ID: 1105686660

View in Genome Browser
Species Human (GRCh38)
Location 13:22789933-22789955
Sequence GATTCCTGTCCTCACCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105686660_1105686663 24 Left 1105686660 13:22789933-22789955 CCAGCATGGTGAGGACAGGAATC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1105686663 13:22789980-22790002 AAATACCTAAAATGATTAATTGG 0: 1
1: 0
2: 1
3: 72
4: 580
1105686660_1105686661 -7 Left 1105686660 13:22789933-22789955 CCAGCATGGTGAGGACAGGAATC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1105686661 13:22789949-22789971 AGGAATCTTAAGTGTTAACAAGG 0: 1
1: 0
2: 0
3: 15
4: 202
1105686660_1105686662 -3 Left 1105686660 13:22789933-22789955 CCAGCATGGTGAGGACAGGAATC 0: 1
1: 0
2: 1
3: 18
4: 164
Right 1105686662 13:22789953-22789975 ATCTTAAGTGTTAACAAGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105686660 Original CRISPR GATTCCTGTCCTCACCATGC TGG (reversed) Intergenic
900114569 1:1023001-1023023 GATTTCTGCCCCCACCAGGCTGG - Intronic
900395566 1:2451879-2451901 GATGCCTGTCATCGGCATGCTGG + Intronic
900505657 1:3028818-3028840 CAGTCCTGCCCTCACCATCCCGG - Intergenic
900693427 1:3995512-3995534 GATTCCTGTCCCCATGAGGCTGG + Intergenic
901104249 1:6743201-6743223 GAATCCTGGCCTTACCATACAGG - Intergenic
901380649 1:8871600-8871622 GGTTCCTGTCCTAACCGTGAAGG + Intronic
910863097 1:91762583-91762605 AGTTCCTGTTCTAACCATGCTGG + Intronic
916755608 1:167767169-167767191 GATTCCTGTGCTCACCCTTATGG - Intronic
919719182 1:200813499-200813521 GATTCCTGTCCTCATGAAGCAGG - Intronic
919863318 1:201758049-201758071 TTTTCTTGTCCTCACCATGAGGG + Intronic
921988185 1:221335096-221335118 GATTCCTGCTGTCACCATGCTGG - Intergenic
922723475 1:227910730-227910752 GATTCCCTTCCTCACCACCCAGG + Intergenic
1063436608 10:6037066-6037088 GAGTCCTGTCCTCACCCAGGGGG - Intronic
1063725190 10:8629511-8629533 GATACATGTGCTGACCATGCAGG + Intergenic
1063882865 10:10549215-10549237 GATTAATTTCCTCACCATTCTGG + Intergenic
1063982213 10:11463298-11463320 GCTTCCCGTCCTCAGCATCCAGG + Exonic
1067440498 10:46306722-46306744 CATGTCTGTCCTCAGCATGCAGG - Intronic
1070634473 10:78113371-78113393 GATCCCGCTCCTGACCATGCTGG + Intergenic
1070784996 10:79157693-79157715 GTTCCCTGACCTCACCAAGCTGG - Intronic
1073249492 10:102113180-102113202 GAGCCCTGTCCTCACAATGCAGG + Intronic
1073505582 10:103985796-103985818 TATTCCTGTACTCACCACCCAGG + Intronic
1074254602 10:111788316-111788338 GATTCCTCTTCTCACTATGATGG - Intergenic
1074828198 10:117229625-117229647 AATTCCTGTCAACACCATGGTGG + Intergenic
1075116452 10:119630959-119630981 GGTGCCTGTCCTCAGCCTGCTGG - Intergenic
1076214692 10:128684015-128684037 CATTCCTGTCCTCTCCCTCCCGG + Intergenic
1076343730 10:129766681-129766703 GAGTCCTGTGCCCACCAAGCAGG - Intronic
1077414540 11:2418553-2418575 GATCCCTGTCCTCTGCTTGCTGG - Exonic
1080761756 11:35257220-35257242 GATTCCTGGCATCACCTAGCAGG + Exonic
1083310811 11:61782787-61782809 GATACCTGTCCTGACCACACAGG + Intronic
1083934278 11:65862272-65862294 GATCCCTGTGCTCACCCTGGGGG - Exonic
1086437776 11:86799655-86799677 GAGTCCTCTCCTAACCAGGCTGG - Intronic
1086892065 11:92270036-92270058 GGTTCCTGTCCTCTCCATTAAGG + Intergenic
1089335662 11:117721479-117721501 GGTTCCTGACCTCACCCTCCTGG + Intronic
1090677595 11:129015424-129015446 TATCCATGTCCTCATCATGCAGG + Intronic
1090948172 11:131449737-131449759 TGATCCTGTCCTCCCCATGCAGG + Intronic
1091308800 11:134558620-134558642 GATGCCTTTCCTCCCCATCCTGG + Intergenic
1093788443 12:23218873-23218895 GCTTCTTGTCGTCACCAAGCTGG - Intergenic
1094869097 12:34578307-34578329 GGTACCTGTCCACAACATGCAGG - Intergenic
1097071004 12:56354863-56354885 GACTCCTGTTCCCACCATCCAGG - Exonic
1098196175 12:68004395-68004417 GATTCCTCTCTTCCCAATGCTGG + Intergenic
1102519549 12:113470073-113470095 GATTCCTGTCCTGGCCTTGCAGG - Intronic
1103436667 12:120932098-120932120 GATACTTGCCCTCACCAAGCTGG - Intergenic
1103926821 12:124427811-124427833 CCTTCCTGTCCTTCCCATGCCGG + Intronic
1105308523 13:19186101-19186123 GAGGCCTTTCCTCCCCATGCGGG + Intronic
1105686660 13:22789933-22789955 GATTCCTGTCCTCACCATGCTGG - Intergenic
1105949129 13:25213809-25213831 AATGCCTGCACTCACCATGCTGG - Intergenic
1115138725 14:30143030-30143052 GATTACAGGCCTCACCATGCCGG - Intronic
1116866520 14:50036044-50036066 GATTGCAGGCCTCAGCATGCTGG - Intergenic
1120571523 14:86123855-86123877 GATTCCTCTCACCACCATGAGGG + Intergenic
1120699062 14:87678072-87678094 GAGTCCTGTCATCATCCTGCAGG + Intergenic
1122126123 14:99579634-99579656 GAATCCAGTCCTCACCTTTCTGG - Intronic
1122259244 14:100502663-100502685 GACTCCTCCCCTCGCCATGCAGG - Intronic
1123466090 15:20517086-20517108 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1123487915 15:20757399-20757421 GATTCGCGTTTTCACCATGCTGG - Intergenic
1123652024 15:22483953-22483975 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1123742444 15:23292813-23292835 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1123760881 15:23431673-23431695 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1124276814 15:28333062-28333084 CCTTCCTTTCCTCACCATGAAGG + Intergenic
1124305886 15:28578544-28578566 CCTTCCTTTCCTCACCATGAAGG - Intergenic
1128920220 15:71603576-71603598 GATTCCCCTCCTGACCATGGCGG - Intronic
1130221716 15:82025164-82025186 GATACCTGTCCTCAGCAGGCTGG + Intergenic
1130998981 15:88922975-88922997 AATTCCTGTCCTCTCGATGGTGG - Intergenic
1133390454 16:5405897-5405919 GACTCCTGTCCTCAGCCTGTGGG - Intergenic
1135841592 16:25881749-25881771 GATTCCTGTCCCCTCCATTCTGG - Intronic
1138438836 16:57022308-57022330 AACTCCAGTCCTCACCATGGTGG - Exonic
1138598102 16:58040175-58040197 GCCAGCTGTCCTCACCATGCAGG - Exonic
1139589701 16:67926798-67926820 GTTTCCTTTCCTCCCCATGCCGG + Intronic
1139659441 16:68410912-68410934 GATTCCTGACCTCACTGTGCAGG - Intronic
1139788940 16:69416721-69416743 AACTCCTGACCTCACCATGTTGG - Intergenic
1141772832 16:86101426-86101448 GCTTCCTGGCCTCACCCTGTAGG - Intergenic
1149722465 17:58860256-58860278 GAATACTGTCCTAACCATCCTGG + Intronic
1149785954 17:59435146-59435168 GGTTCCTGTCCACACCTTGGAGG - Intergenic
1150158029 17:62870406-62870428 GACTCCTGTACTGGCCATGCTGG - Intergenic
1157376557 18:47172621-47172643 GATTCATGTCCTCATGATACAGG + Intronic
1160895936 19:1401743-1401765 GATTCCAGTCCCCAGCCTGCAGG - Intergenic
1166337326 19:42116392-42116414 GATTGTTGTCCTCAACATACAGG - Intronic
1166910649 19:46153862-46153884 GATTCATGTGCTGAACATGCAGG + Intronic
1167188787 19:47967907-47967929 GATTCCTGTGGCCACCATGTTGG + Intergenic
1168355418 19:55696954-55696976 AATTGCTGACCACACCATGCAGG + Intronic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
926117835 2:10224555-10224577 GATTGCTGTCCTCAGCCTGGAGG + Intergenic
927060309 2:19412456-19412478 CATCCCTGCCCTCACCAAGCTGG - Intergenic
927463185 2:23317104-23317126 CATTCCTGTCCCCACCAGACTGG + Intergenic
930416557 2:51097015-51097037 GATTCCTGTCCACACACTGTGGG - Intergenic
930930689 2:56878148-56878170 AATGCCTGCTCTCACCATGCCGG + Intergenic
934853457 2:97715310-97715332 GATTCCTGTCCTGGACATGCTGG - Intronic
936076007 2:109402317-109402339 GATTCTCTTCCCCACCATGCTGG + Intronic
937023672 2:118680388-118680410 GACCCCTGTCCTCACCTTCCAGG + Intergenic
937431350 2:121841390-121841412 GATTCCTTTCCTCTCCTTGGGGG + Intergenic
937675126 2:124581778-124581800 GATTTCTTTCCTCAGCAGGCTGG - Intronic
939027799 2:137034449-137034471 GATACATGTCCTGAACATGCAGG + Intronic
942966708 2:181902968-181902990 GGTCCCTATCCTCCCCATGCAGG - Intronic
947027957 2:225760181-225760203 GATTGCTGTCCTCACAATCTAGG - Intergenic
947201195 2:227616023-227616045 AACTCCTTTCCTCCCCATGCTGG - Intronic
1169761863 20:9104211-9104233 GATTTCCGTCATCACCATGTGGG + Intronic
1170885951 20:20340060-20340082 GAGCCCTGCCCTCACCATGCAGG + Intronic
1172271209 20:33656767-33656789 AAGACCTGTCCTCACCAAGCTGG - Intergenic
1173740053 20:45394013-45394035 GCTTCCTTTCCTTGCCATGCGGG + Intronic
1173752154 20:45485938-45485960 AATTCCTGTCCTCTGGATGCTGG + Intergenic
1175471933 20:59236407-59236429 GATTCCTCTCCTCTGCATGAGGG + Intronic
1179954085 21:44728171-44728193 CTTTCCTGTCCCCTCCATGCAGG - Intergenic
1182877305 22:33703318-33703340 GATACATGTCCTAAACATGCAGG - Intronic
1184092853 22:42301472-42301494 CCCTCCTGTCCTCACCTTGCAGG - Intronic
1184164138 22:42717499-42717521 GCCTCCTGTCCTCACCAGCCCGG + Intronic
1184776716 22:46627044-46627066 GATTCGTGTCCTGCCCATGCTGG + Intronic
1184777032 22:46628377-46628399 GGTTCGTGTCCTGCCCATGCTGG + Intronic
1184903752 22:47464803-47464825 CATTCCTGCCCTCGCCATGTAGG + Intronic
950187193 3:10952431-10952453 CATTCCAGTCCTCACCGTGATGG - Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955913466 3:63882091-63882113 CATTCCTCACCTCACAATGCTGG - Intronic
956775945 3:72565683-72565705 GATGCCAGTGTTCACCATGCAGG + Intergenic
960446378 3:117753937-117753959 ACTACCTGTCCTCACCCTGCAGG + Intergenic
964424722 3:156539995-156540017 GATACATGTGCTGACCATGCAGG - Intergenic
967172212 3:186830539-186830561 GAGCCCACTCCTCACCATGCTGG - Intergenic
968914673 4:3492242-3492264 GCCCCCTGCCCTCACCATGCTGG - Intronic
970297308 4:14644024-14644046 CACTCCTGTCCCCACCAAGCCGG - Intergenic
970988539 4:22186722-22186744 GATTCCTGTGCTGACCATCTTGG - Intergenic
973377016 4:49293602-49293624 TTTCCCTGTCCTCACCATGATGG - Intergenic
976148393 4:82066912-82066934 CAGTCCTGTCCTCACTCTGCTGG - Intergenic
976513499 4:85937218-85937240 TATTCATGTAATCACCATGCTGG - Intronic
977322267 4:95532534-95532556 AATTCCTGTACTCATCATGCTGG + Intronic
978076665 4:104539576-104539598 GATTCCTGTACACACCTTACTGG - Intergenic
980822742 4:138038344-138038366 CATTCCTGTCCTCTCCATACTGG + Intergenic
982463314 4:155698531-155698553 GAATCCTGTCCTTACTATGTTGG + Intronic
986770515 5:10968672-10968694 GATTGTTGTCCTCACCACCCTGG + Intergenic
987870104 5:23605814-23605836 AATTCCTGTCCTCCCCTTGCAGG - Intergenic
992352463 5:75944435-75944457 AATTCCTGTGCTCACCAAGATGG + Intergenic
994042706 5:95276213-95276235 GAATCCTGTCCTCACTAGCCTGG - Intronic
994568762 5:101485993-101486015 GCTTCCTGTTCTCACAATTCTGG + Intergenic
996623122 5:125534859-125534881 GATTCATGTCCAGAACATGCAGG - Intergenic
996871693 5:128199608-128199630 GTTTCATGTCCTCACTATGCTGG + Intergenic
998258895 5:140612704-140612726 GAATCCTGTCCCCACACTGCTGG + Intergenic
1000297501 5:159924914-159924936 GCTTACTGTGCTCTCCATGCTGG + Intronic
1000987341 5:167875284-167875306 ACTTCCTGTCCCCTCCATGCAGG - Intronic
1001854573 5:174999815-174999837 GCTTCCTGTCCTCACCACATGGG + Intergenic
1004251744 6:14028635-14028657 GAATGCTGTCCTCACCGTGAGGG - Intergenic
1005233978 6:23738538-23738560 GATTCCTGAACTGAGCATGCAGG + Intergenic
1006243212 6:32705692-32705714 GATACATGTGCTCAACATGCAGG - Intergenic
1007906479 6:45466460-45466482 GATTCCAGTCCTGACTCTGCAGG - Intronic
1015006056 6:128283101-128283123 TCTTCCTGTCCTCACCTTCCTGG - Intronic
1016704395 6:147089896-147089918 GAGTTTAGTCCTCACCATGCTGG - Intergenic
1017898408 6:158701088-158701110 CATGACTGTCCTCACCAGGCTGG - Intronic
1019335502 7:480735-480757 GCCTCCTGTCCTCACCAGGGTGG - Intergenic
1020083387 7:5298030-5298052 CACTCCTGACCTCACCCTGCAGG - Intronic
1023807570 7:43884468-43884490 TATTCCTGGGCTCACCATGGTGG - Intronic
1023825673 7:44007253-44007275 GATTCCTGTCCTCAGCTACCTGG + Exonic
1025210888 7:57019169-57019191 CACTCCTGACCTCACCCTGCAGG + Intergenic
1025661067 7:63557678-63557700 CACTCCTGACCTCACCCTGCAGG - Intergenic
1026134123 7:67644348-67644370 GTTTTGTTTCCTCACCATGCTGG - Intergenic
1026450971 7:70529198-70529220 AAATTCTGTCTTCACCATGCTGG + Intronic
1026537831 7:71254807-71254829 GATTCCTGTTTTCAGCTTGCTGG - Intronic
1026786219 7:73303353-73303375 GATGCCTGTCCTCTCCGTGGAGG - Exonic
1027107860 7:75416640-75416662 GATGCCTGTCCTCTCCGTGGAGG + Intergenic
1029517836 7:101038088-101038110 TATGCCTGTCAGCACCATGCCGG + Exonic
1029518146 7:101040920-101040942 TATGCCTGTCAGCACCATGCTGG + Exonic
1032751307 7:134844679-134844701 GATTTCTTTTCTCACCATTCTGG + Intronic
1034540728 7:151756352-151756374 GTTTCCTGTCCTTGCAATGCTGG + Intronic
1034542764 7:151769624-151769646 GATTCCTGTTCCCACAATTCTGG - Intronic
1034986363 7:155517968-155517990 GATTTCTGTCCTCTCCCTTCAGG + Intronic
1035909059 8:3545563-3545585 GAATCCTGTCTTTACCATGAAGG + Intronic
1037633001 8:20675290-20675312 GATTTCTGGCCTCCCTATGCTGG - Intergenic
1037747165 8:21655066-21655088 GATTACTGTCCACACTATGGAGG + Intergenic
1039336931 8:36601688-36601710 GGTTGCTGTCCTGACCATCCAGG + Intergenic
1042852656 8:73231924-73231946 AATTCCTGGCCTCAAAATGCTGG + Intergenic
1048473438 8:134723061-134723083 AATTTATGTCCTCACCATTCTGG - Intergenic
1050136743 9:2473412-2473434 CATTCCTGGCCTCACTAAGCTGG + Intergenic
1050961421 9:11738230-11738252 TATTCCTGTCCTCACCATATTGG + Intergenic
1051037288 9:12763706-12763728 GAGTGATGTCCTCATCATGCTGG - Intergenic
1054713764 9:68537295-68537317 GATTGCTGTCACCACCAGGCCGG + Exonic
1059599337 9:115759450-115759472 AATTACTGTCATCACCATCCAGG + Intergenic
1060140871 9:121208897-121208919 GGTCCCTGTCCTCACCTTGGTGG - Intronic
1061388929 9:130306535-130306557 GAGTCCCGTCCCCACCATTCAGG + Intronic
1062391520 9:136335843-136335865 GGCTCCTGTCCACTCCATGCTGG + Intronic
1185470443 X:378540-378562 GAATCCTGTCCTCACCCTGCAGG + Intronic
1186124817 X:6401716-6401738 GACTGCTGTCCTCATTATGCTGG + Intergenic
1188083855 X:25879719-25879741 GATTAGTGTCCTTACCATGGAGG + Intergenic
1190560341 X:51680402-51680424 TCTTCCAGTCCTCTCCATGCAGG + Intergenic
1190563950 X:51712919-51712941 TCTTCCAGTCCTCTCCATGCAGG - Intergenic
1190768130 X:53492519-53492541 GATTCCTGTGCTCACTCGGCAGG - Intergenic
1191595668 X:62941310-62941332 GATACATGTGCTCAACATGCAGG - Intergenic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1198045603 X:132898718-132898740 GATTTCTGTCTTCTCAATGCAGG - Intronic
1200214313 X:154360678-154360700 GCTTCCTGCCCTCACCAAACAGG + Intronic
1201198719 Y:11519589-11519611 TATTCCTGTCCTTTCCATTCTGG - Intergenic