ID: 1105688510

View in Genome Browser
Species Human (GRCh38)
Location 13:22811460-22811482
Sequence CACGTTGCAAAGATGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105688510 Original CRISPR CACGTTGCAAAGATGAAAGT AGG (reversed) Intergenic
901188057 1:7387683-7387705 CACGGTGTAAAAATGATAGTGGG + Intronic
905965207 1:42087229-42087251 CACCTTGGGAAGATGTAAGTGGG - Intergenic
908087198 1:60648211-60648233 GAGCTTGCAAAGATCAAAGTTGG + Intergenic
908379138 1:63578091-63578113 CAAGTTGGAAAAATGAATGTGGG + Intronic
910324581 1:85990825-85990847 CACGTTCAAAGGATGAAAGGAGG + Intronic
911170914 1:94770046-94770068 CATGCTGCCAAGATGAATGTGGG - Intergenic
911541411 1:99162389-99162411 CGGGTTGCAAAGAAGACAGTGGG + Intergenic
912895183 1:113579142-113579164 CACAGTGCAAAGATCACAGTAGG - Intronic
917586846 1:176435619-176435641 AACGCTGGAAAGAAGAAAGTTGG + Intergenic
918623059 1:186627104-186627126 CATGCTGCACAGCTGAAAGTGGG - Intergenic
1066237530 10:33500994-33501016 CAAGGAACAAAGATGAAAGTGGG + Intergenic
1067574261 10:47398383-47398405 CACATTGCAGAAATGGAAGTGGG - Intergenic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1071944866 10:90632986-90633008 AACGTTGCAAGGATAAAAGCAGG - Intergenic
1074921489 10:118018877-118018899 CATGTGGCAGAGATCAAAGTGGG + Intronic
1075663941 10:124217596-124217618 CACTTTGTAAAGATGGAAGCTGG + Intergenic
1077509455 11:2948990-2949012 CAAGTAGCAAAGATGTAACTTGG - Intronic
1085613192 11:77971959-77971981 CACGTGTAAAAGAAGAAAGTTGG - Intronic
1085669710 11:78451505-78451527 CAGGTTGGAAACAAGAAAGTTGG + Intronic
1087148915 11:94840445-94840467 CAAGTTGCAAAAATGACAGTGGG + Intronic
1090563098 11:127954866-127954888 CACATTGCAGAAATGAAAGAAGG + Intergenic
1091104087 11:132902193-132902215 CAGTTTGCAATGAAGAAAGTTGG - Intronic
1092573413 12:9750797-9750819 CGCGTGGCAGAGATGAAACTCGG + Intergenic
1092741141 12:11630763-11630785 CACGTTGCAAAGATTGAAAAAGG + Intergenic
1093530572 12:20157343-20157365 CACTTTCTAAATATGAAAGTGGG + Intergenic
1095599058 12:43994149-43994171 CAAGTTGCAAGTATGAAATTTGG - Intronic
1099194441 12:79598756-79598778 CAGGTGACAAAAATGAAAGTTGG - Intronic
1100381564 12:94066530-94066552 CATGTTGCAAAGATGCACATAGG + Intergenic
1102767294 12:115444588-115444610 CACTATCCAAAGATGTAAGTTGG + Intergenic
1104257316 12:127151093-127151115 CACATTGCAAAGCCGAAAGAAGG + Intergenic
1105688510 13:22811460-22811482 CACGTTGCAAAGATGAAAGTAGG - Intergenic
1105840578 13:24250542-24250564 CAGGTTTTAAAAATGAAAGTGGG - Intronic
1110246337 13:73328643-73328665 CATGTTACAAAAATGAAAGCTGG - Intergenic
1111723785 13:91978935-91978957 CAGGTTGATAAGATGAAAGCAGG + Intronic
1112198875 13:97255680-97255702 CACTTTGCAAATAGGAAAGCTGG + Intronic
1113827331 13:113266745-113266767 CACCTTGAAAAGAGAAAAGTTGG + Intronic
1122138752 14:99649835-99649857 TACCTTGCAGAGATGAAAGAAGG + Intronic
1124237349 15:28002238-28002260 TACGTTCCAAAGATCCAAGTTGG - Intronic
1127361269 15:58246952-58246974 CACATTGCAGACATCAAAGTAGG - Intronic
1127979209 15:64022056-64022078 TACCTTGCAAAGAGGAAAGCAGG + Intronic
1129878431 15:78992114-78992136 CAAGTTGCTAAGCTGGAAGTGGG + Intronic
1130173927 15:81547771-81547793 CAGGTTTCAAAAATGAAAGGAGG + Intergenic
1135349241 16:21714926-21714948 CACGTTGGAGAGGTGAAAGGCGG + Intronic
1137284262 16:47002156-47002178 CAGGTTCCAAATAAGAAAGTAGG - Intergenic
1138381319 16:56604655-56604677 CATGTTGAAAAGAGGAAATTAGG - Intergenic
1147536786 17:41326892-41326914 CACGTGACCCAGATGAAAGTCGG + Intergenic
1149100240 17:52897330-52897352 CACGTAACACAGATGAAAGTAGG - Intronic
1149450007 17:56742621-56742643 CACTATGTAAAGATGGAAGTAGG + Intergenic
1151270230 17:72988582-72988604 CATGTTGCAAATCTGAAACTCGG + Intronic
1153061580 18:1000618-1000640 CATTTTGCAATGATGAATGTAGG - Intergenic
1153995990 18:10441833-10441855 CACTTTACAAAGGAGAAAGTGGG + Intergenic
1154148390 18:11885668-11885690 CACGTTACCATGATGAAACTGGG + Exonic
1158327817 18:56329362-56329384 TTCTTTGCAAAGATGAACGTGGG - Intergenic
1159209450 18:65297885-65297907 CAGGATTCAAATATGAAAGTTGG - Intergenic
1165289802 19:34874022-34874044 CAGGATGCAAAGGTGACAGTCGG + Intergenic
1165991516 19:39817876-39817898 CAAGTTGCAAAGATGATACAGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167523045 19:49968283-49968305 CACTTTAAAATGATGAAAGTAGG - Intergenic
926098695 2:10099498-10099520 CACTTTGGAAAGGTGAAGGTGGG - Intergenic
926220387 2:10932221-10932243 CACGTTTCAAAGATGAGAAAGGG - Intergenic
932278035 2:70466031-70466053 CACTTTGCAAAAGTGAAATTAGG - Intronic
933792309 2:85892757-85892779 CAAGTTGCAATGATGAAATGAGG + Intergenic
936914828 2:117629469-117629491 CATGTTTTAAAGATGAAATTAGG - Intergenic
939762244 2:146197565-146197587 CATTTTACAAAGATTAAAGTAGG + Intergenic
941773927 2:169371420-169371442 CACGTTGCAAAGTTAACTGTAGG - Intergenic
942602646 2:177657428-177657450 CACCTTGCAAAGCTACAAGTAGG - Intronic
946202969 2:218081851-218081873 CATGTTGCAGGGAAGAAAGTTGG - Intronic
946234893 2:218318079-218318101 CACGGTGCAAAGATGGAGGCAGG + Intronic
947922226 2:233887177-233887199 CACATTGCAATGATGTGAGTAGG + Intergenic
1168946779 20:1767519-1767541 CTAGTGGCAAAGATGAATGTGGG - Intergenic
1169687093 20:8287589-8287611 CACCTTGTAAAGATGAATGCGGG - Intronic
1176453411 21:6884670-6884692 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
1176831586 21:13749718-13749740 CTCGGGGCAAAGATGGAAGTTGG + Intergenic
951328044 3:21329178-21329200 CAGGAAGCAAATATGAAAGTTGG - Intergenic
953835143 3:46336322-46336344 AACTTTGAAAAGAAGAAAGTTGG + Intergenic
955796454 3:62642429-62642451 CAAGTAGCAGAGATGACAGTTGG + Intronic
957358612 3:79124977-79124999 CACAATCCAAAGATGTAAGTTGG + Intronic
957739051 3:84239022-84239044 CACGTAGTGAAGATAAAAGTAGG + Intergenic
959327411 3:104955449-104955471 CACGTGGTAATGAAGAAAGTGGG + Intergenic
959566044 3:107834268-107834290 GCTGTTGCAAAGATGTAAGTGGG - Intergenic
961193784 3:124984357-124984379 GACGTGGCAAATATGAAAGAGGG + Intronic
962918661 3:139932174-139932196 CTTGTTGCAAAGATTAAAGAAGG + Intergenic
964745265 3:160006437-160006459 CACTTTAAAAAGGTGAAAGTAGG - Intergenic
973168969 4:47114713-47114735 CAAGTTTCAAAAATGAAAGTTGG - Intronic
975493906 4:75017125-75017147 CACGTTTGAAAGATGACAGAGGG - Intronic
981311221 4:143299821-143299843 CTCTTTTCAAAGGTGAAAGTAGG - Intergenic
982086648 4:151842544-151842566 AACGTGGGAAAGATGAGAGTAGG + Intergenic
982606392 4:157521699-157521721 CACGTGGGAAAGATGAAGGCTGG + Intergenic
983388185 4:167093093-167093115 CAAGTTGCAAGAATTAAAGTGGG - Intronic
984665021 4:182417665-182417687 CAAGAAGCAAAGATGAAAATAGG + Intronic
988427915 5:31085328-31085350 AAAGTTACAAAGATGAAATTGGG + Intergenic
989750922 5:44892592-44892614 CACGTTAAAAAGATCCAAGTGGG - Intergenic
992058528 5:73018434-73018456 CACGTTGACAGAATGAAAGTGGG + Intronic
994096004 5:95848466-95848488 CAGTTTGCAAAGGTTAAAGTCGG + Intergenic
995511843 5:112918436-112918458 CAGGATGCAAAGATGAAATTGGG - Intronic
1000864802 5:166500567-166500589 AAAGTTGCAAAGGTGAAACTTGG + Intergenic
1004930397 6:20457570-20457592 GACGTAGCAAAGAGGTAAGTGGG + Intronic
1008379854 6:50828832-50828854 CATGTTGGGAAGATGGAAGTTGG + Intronic
1021465242 7:20935561-20935583 CACTTTGAAAACATGAAGGTAGG - Intergenic
1025080502 7:55977899-55977921 CAAATTGCAAAGATAAATGTGGG + Intronic
1028641238 7:93044029-93044051 CTATTTGCAAAGATGAAAATCGG - Intergenic
1030557480 7:111044773-111044795 CAAGTTACAAATATGTAAGTGGG + Intronic
1032354609 7:131198609-131198631 TAAGTTGTAATGATGAAAGTGGG + Intronic
1033001921 7:137514834-137514856 CAGGTTGCAATGATGGAAATAGG - Intronic
1036174837 8:6527493-6527515 CACTTTCCAGATATGAAAGTCGG - Intronic
1036393194 8:8342984-8343006 CGGGTTGCAAAGATGTGAGTTGG - Intronic
1037718249 8:21418320-21418342 CAGGTTGCAGAGCAGAAAGTTGG - Intergenic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1039928069 8:41957224-41957246 CACGGTGCAAAGGTTAAAGGCGG - Intronic
1043347741 8:79319578-79319600 CACCATGCAAAGATGAAGGCAGG - Intergenic
1043622234 8:82208890-82208912 CACTTTGTATAGATTAAAGTGGG + Intergenic
1046057345 8:109094706-109094728 CATGTTGCAAATATAAAATTAGG + Intronic
1047336074 8:123937545-123937567 CACGTTGGAAAGAAGATAGGAGG + Intronic
1047942663 8:129840617-129840639 AACCCTTCAAAGATGAAAGTTGG + Exonic
1048755256 8:137731209-137731231 TATGATGCAAAGATGAAAGATGG + Intergenic
1056047110 9:82730153-82730175 AACGTGCCAAAGATGAGAGTAGG - Intergenic
1062270405 9:135705685-135705707 CAAGTTCCACAGGTGAAAGTGGG - Intronic
1187280908 X:17858085-17858107 GACGTTGTAAAGATTAAAGTGGG - Intronic
1188801114 X:34531311-34531333 CAGCTTGCAAAGATGAATGGTGG + Intergenic
1193514212 X:82444030-82444052 CAAGTTGCAAAATTAAAAGTAGG - Intergenic
1197052852 X:122081008-122081030 CATGTTGCAAAGATGACAAAGGG - Intergenic