ID: 1105699789

View in Genome Browser
Species Human (GRCh38)
Location 13:22927075-22927097
Sequence TCCGCAGCTCGTCCTCCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105699789_1105699796 30 Left 1105699789 13:22927075-22927097 CCGCACGGAGGACGAGCTGCGGA 0: 1
1: 0
2: 1
3: 8
4: 58
Right 1105699796 13:22927128-22927150 GCCAAGGCCACCCCGAGCCCAGG 0: 1
1: 1
2: 1
3: 40
4: 331
1105699789_1105699792 14 Left 1105699789 13:22927075-22927097 CCGCACGGAGGACGAGCTGCGGA 0: 1
1: 0
2: 1
3: 8
4: 58
Right 1105699792 13:22927112-22927134 TAGCCAAGCTCCTGCCGCCAAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1105699789_1105699791 -10 Left 1105699789 13:22927075-22927097 CCGCACGGAGGACGAGCTGCGGA 0: 1
1: 0
2: 1
3: 8
4: 58
Right 1105699791 13:22927088-22927110 GAGCTGCGGAGCGCGGTGTGCGG 0: 1
1: 1
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105699789 Original CRISPR TCCGCAGCTCGTCCTCCGTG CGG (reversed) Intergenic
900166635 1:1246627-1246649 GCCGCAGCTCGTGCTCCTCGGGG - Exonic
900291243 1:1924404-1924426 TCCTCAGCTCGCCCTCCCAGAGG - Exonic
900322888 1:2093755-2093777 TACACAGCACGTCCTCTGTGAGG - Intronic
900823863 1:4910879-4910901 TCCACAGCTCGACCTGCATGGGG - Intergenic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
902923174 1:19679317-19679339 GCCGCAGCTCGGGCTCCGCGGGG - Exonic
910723651 1:90314888-90314910 TCCGCAGATTCTCCTCCCTGTGG + Intergenic
922992777 1:229929565-229929587 TCCAGAGCTCTCCCTCCGTGTGG - Intergenic
1062988383 10:1791127-1791149 TCAGCAGCTTGTCCTGCCTGAGG - Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063371428 10:5525214-5525236 CCCGCAGCTCGGCCTCCGTGGGG - Exonic
1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077189900 11:1251561-1251583 TTCCCAGCTCGTCCACCGTGGGG + Exonic
1091410757 12:237640-237662 TCCGCACTTCCTCCTCCCTGTGG - Intronic
1092183259 12:6460757-6460779 TCCTTAGCTCCTCCTCCCTGGGG + Intronic
1096529789 12:52235310-52235332 TCCGCAGCTCCGCCTCCAGGCGG - Exonic
1098367032 12:69714530-69714552 TACTCAGGTCATCCTCCGTGAGG + Intergenic
1100057050 12:90524640-90524662 TCCTCAGCTAGTCATCCATGGGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1113789146 13:113018202-113018224 TCCGCAGCTCGTCCTGACTTTGG - Intronic
1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG + Intergenic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG + Exonic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1141994959 16:87630435-87630457 TCCCCAGCCAGTCCTCCCTGGGG + Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151216236 17:72578522-72578544 TCCTCAGCGCTTCCTCCTTGGGG - Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1167509855 19:49890338-49890360 TCCGCAGCGCCTCCTGCATGTGG + Exonic
1168310071 19:55455764-55455786 TCCCCAGCTCGGGCACCGTGGGG + Exonic
1168694630 19:58397358-58397380 TCCGCAACCCCTACTCCGTGGGG + Intergenic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
934686382 2:96325140-96325162 TCCGCTGCTCGGCCTCCCTGGGG - Intergenic
942093146 2:172513536-172513558 TCCGCAGCTGGTGCCCTGTGTGG + Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
946360366 2:219216037-219216059 TCCGCAGCACCTCCCCTGTGCGG + Exonic
1173751453 20:45479979-45480001 TCCCCAGCTCGGCCTCTGTCGGG + Exonic
1180782655 22:18529596-18529618 TCTGCAGCGCGTCCTGGGTGTGG - Exonic
1181126215 22:20703623-20703645 TCTGCAGCGCGTCCTGGGTGTGG - Intergenic
1181239545 22:21468934-21468956 TCTGCAGCGCGTCCTGGGTGTGG - Intergenic
1184782939 22:46658179-46658201 TCCGGAGCTCCTCCTCTATGGGG - Exonic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
961017555 3:123479492-123479514 TGGGCAGCTGGCCCTCCGTGGGG - Intergenic
969326507 4:6447402-6447424 TCCGGAGCTCTTCCTCCGCAGGG - Intronic
969475179 4:7418298-7418320 TCCGCAGCACTTCCTCCCTATGG - Intronic
973982006 4:56315050-56315072 ACCGCAGCTCCTCCACCTTGCGG - Exonic
990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG + Intergenic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1015287987 6:131507486-131507508 CCCGAAGCTCGGCGTCCGTGAGG + Intergenic
1021241056 7:18201548-18201570 TGCTCAGCTAGTCCTCCCTGAGG - Intronic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG + Exonic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1051173832 9:14345072-14345094 TCCTGAGCTCGGCCTCCCTGGGG + Intronic
1055724174 9:79209990-79210012 TCCTCAGCTTATCCTCCCTGAGG + Intergenic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1057719966 9:97524251-97524273 TCCTCAGCTCTTCCTCTGTTAGG - Exonic
1061219775 9:129243455-129243477 TCGGCAGCTTGTCCTCCTTGTGG + Intergenic