079 ATGTCACTATTCAGGAAAGCAGG - Intergenic
1202398206 Y:24446803-24446825 ATGTCACTATTCAGGAAAGCAGG - Intergenic
1202472575 Y:25223283-25223305 ATGTCACTATTCAGGAAAGCAGG + Intergenic
1202578246 Y:26350387-26350409 CTGAGACTATAAGGGAAAGAAGG - Intergenic