ID: 1105698520

View in Genome Browser
Species Human (GRCh38)
Location 13:22915477-22915499
Sequence GGAGGAGGAAGATGGCGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 2, 1: 1, 2: 8, 3: 95, 4: 944}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105698520 Original CRISPR GGAGGAGGAAGATGGCGGCG GGG Intergenic