ID: 1105679212

View in Genome Browser
Species Human (GRCh38)
Location 13:22708125-22708147
Sequence ACTTAGCATAAGGCAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105679212_1105679217 -9 Left 1105679212 13:22708125-22708147 CCCAGCCCTGCCTTATGCTAAGT 0: 1
1: 0
2: 1
3: 20
4: 208
Right 1105679217 13:22708139-22708161 ATGCTAAGTCTCCATGTCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105679212 Original CRISPR ACTTAGCATAAGGCAGGGCT GGG (reversed) Intergenic
900913264 1:5617175-5617197 CCTGAGCAGAAGGCAGGGCCAGG + Intergenic
902158461 1:14509335-14509357 ACTTAGCTTAAGTCAAAGCTGGG + Intergenic
902893019 1:19458644-19458666 ACCTTGCATAAGGCTGGGCATGG - Intronic
903490333 1:23723456-23723478 ACTCAGCAAGAGGCAGGGCGCGG - Intergenic
903556928 1:24200824-24200846 ACTGAGCCTTAGGCTGGGCTCGG + Intergenic
904151510 1:28445382-28445404 AATTAGAATTAGGAAGGGCTGGG - Intronic
905231427 1:36516927-36516949 AGCTAGCATGTGGCAGGGCTGGG + Intergenic
907316452 1:53575670-53575692 ACTCAGCACAAGGCAGGACATGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
908483657 1:64569209-64569231 ACTGTGCATAAGGCTGGGCGTGG - Intronic
910122031 1:83800430-83800452 ACTTCGCAGAAGGAAGGGATTGG + Intergenic
910256232 1:85249811-85249833 ACTGAGTACAAGGCAGAGCTTGG - Intergenic
912456983 1:109804534-109804556 ACTTAGCATGAGGCACAGCAGGG - Intergenic
915484442 1:156210529-156210551 ACTTGGCCCAGGGCAGGGCTGGG - Exonic
915583630 1:156831211-156831233 CCTGAGCATAGGGAAGGGCTTGG + Intronic
918208489 1:182330253-182330275 ACTTAGCAAGTGGCAGAGCTGGG - Intergenic
919870144 1:201814088-201814110 ACTTAAAATAAGGCTGGGCCTGG + Intronic
921333486 1:214063759-214063781 ATCTAGCATAAGACAGAGCTGGG + Intergenic
923624047 1:235599688-235599710 ACCCTGCATAAGGCAGGACTGGG - Intronic
1064909251 10:20382588-20382610 ACTTAATATAAGGCAGGGTGTGG - Intergenic
1068831499 10:61500477-61500499 AATTAGCATAAGGTAGGTTTGGG + Intergenic
1069501883 10:68960411-68960433 AATTAGCATACGACAGGGCATGG + Intronic
1069865296 10:71498656-71498678 AGCTAGCACAAGGCAGAGCTGGG - Intronic
1073122213 10:101129396-101129418 ACTAAGCAGAAGGCTGGGCATGG - Intronic
1074279652 10:112038829-112038851 GCTTAGCATAAGGCTGGGCATGG + Intergenic
1076552373 10:131290339-131290361 ACTTAACATTAGGCCGGGCATGG + Intronic
1078892649 11:15571134-15571156 ACTTAGCGTTAGACAGTGCTGGG + Intergenic
1081695873 11:45108726-45108748 ACATAGCTACAGGCAGGGCTGGG - Intronic
1083621711 11:64052602-64052624 ACTCAGCAGGAGACAGGGCTGGG - Intronic
1084229855 11:67743695-67743717 ACTTAGCAGGAGGCAGGCCTAGG - Intergenic
1086830292 11:91553648-91553670 ACTGGGCATATGGCAGGGCATGG - Intergenic
1089651631 11:119918049-119918071 ATTTAGCATGCGGCAGAGCTGGG - Intergenic
1090033529 11:123228500-123228522 ACTTCCCAGAGGGCAGGGCTTGG - Intergenic
1091461603 12:647273-647295 ATTAAGCATAATGAAGGGCTCGG - Intronic
1091897348 12:4116286-4116308 AGTTAGCAAATGGCAGAGCTGGG - Intergenic
1092030087 12:5276644-5276666 GCACAGCCTAAGGCAGGGCTTGG + Intergenic
1092778675 12:11965626-11965648 ACCTGGCATAAGGGAGGACTGGG - Intergenic
1093063401 12:14630990-14631012 AATGAGGAGAAGGCAGGGCTAGG + Intronic
1093432035 12:19095190-19095212 GCTGAGCCTAAGACAGGGCTTGG - Intergenic
1094724636 12:33101392-33101414 ACTTAGAAAAAGGCAGTTCTTGG - Intergenic
1095326659 12:40903192-40903214 ACCTGGCATAAGGCCTGGCTGGG + Intronic
1095328093 12:40922680-40922702 AGTTAGCATCAGGCTGGGCGCGG + Intronic
1096356367 12:50944230-50944252 ACTTAGCAAAAGACAGACCTGGG - Intergenic
1096517955 12:52168306-52168328 TCTTAGCACAAGGCTGGGCTTGG + Intergenic
1099876577 12:88414632-88414654 ACTTAGGATATCTCAGGGCTAGG - Intergenic
1100587952 12:95996718-95996740 ACTTAGCAAATGGCAGAGCCAGG - Intergenic
1100723886 12:97387901-97387923 ACTTAGCATAAGGGAAGGATGGG + Intergenic
1100841329 12:98614719-98614741 AAATAACATAAGGCAGGGCGTGG - Intronic
1101213646 12:102559867-102559889 ACTTGGCATATGCCAGGGATAGG - Intergenic
1101820070 12:108177068-108177090 ACTCAGCAAGAGGCAGAGCTGGG - Intronic
1103240317 12:119407807-119407829 AGTTAGCAAATGGCAGAGCTGGG + Intronic
1103962222 12:124616232-124616254 AATAACCATAAGGCCGGGCTTGG - Intergenic
1104035822 12:125096532-125096554 ACTTTGCATAAGGGGTGGCTGGG + Intronic
1105679212 13:22708125-22708147 ACTTAGCATAAGGCAGGGCTGGG - Intergenic
1111399765 13:87719376-87719398 AAATAACATAAGGCAGGGCGTGG + Intergenic
1112104400 13:96224723-96224745 AGTTAGAATTAGGCAGTGCTTGG + Intronic
1113988437 13:114338752-114338774 ACTTTGCATAGGGCATGGATGGG + Intergenic
1114049711 14:18913173-18913195 ACATAGCAGGAGCCAGGGCTGGG - Intergenic
1114217406 14:20667220-20667242 ACTTAGCATAAGACAGGGAGTGG - Intergenic
1116434421 14:44880271-44880293 ACATAGCCTGAGGCTGGGCTGGG + Intergenic
1117389604 14:55250354-55250376 GCTAAGGATAAGGCAGGGCGCGG - Intergenic
1118641123 14:67793550-67793572 ACTTAGCATCAGGTAAGGCTCGG - Intronic
1118845823 14:69547293-69547315 AATAAGCATAAGGCCGGGCGTGG + Intergenic
1118894795 14:69936667-69936689 ACTTGGCTAAAGGCAGGTCTGGG + Intronic
1121102594 14:91260278-91260300 ACTTGGCATGTGGCAGAGCTGGG - Intergenic
1121566478 14:94914042-94914064 ACTGAGGTTAAGGCTGGGCTGGG - Intergenic
1122581675 14:102775780-102775802 ACACAGCATAAGGCAGGCGTTGG + Intergenic
1126782727 15:52152258-52152280 ACTGAGCACAAGGCAGGGGTTGG + Intronic
1126930852 15:53649338-53649360 ATTTAGAATAAGCCAGGGGTTGG - Intronic
1127472659 15:59304339-59304361 ATAAAGCAAAAGGCAGGGCTGGG + Intronic
1127666697 15:61154679-61154701 ACATACCAGAATGCAGGGCTGGG - Intronic
1128159434 15:65413755-65413777 ACTCATCACAAGGCAGGTCTGGG + Intronic
1128827836 15:70736914-70736936 CCTTTGCTTATGGCAGGGCTTGG + Intronic
1128844207 15:70875316-70875338 ACATAACTAAAGGCAGGGCTCGG + Intronic
1128960099 15:71993677-71993699 ACTTAGCAATCGGCAGGGCACGG + Intronic
1129201046 15:74000119-74000141 AATTAGTATAAGGCTGGGCATGG - Intronic
1132947561 16:2540284-2540306 ACTTAGCATCAGACTGGGCCAGG - Intronic
1139101746 16:63775749-63775771 AATTAGCTTAAGGCTGGACTAGG - Intergenic
1139287991 16:65832475-65832497 CCTGACCATAAGGCAGGGGTGGG - Intergenic
1139309608 16:66017435-66017457 ACTTAGGACAAGGCTGGACTGGG + Intergenic
1139406445 16:66722686-66722708 ACAAGTCATAAGGCAGGGCTTGG + Exonic
1139449953 16:67021545-67021567 AGTTAGCATAAGCCGGGACTAGG + Intergenic
1149916407 17:60613843-60613865 ACTCCCCATGAGGCAGGGCTTGG + Intronic
1151542713 17:74772863-74772885 AGTCAGCGGAAGGCAGGGCTAGG + Intronic
1152206038 17:78974826-78974848 ACACAGCAGATGGCAGGGCTGGG + Intronic
1153281292 18:3416638-3416660 ATTTATAATAAGGCCGGGCTGGG + Intronic
1153747155 18:8191270-8191292 ACTTAGTTTAAGGCAGAGATTGG + Intronic
1153953686 18:10077785-10077807 ACTTAGCATGTGCTAGGGCTTGG + Intergenic
1155763708 18:29600871-29600893 ACTTAGTAAAGGGCAGAGCTAGG - Intergenic
1157860896 18:51139161-51139183 AGTAAGCATAAGTCTGGGCTGGG + Intergenic
1159065875 18:63567562-63567584 ACCTAGGACAAGGCAGGGCTTGG + Intergenic
1161853432 19:6750699-6750721 AATTCGCCTAAAGCAGGGCTGGG + Intronic
928563959 2:32523045-32523067 ACTGAGTATCAGGCAGGGCAGGG - Intronic
929415319 2:41741360-41741382 ACTTAGAATAAGGCTGGGCTTGG + Intergenic
929541957 2:42829528-42829550 GCTTATCATCAGGCAGGGGTTGG - Intergenic
929756680 2:44771746-44771768 ACTTGACAGAAGGCAGAGCTGGG - Intronic
932629188 2:73323744-73323766 AGTTAGCAAGAGGCAGGGTTGGG + Intergenic
936673044 2:114681953-114681975 ACTTAGCAAATGGCTGGCCTGGG + Intronic
940917553 2:159273708-159273730 ACTTTTCATAAGGCTGGGCGTGG - Intronic
942656591 2:178220245-178220267 ACTTAAAAAAAGGCAGGGGTGGG - Intronic
943776489 2:191772392-191772414 CCTTAGCATAAGCAAGGGCAAGG - Intergenic
946159175 2:217825684-217825706 ACTTGCCATTAGGCAAGGCTGGG + Intronic
947179142 2:227396906-227396928 ACTTATAATAAGGCCGGGCATGG - Intergenic
947930868 2:233964259-233964281 ACTTAACCTTAGGCTGGGCTTGG + Intronic
948517415 2:238512374-238512396 GCTTGGCACAAGGCGGGGCTGGG - Intergenic
1170598602 20:17823708-17823730 AGTTAGCACAACGAAGGGCTGGG + Intergenic
1173024158 20:39292550-39292572 ACAAAGAATCAGGCAGGGCTGGG + Intergenic
1173024432 20:39294860-39294882 ACTTTGGACAAGGCAGGGATGGG + Intergenic
1173046464 20:39517433-39517455 ACTTAGCAGTAGGCACTGCTGGG - Intergenic
1173162882 20:40665230-40665252 ACTTAGCAGAAGGCAGGTGGTGG + Intergenic
1173623243 20:44452335-44452357 TATTACCATCAGGCAGGGCTAGG + Intronic
1174820921 20:53725750-53725772 AGTTAGCATTAGGCAGGGCGCGG - Intergenic
1175138171 20:56840490-56840512 AGTTGGAATAAGGCAGGCCTGGG + Intergenic
1175543875 20:59765555-59765577 ACTTAACATAAGAAAGGGCTGGG + Intronic
1178389892 21:32189572-32189594 ACAAAGCATGAGGCATGGCTGGG - Intergenic
1178429814 21:32509362-32509384 ACTTAGCAGGAGGCAGGCCTAGG + Intronic
1178761091 21:35403571-35403593 ACTGATAATGAGGCAGGGCTGGG - Intronic
1178970761 21:37174963-37174985 ACTTAGCATATGGCCAGGCGCGG + Intronic
1179960916 21:44766622-44766644 ACCCAGCAGAGGGCAGGGCTGGG + Intergenic
1180828381 22:18883050-18883072 ACTGAGCATATGGCCGGGCATGG - Intergenic
1181071539 22:20344921-20344943 ACTGAGCATATGGCCGGGCGTGG + Intergenic
1181194609 22:21173871-21173893 ACTGAGCATATGGCCGGGCGTGG + Intergenic
1181214834 22:21318907-21318929 ACTGAGCATATGGCCGGGCGTGG - Intergenic
1181416332 22:22762134-22762156 GCTGAGCCTAAGGCAGGGTTGGG - Intronic
1182050276 22:27307819-27307841 ACTGAGCATAAGACAGTGATGGG - Intergenic
1182469073 22:30536150-30536172 ACTTATGACAAGGCTGGGCTAGG - Intronic
1182753131 22:32657621-32657643 TCTGAGAACAAGGCAGGGCTTGG + Intronic
1183409481 22:37646620-37646642 TCTGAGCAAAGGGCAGGGCTGGG - Intronic
1183641145 22:39093290-39093312 ACTGAGCAACAGGCAGGGCGCGG + Intergenic
1183963903 22:41429701-41429723 CCTTGGCAGAGGGCAGGGCTGGG + Intergenic
1185290434 22:50023392-50023414 ACTTAACATGAGGCTGGGCACGG + Intronic
1203232274 22_KI270731v1_random:121265-121287 ACTGAGCATATGGCCGGGCGTGG - Intergenic
1203278478 22_KI270734v1_random:109039-109061 ACTGAGCATATGGCCGGGCATGG - Intergenic
949622418 3:5829028-5829050 ACTATGCATAAGCCAGGGGTAGG - Intergenic
950036863 3:9892309-9892331 ACTAATAAAAAGGCAGGGCTGGG - Intronic
951232851 3:20199855-20199877 CTTTACCATAAGTCAGGGCTTGG + Intergenic
951713900 3:25617919-25617941 TCTAAGCATGAGGCAGAGCTTGG + Intronic
955505760 3:59631716-59631738 ACCTGGCACAAGGCAAGGCTGGG + Intergenic
956561869 3:70587222-70587244 ACTTTGAATAAGGCAGGAATGGG + Intergenic
956643066 3:71432559-71432581 ACCTAACATAGGGCAGGGCCTGG + Intronic
957046426 3:75378542-75378564 ACTTAGCAGGAGGCAGGCCTAGG - Intergenic
957623475 3:82625873-82625895 ACTTTTCAGAAGGCAGAGCTAGG + Intergenic
959934795 3:112018121-112018143 AATAAGCATAAGGCTGGGCATGG - Intergenic
961254132 3:125532441-125532463 ACTGAGCAAAAGGCAGTGCAGGG + Intronic
961722271 3:128904852-128904874 ACTAAGCATATGGCAGGGCGCGG + Intronic
961878489 3:130042780-130042802 ACTTAGCAGGAGGCAGGCCTAGG - Intergenic
965398900 3:168194556-168194578 ACCTGGCATATGGCAGAGCTGGG + Intergenic
965513813 3:169599223-169599245 CTTTAGCATAAGGCCGGGCACGG + Intronic
966613458 3:181890857-181890879 ACTTAGCCTAAGGCCGGGCGCGG + Intergenic
966630671 3:182070851-182070873 ACTTAGCTGAAGGCTGGGCACGG - Intergenic
966756866 3:183379225-183379247 ACTTCCCATGTGGCAGGGCTGGG - Intronic
967754489 3:193153463-193153485 GCTTAGCATGAAGCATGGCTAGG - Intergenic
968375012 4:32471-32493 ACTTTGCATAGGGCATGGATGGG - Intergenic
968990708 4:3909655-3909677 ACTTAGCAGGAGGCAGGCCTAGG - Intergenic
969074767 4:4569230-4569252 ACTTAGTGCAAGGCAGGGGTGGG - Intergenic
970138815 4:12957419-12957441 ACCTAGCAAATGGCAGAGCTAGG - Intergenic
972034778 4:34506752-34506774 CCTTACCATGGGGCAGGGCTGGG - Intergenic
973335191 4:48948785-48948807 AATTAGAATAAGATAGGGCTGGG + Intergenic
976073749 4:81272961-81272983 CCTGAGTATTAGGCAGGGCTAGG + Intergenic
976406404 4:84664920-84664942 CCTTACCATGGGGCAGGGCTCGG + Intergenic
977321688 4:95524231-95524253 ACTTAGCTAAATGCAGGGTTAGG - Intronic
978809115 4:112831036-112831058 TCTCACCATAGGGCAGGGCTCGG + Intronic
978811752 4:112856978-112857000 ACTTTGCAGAAGGCAGGGCAAGG + Intronic
982974312 4:162034089-162034111 ACTTTATATAAGGCAGGGATGGG - Intronic
983246439 4:165293069-165293091 AGCTAGCATATGGCAGAGCTGGG + Intronic
983252478 4:165360465-165360487 ATTTAGCAGAAGTGAGGGCTGGG - Intergenic
984458303 4:179999782-179999804 ACATAGGAGAAGGCAGGGTTTGG - Intergenic
984921966 4:184772873-184772895 AATTATCATAAGGCAAGGGTTGG + Intronic
985460031 4:190096573-190096595 ACTTTGCATAGGGCATGGATGGG + Intergenic
985468937 5:25040-25062 ACTTTGCATAGGGCATGGATGGG - Intergenic
986127476 5:4896558-4896580 ACTTTGCATAATGAAGTGCTTGG - Intergenic
987329522 5:16843499-16843521 AGTAAGCAGCAGGCAGGGCTAGG + Intronic
988180809 5:27789205-27789227 ACTTAATAGAAGGCAGTGCTTGG - Intergenic
989260541 5:39414888-39414910 ACATAGGATAATGCAGTGCTTGG - Intronic
989996330 5:50836708-50836730 ATTTAGCACAATGCAGGTCTTGG + Intronic
993770732 5:91922442-91922464 ATTTAGCATAGGGCAGAGTTGGG + Intergenic
999079842 5:148832818-148832840 ACTGAGCAGGAGGCTGGGCTAGG + Intergenic
1000043930 5:157505864-157505886 GCTAAGGATAAGGCAGGGATGGG - Intronic
1000308721 5:160020403-160020425 ACTTAGCATCAGGCCAGGCAGGG - Intronic
1001242308 5:170080095-170080117 GCTTAGCATGAGGCAGATCTGGG - Intronic
1001759859 5:174198490-174198512 GGTTGGCATAGGGCAGGGCTGGG - Intronic
1002636320 5:180610465-180610487 CCCTAGCATACGGCAGGGCTAGG - Intronic
1004080868 6:12391871-12391893 CCAAAGCAAAAGGCAGGGCTTGG - Intergenic
1004992460 6:21154012-21154034 AGCTAGTAAAAGGCAGGGCTGGG - Intronic
1005589456 6:27309789-27309811 ACTTGGCATAAGGGCTGGCTGGG + Exonic
1006954970 6:37860967-37860989 AAATAGCATAAGGCCGGGCGTGG + Intronic
1008496737 6:52141719-52141741 TCTGATCATGAGGCAGGGCTGGG + Intergenic
1010710086 6:79163386-79163408 ACTGAGCATTTGGAAGGGCTGGG + Intergenic
1011278771 6:85655998-85656020 AGTGGGCAAAAGGCAGGGCTGGG + Intergenic
1014108325 6:117592074-117592096 AATTAGCACAAGGCTGGGCACGG + Intronic
1014341268 6:120210484-120210506 ACTTATGATAAGGCCGGGCATGG + Intergenic
1014436780 6:121429507-121429529 TCTTAGCATAAGGCCGGGTGCGG + Intergenic
1016287096 6:142485728-142485750 ACTTAGCAAATGGCTGGGCATGG + Intergenic
1016425009 6:143925828-143925850 ACTAAGAATAAATCAGGGCTGGG - Intronic
1017372507 6:153728975-153728997 ACTTAGCAATAGGCCGGGCGTGG - Intergenic
1018131868 6:160739361-160739383 AGCTAGCATGTGGCAGGGCTAGG - Intronic
1019764496 7:2840289-2840311 AATTAGCAGATGGCAGAGCTAGG - Intronic
1020050808 7:5080421-5080443 ACTGTGCAGATGGCAGGGCTGGG + Intergenic
1020313541 7:6887772-6887794 ACTTAGCAGGAGGCAGGCCTAGG - Intergenic
1020799540 7:12716953-12716975 CCTTAGCATAAAGTAGGGCTTGG + Intergenic
1024051140 7:45624175-45624197 TCTGAGCACAGGGCAGGGCTGGG + Intronic
1026032062 7:66802790-66802812 TATTGCCATAAGGCAGGGCTGGG - Intronic
1026387632 7:69866285-69866307 AGTTAGTAAAAGACAGGGCTGGG - Intronic
1028814927 7:95132759-95132781 ACTTAGTCTATGGCTGGGCTGGG + Intronic
1032464584 7:132136036-132136058 ACTTAGCAGCAGGCAGGCTTAGG - Intronic
1035285251 7:157801918-157801940 ACTGAGCTGAAGTCAGGGCTTGG + Intronic
1035449910 7:158970452-158970474 ACTCAGGATAAGGCAGAGCAAGG - Intergenic
1036813652 8:11885503-11885525 ACTTAGAATAATGACGGGCTAGG - Intergenic
1037723472 8:21464569-21464591 ATTTAGGATAAAGCAGGGCCTGG - Intergenic
1039862240 8:41468913-41468935 TCTGAGCAGAAGGGAGGGCTTGG - Intergenic
1044597848 8:93976075-93976097 ACTTAGATTAAGGAAGGCCTAGG - Intergenic
1044764887 8:95560872-95560894 ACTTAGCAGAAGGCATATCTAGG - Intergenic
1045169000 8:99643040-99643062 AATTAGAATAAGGAAGGGATGGG - Intronic
1045379004 8:101604316-101604338 ACTTAGAGAAAGGCAGTGCTCGG - Intronic
1046120155 8:109836075-109836097 AGATAGCATAAGGCAGTGCAGGG - Intergenic
1046558383 8:115805931-115805953 ACTTACCTTCAGTCAGGGCTAGG + Intronic
1047591443 8:126331377-126331399 AACTAGCAAAAGGCAGGACTGGG - Intergenic
1049296191 8:141840885-141840907 ACTGAGCATTGGGCAGGGCAGGG - Intergenic
1049321762 8:142000552-142000574 ATATAGCACCAGGCAGGGCTGGG + Intergenic
1060584619 9:124778067-124778089 ACTTAGCACTAGGCCGGGCGCGG + Intronic
1061655336 9:132085375-132085397 ACTAAGCATGAGGCAGAGATGGG - Intergenic
1203574212 Un_KI270744v1:161679-161701 ACTTTGCATAGGGCATGGATGGG + Intergenic
1189176679 X:38964382-38964404 ACTTAGAATACTGCATGGCTTGG + Intergenic
1189209847 X:39275803-39275825 CCTTCCCATAGGGCAGGGCTCGG + Intergenic
1189363491 X:40370699-40370721 ACATAGCAGGAGGCAGGGCCAGG - Intergenic
1192231599 X:69269171-69269193 AGCTAGCATATGGCAAGGCTGGG + Intergenic
1193796498 X:85881544-85881566 AATTAGTAGAAGGAAGGGCTGGG + Intronic
1195223387 X:102768007-102768029 AATTTCCTTAAGGCAGGGCTGGG + Intergenic
1198805191 X:140487411-140487433 ACTTAACCTAAGGCCGGGCACGG + Intergenic
1201979162 Y:19889136-19889158 ACCTCTCATAGGGCAGGGCTGGG + Intergenic