ID: 1105674978

View in Genome Browser
Species Human (GRCh38)
Location 13:22661450-22661472
Sequence ATACAGCAGGACAACCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105674973_1105674978 29 Left 1105674973 13:22661398-22661420 CCTATCCATATTACAAAAGATGC 0: 1
1: 1
2: 11
3: 28
4: 232
Right 1105674978 13:22661450-22661472 ATACAGCAGGACAACCTTCTAGG 0: 1
1: 0
2: 1
3: 7
4: 125
1105674974_1105674978 24 Left 1105674974 13:22661403-22661425 CCATATTACAAAAGATGCTGAAG 0: 1
1: 0
2: 5
3: 21
4: 330
Right 1105674978 13:22661450-22661472 ATACAGCAGGACAACCTTCTAGG 0: 1
1: 0
2: 1
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105674978 Original CRISPR ATACAGCAGGACAACCTTCT AGG Intergenic
900980214 1:6041946-6041968 ATACACCAGCACACCCTGCTCGG - Intronic
902150874 1:14442429-14442451 ATACAGCAGCAAAACCTCCAAGG - Intergenic
906314593 1:44778108-44778130 TTCCAGCAGGGCAAGCTTCTTGG + Exonic
907232461 1:53012705-53012727 TTAAACCAGGACAACCTTTTTGG - Intronic
907700245 1:56779359-56779381 ATAAATCAGAACAAGCTTCTTGG + Intronic
910279815 1:85486998-85487020 CTACAGAAGGACAATGTTCTGGG + Intronic
912959228 1:114180706-114180728 ACACAGCAGGACACACTTCCTGG + Intergenic
915429986 1:155859222-155859244 ATACAGCAGCAAAATGTTCTCGG - Intronic
916570207 1:166018957-166018979 AGAAAGCAGGACCACATTCTAGG + Intergenic
916974993 1:170066745-170066767 AAACAGGAGGACTACCTCCTAGG + Intronic
920459662 1:206129482-206129504 ATACAGCAGGCCAGGCTTCAGGG + Intergenic
920545953 1:206818580-206818602 ATAGAGCAGGAGAAACTGCTGGG + Intronic
920822909 1:209398109-209398131 AAACAGCAGGACACTCTCCTTGG - Intergenic
921019968 1:211226446-211226468 CTACAGCAGGTCAAACATCTAGG + Intergenic
921137141 1:212271800-212271822 ATACAGCACTATATCCTTCTGGG - Intergenic
921312448 1:213857747-213857769 ACACAGCAGGACGTCCTGCTTGG + Intergenic
924624178 1:245686261-245686283 AGACGGCAGGACCCCCTTCTGGG - Exonic
1066255745 10:33676956-33676978 ATACAGTAGGACATCATGCTTGG - Intergenic
1067978225 10:51050673-51050695 ATACAGCAGTCTCACCTTCTGGG - Intronic
1068309426 10:55259149-55259171 ATACAGCAGGGGTACCATCTGGG - Intronic
1070158891 10:73853537-73853559 ATATCCCAGGACCACCTTCTCGG - Intronic
1072291188 10:93966691-93966713 ATACATCAGGACACTTTTCTAGG - Intergenic
1077719222 11:4610173-4610195 AGTCAGCAGGAGAACCTGCTAGG + Intergenic
1079013759 11:16851306-16851328 ATGCATCAGAACAACCTTCTGGG + Intronic
1080403689 11:31959606-31959628 AAACAGCAGGAAAACCTCCTTGG - Intronic
1083740022 11:64704402-64704424 ATAGAGCAAGGCTACCTTCTAGG - Intronic
1085338487 11:75715792-75715814 ACACAGCAGGAGAAACTGCTGGG - Intergenic
1089198579 11:116710002-116710024 ATGCAGCAGGACACCCATCCTGG - Intergenic
1091372804 11:135074935-135074957 ATACAGCATTACAATCTTGTGGG + Intergenic
1091487247 12:901431-901453 ACACAGAAGAACAAGCTTCTGGG - Intronic
1092981580 12:13799844-13799866 ATGCATCAGGAGAACCTGCTAGG + Intronic
1094163867 12:27422117-27422139 ATACTGCATGTCTACCTTCTCGG + Intronic
1094450477 12:30578396-30578418 ACAGAGCAGGGCAACCTTCCAGG - Intergenic
1099426980 12:82535423-82535445 ATTCTGCAGGACCACCTTATGGG + Intergenic
1099986426 12:89670883-89670905 ATACAACAGAAGAACCTTCTTGG + Intronic
1105674978 13:22661450-22661472 ATACAGCAGGACAACCTTCTAGG + Intergenic
1106670687 13:31901337-31901359 ACTCATCAGGACATCCTTCTTGG - Intergenic
1107794431 13:44035464-44035486 TCACTGCAGGTCAACCTTCTGGG - Intergenic
1108410465 13:50141326-50141348 AGACAGCAGCACAAACATCTGGG + Intronic
1108944817 13:56009118-56009140 ATAGAGAGAGACAACCTTCTGGG + Intergenic
1110960369 13:81614721-81614743 ATACACCAGAACTTCCTTCTTGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112429289 13:99336412-99336434 ATACAGAAGGAATACCTTTTTGG - Intronic
1113741635 13:112715627-112715649 ATACAGAGGGGCAACCCTCTGGG - Intronic
1114661124 14:24345589-24345611 AAACAGCAGGACACCCAGCTAGG - Intergenic
1114847541 14:26341334-26341356 ATAAAACAGTACAACCTTTTTGG - Intergenic
1116828216 14:49692695-49692717 CTACAGCCGTACCACCTTCTGGG - Intergenic
1120583592 14:86284422-86284444 ATACAGCAGGACAACCTGGTGGG + Intergenic
1120960628 14:90121387-90121409 CCACATCAGGAAAACCTTCTGGG + Intronic
1121592817 14:95131363-95131385 GTACATCAGGACTAGCTTCTAGG + Intronic
1123820329 15:24023135-24023157 ATGCAGCAGGACAAAATTTTAGG - Intergenic
1123824429 15:24067301-24067323 ATACGACAGGACATGCTTCTTGG - Intergenic
1124698576 15:31889700-31889722 ATACAGCAGGTCAAATTTGTGGG - Intergenic
1124898541 15:33800068-33800090 AAACTGCAGTTCAACCTTCTTGG + Intronic
1125574910 15:40748589-40748611 ATAAAGAAGTACAAACTTCTGGG - Intronic
1126936496 15:53714861-53714883 ATACAGCAGGGCAAAATTCCAGG + Intronic
1134477440 16:14588003-14588025 ATACAGCATAACCCCCTTCTAGG - Intronic
1135413844 16:22254251-22254273 TTACAGCAGGGCCACCTGCTGGG - Intronic
1136519347 16:30786305-30786327 ACACAGCAGGGCATCCTTCCCGG - Intronic
1139798522 16:69502397-69502419 CTACAGCAGCAAAACCTTCCTGG - Intergenic
1146476001 17:33163242-33163264 AAACAGCAGCATGACCTTCTAGG + Intronic
1155460827 18:26080899-26080921 ATATAACAGGACAACCATCATGG + Intronic
1155583137 18:27334799-27334821 ATACTGCATGAAAACCTTCCAGG - Intergenic
1157769554 18:50333793-50333815 ATGCAGCAGGACAAAATTTTAGG - Intergenic
1158038073 18:53058860-53058882 AAAAATCAGGACATCCTTCTTGG + Intronic
1163939623 19:20479850-20479872 ATTCTGAAGGACAGCCTTCTAGG - Intergenic
1166246592 19:41531878-41531900 ATAGAGGAGGAGAAACTTCTTGG - Intergenic
1167320914 19:48796748-48796770 CTGCAGCAGGGCAACCCTCTGGG - Intronic
1167507626 19:49879217-49879239 GGACAGCAGAACAACCTTCAAGG + Intronic
925653671 2:6121598-6121620 ATTCACCAGGAAAACCATCTGGG - Intergenic
928459375 2:31456553-31456575 ATACAACAGGACACTCCTCTCGG - Intergenic
933304465 2:80579946-80579968 ATACAGTAGGACCACATTCCAGG - Intronic
935853483 2:107248864-107248886 AGACAGCAGGTCAGCCTGCTGGG + Intergenic
936112231 2:109674503-109674525 CTACAGCCTCACAACCTTCTGGG - Intergenic
937899374 2:127006000-127006022 ATTCATCAGGAAAACCATCTGGG - Intergenic
937928366 2:127185178-127185200 ATTCAGCTGGACAAGTTTCTAGG - Exonic
938252422 2:129826183-129826205 ATACAGCAGGACTGCCAGCTAGG + Intergenic
938805917 2:134807173-134807195 CTACAGCAGGTCAACTATCTAGG - Intergenic
939129338 2:138215717-138215739 ATGTAGCTGGACAACCTTTTAGG + Intergenic
939875707 2:147575011-147575033 ACACAGAAGGACAACATTCAGGG + Intergenic
943774663 2:191751735-191751757 GTACAGAAGGAAAACTTTCTGGG + Intergenic
944156680 2:196614503-196614525 ATAAAGCAGAACTATCTTCTGGG - Intergenic
944411600 2:199448956-199448978 ATAGGACAGGAAAACCTTCTGGG - Intronic
945269806 2:207926627-207926649 ATTCAGCAGGACCGCCATCTGGG + Intronic
1169398937 20:5263042-5263064 ATAAAGCAGTACAACCTCTTTGG - Intergenic
1169671363 20:8106265-8106287 ATAGAGCTGGAAAACCTCCTTGG - Intergenic
1169937167 20:10896129-10896151 ATGCAGCTGGTCAACCTTCTTGG - Intergenic
1170176818 20:13480311-13480333 ATACAGAAGAACAATGTTCTGGG - Intronic
1174374125 20:50114120-50114142 ATAAAGGAGGAGTACCTTCTTGG - Intronic
1176061081 20:63173275-63173297 ATGCAGCAGGACACCCATTTAGG - Intergenic
1179934446 21:44593160-44593182 GGACAGCATGACAGCCTTCTGGG + Intronic
951519647 3:23599376-23599398 ATAAAGCAAGATCACCTTCTAGG + Intergenic
954640335 3:52093999-52094021 ATCCTGCAGAACATCCTTCTAGG - Intronic
957839372 3:85647363-85647385 ATAAATGAGGACAACATTCTAGG - Intronic
961605015 3:128087141-128087163 AAACAGCATGACAAGTTTCTCGG - Intronic
962124226 3:132598588-132598610 ATACATCAGGAAAGTCTTCTGGG + Intronic
970829263 4:20316950-20316972 ATACTGCAGGTCCTCCTTCTGGG - Intronic
971479157 4:27098960-27098982 ATGCAACAGGACAACCTTCCAGG + Intergenic
975537784 4:75470332-75470354 ATGAAGCAGGACAAACTTCCTGG + Intergenic
983932492 4:173468147-173468169 ATACAGCAGTATAATCTTATGGG - Intergenic
984821962 4:183889984-183890006 ATACAGCCTGAGAAGCTTCTAGG + Intronic
987318952 5:16749811-16749833 ACACATCAGGAACACCTTCTGGG - Intronic
987361657 5:17112608-17112630 AGCCAGCAGGGCAACCTGCTTGG + Intronic
987441376 5:17961185-17961207 ACACAGCAGAACACCCTTCAGGG + Intergenic
990546188 5:56823803-56823825 ATACTGCATGACAACTTTATAGG + Intronic
994807549 5:104470237-104470259 ATACAGTATTACAACCTTATGGG + Intergenic
999365950 5:151023518-151023540 AAACAGAAGGACCAGCTTCTGGG - Intronic
1002004305 5:176219628-176219650 ACACAGCAGGACAAAATTTTAGG + Intergenic
1002222069 5:177691001-177691023 ACACAGCAGGACAAAATTTTAGG - Intergenic
1003083473 6:3041681-3041703 ATACAGCAGGACAAAATTTTAGG + Intergenic
1005336066 6:24797821-24797843 TTACAGGAGGACCACCTGCTGGG - Exonic
1005372072 6:25144051-25144073 ATTCACCAGTACACCCTTCTGGG - Intergenic
1006930054 6:37682127-37682149 ATACAGCAGGGCCACCAGCTTGG + Intronic
1007211326 6:40195447-40195469 AGATAGCAGGACAACCCCCTAGG + Intergenic
1009958388 6:70486223-70486245 ACACAGAAAGACAACCATCTAGG + Intronic
1016430378 6:143977859-143977881 ATTCACCAGTACAACCATCTGGG + Intronic
1021599132 7:22346713-22346735 ATACAGGAAGACAACCAACTAGG + Intronic
1022193687 7:28042680-28042702 ATACAGCATTACAACCTTATGGG - Intronic
1030230994 7:107208390-107208412 ACACAGCAGGACAACTGTTTTGG + Intronic
1038317210 8:26496708-26496730 ATTCAGCAGTTCAGCCTTCTGGG - Intronic
1046653121 8:116861662-116861684 TTACAGAAGAACAACTTTCTAGG + Intronic
1046910494 8:119621038-119621060 ATACTGCAGGAAAACCATGTCGG - Intronic
1048315077 8:133355796-133355818 AAACACCAGGACAAGCTTGTGGG - Intergenic
1057504246 9:95619601-95619623 ATACAGCTGAACAATCCTCTAGG - Intergenic
1059217538 9:112580015-112580037 AACCAGCAGCACAACCATCTTGG - Intronic
1189867222 X:45343481-45343503 AGACATCAAAACAACCTTCTTGG - Intergenic
1194309868 X:92293007-92293029 ATACAGCATGACAACTGCCTTGG - Intronic
1195448941 X:104987670-104987692 ATGCAGGAGGGCAGCCTTCTTGG - Intronic
1197328004 X:125117781-125117803 ATAAAGTAGGACAACCTTTATGG + Intergenic
1197820654 X:130537889-130537911 ACACAGCAGGACAAAATTTTAGG + Intergenic
1199974951 X:152888968-152888990 ATAAGTCAGGGCAACCTTCTGGG - Intergenic
1200618161 Y:5407296-5407318 ATACAGCATGACAACTGCCTTGG - Intronic
1200968948 Y:9129335-9129357 ATACAAGAAGACAAACTTCTAGG - Intergenic
1202192391 Y:22258674-22258696 ATACAGCAGGTCAAATATCTAGG - Intergenic