ID: 1105693744

View in Genome Browser
Species Human (GRCh38)
Location 13:22867565-22867587
Sequence GGACAACACCATAGGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105693744_1105693749 3 Left 1105693744 13:22867565-22867587 CCCTGACTCCTATGGTGTTGTCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1105693749 13:22867591-22867613 TGGCAGCACAACTAAAGTTGAGG 0: 1
1: 0
2: 0
3: 2
4: 116
1105693744_1105693750 4 Left 1105693744 13:22867565-22867587 CCCTGACTCCTATGGTGTTGTCC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1105693750 13:22867592-22867614 GGCAGCACAACTAAAGTTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105693744 Original CRISPR GGACAACACCATAGGAGTCA GGG (reversed) Intergenic
902150473 1:14438761-14438783 AGAAATTACCATAGGAGTCAGGG + Intergenic
903848447 1:26291963-26291985 GGAGAGGACCAGAGGAGTCAGGG - Intronic
904253857 1:29242228-29242250 GGACACCACCATAGGTCACAAGG - Intronic
904759543 1:32792286-32792308 GGACCACACCACAGGAGTAAAGG + Intronic
914739242 1:150449733-150449755 GGACTTCAACATATGAGTCAGGG + Intronic
919041915 1:192399848-192399870 GGACAGCACAATCGAAGTCAGGG - Intergenic
920091770 1:203458926-203458948 GGACAACACCCTTGGAGTAAAGG - Intergenic
921351706 1:214242731-214242753 GGACAACACCATTGACGTCAAGG + Intergenic
921817279 1:219578005-219578027 GGACAACTCAATAGGATCCAAGG - Intergenic
923211078 1:231804935-231804957 TGGCAACACCTTGGGAGTCATGG + Intronic
1064510508 10:16084795-16084817 TGACAACAGGACAGGAGTCATGG + Intergenic
1070669725 10:78369464-78369486 GGACAACCCCAGAGGAGCCGAGG - Intergenic
1072964119 10:99956468-99956490 GGAGAACACCTTAGGAGTAGAGG - Exonic
1073866221 10:107807415-107807437 GAACAATACCATCAGAGTCAAGG - Intergenic
1077173146 11:1177257-1177279 TGACAACACGAAAGGAGTCCTGG - Intronic
1079394732 11:20051726-20051748 GGACAAGAGCACAGGAGGCAAGG + Intronic
1083158518 11:60840574-60840596 GGACAAGAGCTTAGGAGGCAGGG + Intergenic
1084173109 11:67410006-67410028 AGCCAGCACCAAAGGAGTCAGGG + Exonic
1087810345 11:102603393-102603415 GGACAGCACCTTAGGAGGCAGGG + Intronic
1091837603 12:3596542-3596564 AGACAACAAAATAGGAGTCTGGG - Intergenic
1092283893 12:7117605-7117627 GGCCAACACAATAGGAGGTAGGG + Intergenic
1098753481 12:74326023-74326045 GGAGACAACAATAGGAGTCAAGG - Intergenic
1100117559 12:91326285-91326307 GGACAACTCCACATGAGTCAAGG + Intergenic
1100489808 12:95068357-95068379 GGACATCACCATAGGAATTTGGG + Intronic
1103031235 12:117615068-117615090 GGAGAACACCCTAGGGGCCAAGG - Intronic
1103483883 12:121269563-121269585 TGACGACACCATAGGAGCCCTGG + Exonic
1105285435 13:18999629-18999651 GGACTACTGCATAGGAGCCAGGG + Intergenic
1105693744 13:22867565-22867587 GGACAACACCATAGGAGTCAGGG - Intergenic
1106690556 13:32111001-32111023 GGGCAACATCATAGGATTCTGGG + Intronic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1108420803 13:50247236-50247258 AGACATCACCATAGGATACATGG - Intronic
1118536100 14:66766374-66766396 GGACTACACTTTAGGAGTGAAGG + Intronic
1119968621 14:78944540-78944562 GGACACCATCATAGGAATCAGGG - Intronic
1122544565 14:102515035-102515057 GGACAAAACCAGTGGAGACAAGG + Intergenic
1126270923 15:46815935-46815957 GGACTACAACAGAAGAGTCAGGG + Intergenic
1129247472 15:74288238-74288260 GGCCAACTCCAGAGAAGTCAGGG + Intronic
1131081415 15:89539446-89539468 GGAGAATACCATATAAGTCAGGG + Intergenic
1134054574 16:11161604-11161626 GGTCAAATCCATAGGACTCAGGG - Intronic
1138329012 16:56197927-56197949 TGAAAACACCCTAGGAGACAGGG - Intronic
1139270910 16:65681732-65681754 AGCCACCACCAGAGGAGTCACGG - Intergenic
1141131369 16:81439496-81439518 GGACAACATCATATGTGTGATGG + Intergenic
1143506101 17:7366317-7366339 GGAAGACACCAGAGCAGTCAGGG + Intergenic
1147154938 17:38539704-38539726 GGACGACACCAGAGGATTGAGGG - Intronic
1148291989 17:46460237-46460259 GGGCTACACCATAGGAGCAAGGG + Intergenic
1148314179 17:46677928-46677950 GGGCTACACCATAGGAGCAAGGG + Intronic
1153162705 18:2226917-2226939 AGACTACACCATAGGAATAAGGG + Intergenic
1153618231 18:6953215-6953237 GATCCACACCATAGGAGCCATGG + Intronic
1157053448 18:44197430-44197452 GGCCAACACCAAAGGCATCAGGG - Intergenic
1160952066 19:1672362-1672384 GGACAACACCAGAAGACCCAGGG - Intergenic
1165592162 19:36978329-36978351 GGAGAACTCCACAGGAATCAGGG - Intronic
926289337 2:11516375-11516397 GGACGGCACCAGAGCAGTCAGGG - Intergenic
930683751 2:54285875-54285897 GGACAACATCCTAGAAATCATGG + Intronic
932512403 2:72307137-72307159 GGACTATACCATTGCAGTCATGG - Intronic
936160962 2:110084075-110084097 GGACAGAACTACAGGAGTCATGG - Exonic
936183701 2:110287279-110287301 GGACAGAACTACAGGAGTCATGG + Intergenic
937556064 2:123157590-123157612 GGACAACACCATGGTCCTCATGG - Intergenic
938421883 2:131153090-131153112 GGCCAAGACCAGGGGAGTCAAGG - Intronic
940036398 2:149316404-149316426 GTACAACAGGATAGTAGTCAAGG - Intergenic
945406565 2:209456006-209456028 TGACAACTCCTTAGGACTCAAGG + Intronic
945850349 2:214998784-214998806 AGACCACACCTTAGGAGCCATGG + Intronic
948460022 2:238124497-238124519 GGACCACAGCACAGGAGTCAGGG + Intronic
1171383877 20:24753967-24753989 TGACAACACCATAGGATGCCTGG + Intergenic
1172400979 20:34651201-34651223 GGACTACACTCTAGGAGTAAGGG - Intronic
1173036434 20:39415652-39415674 GGTCACCATCATAGGTGTCATGG - Intergenic
1179624409 21:42640531-42640553 GGACCCCACCATAGCACTCAGGG + Intergenic
949855330 3:8456310-8456332 AGACAAAACCCTAGGAATCAGGG + Intergenic
950166733 3:10806507-10806529 TGACAACCACATAGGTGTCAGGG + Intergenic
950266404 3:11576517-11576539 GGACAAAACCCTGGGAGACACGG + Intronic
950969895 3:17175891-17175913 GGACAAGAGCATATGAGCCAGGG - Intronic
953449473 3:42994320-42994342 GGACAACACCAGGGGAGGCATGG + Intronic
956584529 3:70850475-70850497 AGACGCCACCATAGGAGCCAGGG + Intergenic
959591270 3:108084500-108084522 GAAGAAAACCATGGGAGTCAGGG - Intronic
960489645 3:118299025-118299047 GGACATCACCATAGATGTTACGG - Intergenic
970239479 4:13993468-13993490 AGACAACACCATGGGAGTGCAGG + Intergenic
972897428 4:43640684-43640706 GGATAACAGCAAAGGAGGCATGG + Intergenic
980749951 4:137075966-137075988 GGACATCTGCATAGAAGTCAGGG + Intergenic
985072220 4:186177648-186177670 GGACTACACTCTAGGAGTAAGGG + Intergenic
986264609 5:6181249-6181271 GGAGAGCACCATAGGAGAGAGGG - Intergenic
996268517 5:121573590-121573612 GGACAACAAAGTATGAGTCAGGG + Intergenic
997147680 5:131454708-131454730 GTACAAAACCATAGGTTTCAAGG + Intronic
999764228 5:154726172-154726194 GGGCAACACCCTAGGAGTAGAGG + Intronic
1000635097 5:163635018-163635040 GGTCAACAACATAGGTTTCAGGG - Intergenic
1004814241 6:19295263-19295285 GGGCAAGACCAGAGGAATCATGG + Intergenic
1007730891 6:43945300-43945322 GGGCTACACCCTAGGAGTTATGG + Intergenic
1012882669 6:104809707-104809729 GGGAAACAACATAGGAATCAGGG + Intronic
1016935517 6:149446657-149446679 GGAGAATACCGTAGAAGTCAGGG - Intergenic
1025872843 7:65450952-65450974 GAAAAACACAATAGTAGTCATGG - Intergenic
1026589843 7:71685109-71685131 GGAGAACACCGAAGGACTCAAGG - Intronic
1028323309 7:89490191-89490213 TGACAGCAGCATAGGAGTGAGGG - Intergenic
1030030740 7:105366975-105366997 GAATAACACCATGGGACTCACGG - Intronic
1030116874 7:106068686-106068708 GGGCAAGACCACAGGAGTCTGGG - Intergenic
1031959777 7:127978337-127978359 GGACAACATCTTAGGAGCAAAGG + Intronic
1033665388 7:143436195-143436217 GGACATCACCATAGGAGCTGGGG - Intergenic
1034660183 7:152761945-152761967 TGACAACATCATAAGAGTCATGG + Intronic
1036812943 8:11880157-11880179 GGAAACCACTATAGGAGTCAGGG - Intergenic
1038432936 8:27514498-27514520 GGACCCCACCATAACAGTCAAGG + Intronic
1039882504 8:41633761-41633783 GGACAACTCCATAGAGGGCAGGG + Intergenic
1048459704 8:134611418-134611440 TGACAACTCCATAGGAAGCAGGG + Intronic
1049186280 8:141255845-141255867 GGCCAATACCACAGGAGTCCAGG - Intronic
1052290417 9:26833895-26833917 AGACAACACAACAGGAGTGAGGG + Intergenic
1053185458 9:36012645-36012667 GGGCAGCACCATAGGAATAAGGG - Intergenic
1054735569 9:68746657-68746679 GGACAAGACCAGAAGAGACATGG - Intronic
1059210696 9:112512800-112512822 GGAAGACACCAGAGCAGTCAGGG + Intronic
1189540588 X:41983667-41983689 GGAGACCACCGTAGGAGTCTAGG + Intergenic
1192758384 X:74069598-74069620 AGACAACATCATGGGAGTTAGGG + Intergenic
1198160341 X:134001800-134001822 GGAGAAAACAATAGTAGTCATGG + Intergenic