ID: 1105674215

View in Genome Browser
Species Human (GRCh38)
Location 13:22652894-22652916
Sequence AGATTAATGGCACCATTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105674215_1105674217 8 Left 1105674215 13:22652894-22652916 CCTGATAATGGTGCCATTAATCT 0: 1
1: 0
2: 1
3: 15
4: 96
Right 1105674217 13:22652925-22652947 CAGACTTGAGCAGACTCTAGCGG 0: 1
1: 0
2: 0
3: 8
4: 92
1105674215_1105674218 9 Left 1105674215 13:22652894-22652916 CCTGATAATGGTGCCATTAATCT 0: 1
1: 0
2: 1
3: 15
4: 96
Right 1105674218 13:22652926-22652948 AGACTTGAGCAGACTCTAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105674215 Original CRISPR AGATTAATGGCACCATTATC AGG (reversed) Intergenic
903739669 1:25551557-25551579 AGAATAACAGCACCATCATCAGG - Intronic
906253968 1:44333236-44333258 AGATTAAATGCACCAAAATCAGG - Intronic
916065003 1:161129259-161129281 AGATTCTTGGAACCCTTATCTGG - Intronic
1065773580 10:29099813-29099835 AGATTAATTGCATCATTACCTGG + Intergenic
1067924745 10:50496816-50496838 ACATTACTGGCACCATTTTGCGG - Intronic
1070275336 10:75000588-75000610 ATATTAATGGCAAGTTTATCTGG - Intronic
1073034701 10:100555464-100555486 AGATTAATGGGATCATGATGTGG - Exonic
1075385805 10:122054538-122054560 ATATTAATAGCTCCATTATCTGG - Intronic
1077275433 11:1704607-1704629 AGAATACTGGCACCTTGATCTGG - Intergenic
1079028808 11:16969826-16969848 AGGATATTGGCACCAGTATCTGG - Intronic
1079640394 11:22797631-22797653 GTATTAATGTTACCATTATCTGG - Intronic
1080544066 11:33298617-33298639 TGATTCATGGCAGCATTAACAGG + Intronic
1084545168 11:69811805-69811827 AGATTAATGGGACCCTTGTCAGG + Intronic
1085708768 11:78810529-78810551 AGATGAAGGTCACCATTCTCTGG + Intronic
1090044785 11:123321543-123321565 TGATTAAAGTCACCATCATCTGG - Intergenic
1091128393 11:133122728-133122750 AGATGAATGTCAGCATCATCTGG - Intronic
1093386085 12:18556203-18556225 TGTTTAATGGCAGCATTAGCAGG - Intronic
1097793582 12:63840438-63840460 ATATTAATGCCACCATTAGTAGG - Intergenic
1098387776 12:69936721-69936743 AGAAGCATGGAACCATTATCTGG - Intronic
1099600652 12:84732734-84732756 AAATAAATGGCTCCATTAACTGG - Intergenic
1100736834 12:97544521-97544543 AGAAGAATGGCACAATTTTCAGG + Intergenic
1101269811 12:103131727-103131749 ATATTACTGCCACCACTATCAGG - Intergenic
1102406067 12:112675393-112675415 ACATTAATGGAACCATTAACTGG + Intronic
1105674215 13:22652894-22652916 AGATTAATGGCACCATTATCAGG - Intergenic
1109070470 13:57759909-57759931 ATATTTATGACACCATTATATGG - Intergenic
1109917293 13:69006796-69006818 AGATTAAAAGCAATATTATCAGG - Intergenic
1110096244 13:71525403-71525425 GGATTAATGAAAACATTATCTGG + Intronic
1111955553 13:94753566-94753588 AAAGTAATGGCCCCATTATGTGG + Intergenic
1114157446 14:20120673-20120695 ATAGTAATGGCAGCAGTATCTGG - Intergenic
1114433663 14:22685591-22685613 AGAGTAATGCCAACATTTTCTGG - Intergenic
1115607236 14:35015783-35015805 AAAGTAAAGGCACAATTATCTGG - Intronic
1115632824 14:35262495-35262517 AGAGTAATGTCACCATTTTCTGG - Intronic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1120151142 14:81035402-81035424 AGAATCATTTCACCATTATCAGG - Intronic
1121910746 14:97790207-97790229 AGAGAAATGGGACCATTAGCAGG + Intergenic
1125025088 15:35021635-35021657 GGATTCTTGGCACCATAATCTGG - Intergenic
1128506007 15:68273320-68273342 ATAATAATGTCACCCTTATCTGG - Intergenic
1135148150 16:19981268-19981290 ATATTAATTGTACCATTTTCGGG - Intergenic
1137820637 16:51441459-51441481 AAAGTAATGCCACCATTTTCAGG - Intergenic
1140850492 16:78930627-78930649 AGTTTGAAGGCACCATTATTTGG + Intronic
1144402821 17:14922817-14922839 AGAGAAATGGCACCATTATTTGG + Intergenic
1146303975 17:31715685-31715707 AGAGGCATGGCACCAGTATCTGG - Intergenic
1148573655 17:48691636-48691658 AGAGTAATGTCAACATTTTCTGG + Intergenic
1155348329 18:24880698-24880720 ATACTAATGGCATCTTTATCAGG + Intergenic
1158601711 18:58861904-58861926 AGAGTACTGGCACCGTTTTCAGG + Intergenic
1158747212 18:60214929-60214951 AGATTAATACCACAATTATTGGG - Intergenic
1158813213 18:61061936-61061958 AGATTAATGCCAGCCTTAGCTGG - Intergenic
1163076162 19:14893647-14893669 AAATTAAAGGCATCAGTATCTGG - Intergenic
1166706395 19:44910286-44910308 AGAATAAAGGCACCAATCTCAGG - Intergenic
928816589 2:35302678-35302700 GCATTAATGGCACCAATAGCAGG + Intergenic
930444948 2:51458573-51458595 AGATTAATTGCATCTTAATCTGG + Intergenic
930924169 2:56796324-56796346 ACATTAATGGGAAGATTATCAGG - Intergenic
931047831 2:58376402-58376424 AGAATAAAGGCACCATTTGCTGG + Intergenic
934837588 2:97604846-97604868 AAATTAATGGCACCTGGATCTGG + Intergenic
935725930 2:106024054-106024076 AGAAAAATGGCACCATTGTCAGG + Intergenic
937564527 2:123267966-123267988 ATATTAATGACTACATTATCAGG - Intergenic
938320487 2:130359287-130359309 ACATTAATGGCAACTTCATCCGG + Exonic
943085927 2:183311101-183311123 AGATTAATGGCCAAATTAACTGG + Intergenic
1169664003 20:8014405-8014427 AGATTAATTGCTCTTTTATCAGG - Intronic
1169666860 20:8047252-8047274 AGATGAAAGGCACAATTGTCTGG - Intergenic
1172394299 20:34588862-34588884 AGATTCATTGCACCATTGTTTGG + Intronic
1173081895 20:39876377-39876399 AGATCAATGTCACCATAACCAGG + Intergenic
1174372660 20:50103329-50103351 ACATTCACAGCACCATTATCTGG + Intronic
1174916470 20:54659348-54659370 ACATTAAGGGCACCATGAACAGG + Intergenic
1178774703 21:35538591-35538613 AGGTTAATGGCACAATTATTAGG - Intronic
1180253805 21:46607954-46607976 AGATTAATGCCACCATTAAAGGG + Intergenic
952696490 3:36270332-36270354 AGTTTAAAGGCACCTATATCTGG + Intergenic
957864466 3:86004296-86004318 AGATTAATGGCATCATTGGAAGG + Intronic
960438486 3:117657010-117657032 AGGTTAATGTCACCAGTAACAGG - Intergenic
963523570 3:146387512-146387534 AGATAAATGAAATCATTATCTGG + Intergenic
966049606 3:175598538-175598560 AGATTATTGTCACCATTTTATGG + Intronic
969968431 4:11021126-11021148 AGACTGATGGCACCTCTATCAGG - Intergenic
972400593 4:38698687-38698709 AGATAAATAGCACCATTATTGGG + Exonic
972706414 4:41548509-41548531 TGATTAATGACACCATCAACTGG + Intronic
977691941 4:99921935-99921957 AAAATAATGGCACTATTTTCTGG + Intronic
977848613 4:101796955-101796977 AGAAATATGGCACCATTAACAGG + Intronic
979347730 4:119608426-119608448 AGAGTAATGACACCATTAACTGG - Intronic
982261500 4:153498221-153498243 AGATCAAGGGCACCATGCTCAGG - Intronic
983909165 4:173217170-173217192 AACTTAATGGCACCATTCTCTGG - Intronic
985147694 4:186910891-186910913 AAATCAATGGCAATATTATCTGG - Intergenic
986094953 5:4545445-4545467 AGAAAAATGGCATCATTTTCAGG + Intergenic
986577692 5:9229593-9229615 ATATTAATGACACCATCATAAGG + Intronic
991720031 5:69486809-69486831 AGAATATTGGCACAATTATAAGG - Intergenic
993077304 5:83249716-83249738 AAATTATTGGCATGATTATCTGG - Intronic
996229639 5:121045946-121045968 AGATTACTAACAACATTATCAGG - Intergenic
996302345 5:122003641-122003663 AAATTAATACCACCATTATGAGG - Intronic
1007608489 6:43133039-43133061 AGATTACTGGCTCCATTTTATGG - Intronic
1009471860 6:64036432-64036454 AGATTAATGTCACTAATGTCTGG - Intronic
1009832743 6:68959855-68959877 AGATAAATGAAACCATTATCTGG - Intronic
1010420358 6:75666971-75666993 AGATTAATGCCTCCATTTTGGGG + Intronic
1012927920 6:105286221-105286243 TGATAAAAGGAACCATTATCAGG - Intronic
1014906530 6:127036529-127036551 TTAATAATGGCACCAGTATCAGG + Intergenic
1017561164 6:155629474-155629496 AGATTAATGTCATTATTATGGGG - Intergenic
1021923772 7:25514758-25514780 AGAATACTGGGGCCATTATCAGG - Intergenic
1026134262 7:67645586-67645608 AGCTTACTGGCACCATTCTTGGG - Intergenic
1028175026 7:87645634-87645656 ATATTAATGTCATCATTATCAGG + Intronic
1028462877 7:91115955-91115977 AGAATAATGGTACAGTTATCTGG + Intronic
1032233293 7:130096242-130096264 AAATTAATGGAACTATTATGGGG - Intronic
1033310541 7:140258694-140258716 AGATTAAGGTCAACATTATTTGG + Intergenic
1033558983 7:142513174-142513196 AGATTCAGGGCACCTCTATCAGG - Intergenic
1036637648 8:10563039-10563061 AGATAAATGTCAACATTTTCTGG - Intergenic
1038863761 8:31416102-31416124 AGATAAATGGCACCTTTATCAGG + Intergenic
1041218785 8:55628419-55628441 AGATTAATGTCACAATAATGGGG - Intergenic
1044336678 8:90992202-90992224 AGAAAAATGGCACCATGACCAGG - Intergenic
1046453450 8:114424367-114424389 ATAATAATGGCAACAATATCTGG - Intergenic
1048144927 8:131832152-131832174 TGATTAATAGCACCATTACCTGG + Intergenic
1049120855 8:140735939-140735961 TGCATAAAGGCACCATTATCTGG + Intronic
1053527442 9:38844447-38844469 AGATAAAAGTCACCATTATGAGG - Intergenic
1054199667 9:62068876-62068898 AGATAAAAGTCACCATTATGAGG - Intergenic
1054638688 9:67519481-67519503 AGATAAAAGTCACCATTATGAGG + Intergenic
1059871203 9:118579699-118579721 ATATTAATGACACAATAATCTGG + Intergenic
1198231387 X:134692861-134692883 AGATTAAGGGCAAAATTATTAGG + Intronic
1198740248 X:139834721-139834743 AGATAAATGGCAAGAATATCAGG + Intronic