ID: 1105702917

View in Genome Browser
Species Human (GRCh38)
Location 13:22947217-22947239
Sequence ATGCACTAGCCAACACTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105702917_1105702918 -10 Left 1105702917 13:22947217-22947239 CCTGTTAGTGTTGGCTAGTGCAT 0: 1
1: 1
2: 1
3: 6
4: 46
Right 1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105702917 Original CRISPR ATGCACTAGCCAACACTAAC AGG (reversed) Intergenic