ID: 1105699789

View in Genome Browser
Species Human (GRCh38)
Location 13:22927075-22927097
Sequence TCCGCAGCTCGTCCTCCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105699789_1105699792 14 Left 1105699789 13:22927075-22927097 CCGCACGGAGGACGAGCTGCGGA 0: 1
1: 0
2: 1
3: 8
4: 58
Right 1105699792 13:22927112-22927134 TAGCCAAGCTCCTGCCGCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1105699789_1105699791 -10 Left 1105699789 13:22927075-22927097 CCGCACGGAGGACGAGCTGCGGA 0: 1
1: 0
2: 1
3: 8
4: 58
Right 1105699791 13:22927088-22927110 GAGCTGCGGAGCGCGGTGTGCGG 0: 1
1: 1
2: 1
3: 11
4: 120
1105699789_1105699796 30 Left 1105699789 13:22927075-22927097 CCGCACGGAGGACGAGCTGCGGA 0: 1
1: 0
2: 1
3: 8
4: 58
Right 1105699796 13:22927128-22927150 GCCAAGGCCACCCCGAGCCCAGG 0: 1
1: 1
2: 1
3: 40
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105699789 Original CRISPR TCCGCAGCTCGTCCTCCGTG CGG (reversed) Intergenic