ID: 1105702918

View in Genome Browser
Species Human (GRCh38)
Location 13:22947230-22947252
Sequence GCTAGTGCATAGCAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105702917_1105702918 -10 Left 1105702917 13:22947217-22947239 CCTGTTAGTGTTGGCTAGTGCAT 0: 1
1: 1
2: 1
3: 6
4: 46
Right 1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105702918 Original CRISPR GCTAGTGCATAGCAGTGCTG TGG Intergenic
900923611 1:5689450-5689472 GTTAGGGCCTATCAGTGCTGGGG - Intergenic
901442820 1:9289795-9289817 GCTGATGAATAGCAGAGCTGGGG + Intergenic
902270174 1:15298532-15298554 GCTTCTTCATAGCAGTGCAGTGG + Intronic
902818130 1:18927574-18927596 GCTAGGGCAGCGCAGAGCTGAGG - Intronic
903137867 1:21321143-21321165 GCTAGTGCGTGGCGGAGCTGGGG + Intronic
903346261 1:22686024-22686046 GCTAGGGCATAGGAGAGCAGGGG - Intergenic
904860697 1:33535766-33535788 GCTGGTGCAAAGGAGTGCTGAGG - Intronic
905180345 1:36161452-36161474 GCTAGTGAGTAGCAAAGCTGGGG - Intronic
905486475 1:38300781-38300803 GCTAGTTTTTAGCAGAGCTGGGG - Intergenic
907193355 1:52666907-52666929 GCAAGAGCCTAGCAGTGCAGTGG - Intronic
907594551 1:55707339-55707361 GCTAGGGGACAGCTGTGCTGTGG + Intergenic
908312066 1:62894472-62894494 GCTATTGCAGAGCAGTGGGGTGG - Intergenic
909093561 1:71257775-71257797 GCTAGTGCATATCCCTGATGTGG - Intergenic
912718545 1:112000452-112000474 GCTGGTGCCAAGAAGTGCTGTGG + Intergenic
917444417 1:175095025-175095047 GCTAGTCAATGGCAGAGCTGGGG - Intronic
917635769 1:176934317-176934339 GCGAGTGGAGAGCATTGCTGAGG + Exonic
918082506 1:181218413-181218435 CCTGGTGCACAGCAGTTCTGGGG - Intergenic
921970929 1:221148301-221148323 GCTAATGCATGGCAGAGCTGAGG + Intergenic
922021586 1:221710312-221710334 GCTAGTGTTTGGCTGTGCTGGGG - Intronic
923581796 1:235224239-235224261 GCTAGAGAATAACAGTGTTGAGG + Intronic
1064321556 10:14310009-14310031 CCTCGTGCATCTCAGTGCTGGGG + Intronic
1068257106 10:54526110-54526132 GCTACTGTACAGCAGTGCTATGG + Intronic
1068451991 10:57202611-57202633 GCTAGTTCACAGCGGAGCTGAGG - Intergenic
1070662749 10:78319385-78319407 GCTAGTAAATGGCAGGGCTGGGG - Intergenic
1072921867 10:99583523-99583545 GCTAGTTAATAGCAGAGTTGTGG + Intergenic
1073539462 10:104306622-104306644 GCTAGTGATGAGCAGAGCTGAGG + Intergenic
1074451162 10:113560841-113560863 GCTAGAGATTAGCAGGGCTGAGG + Intronic
1076600362 10:131653411-131653433 GCTAGTGGATGGTAGGGCTGGGG - Intergenic
1078913898 11:15759868-15759890 GCCAGTGAATGGCAGAGCTGGGG - Intergenic
1083176443 11:60952782-60952804 GCTGGTGCTTAGGAGTTCTGAGG - Intergenic
1083211071 11:61186690-61186712 ACTCGTACATATCAGTGCTGGGG - Intergenic
1084504446 11:69556428-69556450 GCTAGTGAGGAGCAGAGCTGGGG - Intergenic
1089809107 11:121116858-121116880 ACTAGTGCCAAGGAGTGCTGAGG + Intronic
1090044000 11:123315247-123315269 GCTGCTGCAGCGCAGTGCTGGGG - Intergenic
1093152590 12:15640373-15640395 CCTGGTGGATAGCAGAGCTGTGG + Intronic
1094591453 12:31825280-31825302 GTTGGTGTATAGCAGTGCTACGG + Intergenic
1098260836 12:68668923-68668945 CCTATTTCATAGCATTGCTGAGG - Exonic
1099747892 12:86730919-86730941 GCTGCTTCATAGAAGTGCTGTGG - Intronic
1100313346 12:93418660-93418682 TCTGTTGGATAGCAGTGCTGTGG - Intronic
1100702882 12:97166670-97166692 GCTACTGCAGAGCTGTGCAGAGG + Intergenic
1100807012 12:98296230-98296252 GCAAGTGCAAAGCATTGCAGAGG + Intergenic
1100920691 12:99482818-99482840 GTTGGTGTATAGCAGTGCTATGG + Intronic
1101021010 12:100553797-100553819 CATAGTGCCTAGCACTGCTGTGG - Intronic
1102029352 12:109731087-109731109 GCTAGTGAATAGCAGAGCCAGGG + Intronic
1104361952 12:128141690-128141712 GCCAGTGCAGGGCAGAGCTGTGG - Intergenic
1105702918 13:22947230-22947252 GCTAGTGCATAGCAGTGCTGTGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1106253323 13:28000772-28000794 GCCAGTGCTGAGCAATGCTGAGG + Intergenic
1114569396 14:23655832-23655854 GAAAGTTCATAGCATTGCTGTGG - Intergenic
1114577423 14:23727042-23727064 GCTAGTTCCTAGGAGTCCTGGGG + Intergenic
1115841869 14:37481204-37481226 GTTAGTGCATAGAAGTGCTATGG - Intronic
1117437561 14:55731434-55731456 GCTTGTGCATAGAAGGGCGGTGG + Intergenic
1118004775 14:61555463-61555485 GCAAGGGGATAGGAGTGCTGAGG - Intronic
1120191935 14:81447460-81447482 TCTAGTGCACAGCAGGGCTGTGG - Intergenic
1122098194 14:99386731-99386753 GGCAGTGCGTGGCAGTGCTGGGG - Intergenic
1122194561 14:100075283-100075305 TCCAGTGCAGAGCAGAGCTGGGG - Intronic
1122844554 14:104485468-104485490 GCTATTGCATAGCCATGCTGTGG + Intronic
1123954736 15:25323642-25323664 GCTAGTGAACAGCAGTGATTAGG + Intergenic
1125421058 15:39504486-39504508 GCTAGTTCATGGCAGAGCTATGG + Intergenic
1127654325 15:61041982-61042004 GCTGATACATAGCAGAGCTGGGG + Intronic
1129153247 15:73702397-73702419 GCTGGTGCACAGCTTTGCTGAGG + Exonic
1129329584 15:74820229-74820251 CCTTGTGCAGGGCAGTGCTGCGG + Intronic
1131549276 15:93342772-93342794 GAAAGTGCATAGAAGTGATGTGG - Intergenic
1132665768 16:1080689-1080711 GCTGGTGCAGAGGAGAGCTGGGG + Intergenic
1134187130 16:12093300-12093322 GCTCTTGAACAGCAGTGCTGTGG - Intronic
1135266126 16:21027255-21027277 GTTAGTGCATAACAGTGCCTGGG - Intronic
1141917159 16:87106984-87107006 GCTAGTGCATGGCACAGCTTGGG + Intronic
1144439456 17:15268437-15268459 GCTAGTGAATGCCAGGGCTGGGG + Intergenic
1147536564 17:41325999-41326021 GCTCCTGCAGAGCAGGGCTGAGG + Intergenic
1148383615 17:47219118-47219140 GCGAGTCCATGGCAGAGCTGGGG + Intronic
1151364978 17:73611422-73611444 GCTATGGCATAGCAAGGCTGGGG + Intronic
1152270595 17:79322501-79322523 GCTAGTAGATTGCAGAGCTGAGG + Intronic
1155336174 18:24767482-24767504 GTTAGAGCATAGCATAGCTGGGG + Intergenic
1156154676 18:34287683-34287705 GGTACTGCCTAGCAATGCTGTGG - Intergenic
1156806426 18:41188318-41188340 GTTAGTCCATAGCAGAGGTGGGG - Intergenic
1157284568 18:46368756-46368778 GCAAGTGAATGGCAGAGCTGGGG - Intronic
1159892914 18:73969335-73969357 GTTAGTGCATGGCTGTGGTGTGG - Intergenic
1164864164 19:31590148-31590170 GCTAGTGCAGAGAAGAGCTGGGG + Intergenic
1165596915 19:37016680-37016702 GCTACTGGACAGCAGTGCTGAGG + Intronic
1166108638 19:40609976-40609998 GCCAGGGCAGAGCAGTCCTGGGG - Intronic
1166722658 19:45006013-45006035 CCTTGTGCCGAGCAGTGCTGAGG + Intronic
925612406 2:5712758-5712780 GCTAGTCAATGGCAGAGCTGGGG + Intergenic
926423912 2:12724243-12724265 GCAAATGCATGGCAGTGCAGAGG + Intronic
927963272 2:27254181-27254203 GCTAGACCATAGCACTGATGTGG - Intronic
928578437 2:32680437-32680459 GCTATTTCACAGAAGTGCTGAGG + Intronic
931401975 2:61939804-61939826 GCTTGTGAATGGCAGTTCTGAGG - Intronic
936008448 2:108909871-108909893 ACTAGTGAACAGCAGGGCTGGGG - Intronic
936284809 2:111173670-111173692 GCCAGTGGAGAGCAGGGCTGGGG + Intergenic
936630246 2:114194250-114194272 GCTATTGCTTGGCAGTGATGAGG - Intergenic
938039303 2:128062683-128062705 GCTGGTGCATGGCAGTCCTGAGG - Intergenic
940811406 2:158246794-158246816 GCTAGTGCACAGCACTGGTCTGG - Intronic
945301951 2:208222676-208222698 GCTTGAGCAGTGCAGTGCTGGGG + Intergenic
945568696 2:211436388-211436410 GCTAGAACATGGCAGGGCTGGGG - Intronic
1169539213 20:6581268-6581290 GCCATTGCATAGCAGTGGGGTGG - Intergenic
1169878972 20:10326862-10326884 GCCAGTGATTGGCAGTGCTGGGG + Intergenic
1172318090 20:33972067-33972089 GCTAGTGACTGGCAGAGCTGGGG + Intergenic
1175988195 20:62774753-62774775 GCTAGTGGCTGGGAGTGCTGGGG - Intergenic
1177481383 21:21694211-21694233 GATAGTCCATGGAAGTGCTGAGG + Intergenic
1181114144 22:20620764-20620786 TCTTGTGCCTAGCTGTGCTGGGG - Intergenic
1182705963 22:32280531-32280553 GCTCGTGCTTAGCAGTGCAGAGG - Intergenic
1183999830 22:41665126-41665148 GCTAGTGAAGAGCAGCCCTGGGG + Intergenic
1184861583 22:47175930-47175952 GCTAGTGCAGAGCCGGGCTTCGG - Intergenic
949273271 3:2246491-2246513 GCTGGCCCATAGCTGTGCTGGGG + Intronic
949454736 3:4226588-4226610 GCTAATTCATATAAGTGCTGCGG - Intronic
952625527 3:35398365-35398387 TCTAATGCATAGCAATACTGAGG - Intergenic
953664837 3:44918215-44918237 GCTATAGCATAGCAGTGGCGGGG + Intronic
954624190 3:52013577-52013599 GCTGGTGCAGAGCTGAGCTGGGG + Intergenic
955088766 3:55729045-55729067 GCCAGTCCATAGTAGTGATGAGG + Intronic
961360048 3:126361287-126361309 GCCAGTGCCGAGCATTGCTGCGG + Intergenic
961426887 3:126855453-126855475 CCTGGTGCACAGCAGTACTGGGG + Intronic
961525748 3:127496373-127496395 GCTAGGTCATGACAGTGCTGGGG - Intergenic
962453161 3:135538814-135538836 GCTGTTGCATAACAGTGTTGGGG - Intergenic
962651455 3:137497954-137497976 GTTGGTGGATAGCAGTGCTATGG + Intergenic
963796436 3:149635135-149635157 GCTAGCTCACAGGAGTGCTGGGG + Intronic
970152751 4:13107043-13107065 GGTAATGCCTAGCAGGGCTGTGG - Intergenic
970493983 4:16607234-16607256 GCAAGTGCATGGCAGCACTGAGG - Intronic
970617600 4:17781988-17782010 GCGAGTGCACAGCGGGGCTGGGG + Intergenic
970871727 4:20823975-20823997 GCTAGGAGGTAGCAGTGCTGGGG - Intronic
974991392 4:69094662-69094684 GCTAGTACTTAGCATGGCTGTGG + Intronic
978189271 4:105894731-105894753 GCTACTGCCTAGTAGTGTTGTGG - Intronic
980087399 4:128405406-128405428 GTTGGTGTATAGCAGTGCTATGG + Intergenic
980638641 4:135542453-135542475 GCTGGTGCATATCACTGCAGAGG + Intergenic
984082621 4:175267034-175267056 GCTGGTTCATGGCAGTGCAGCGG - Intergenic
984447079 4:179850097-179850119 GCTAGTGCATAGAGGTGGTATGG - Intergenic
986079606 5:4376251-4376273 GCAAGTGCAAAGCTGAGCTGGGG + Intergenic
991348858 5:65699972-65699994 GCTAGTGCATAGCAGGTATTTGG + Intronic
997328725 5:133043764-133043786 GCTAGAGCAGAGCTGGGCTGAGG + Intergenic
999327416 5:150651660-150651682 GCAGGTGCATAGCAGTGCAGTGG + Exonic
999438664 5:151584212-151584234 GCCAGGGCATACCAGGGCTGTGG + Intergenic
999801275 5:155039824-155039846 GCTAGTGCTTTGCAAAGCTGAGG + Intergenic
1001304391 5:170561056-170561078 GCTGGTGCGTGGCTGTGCTGTGG + Intronic
1002473595 5:179451891-179451913 GCCACTGCAGGGCAGTGCTGGGG - Intergenic
1002480506 5:179497860-179497882 GCCACTGCAGGGCAGTGCTGGGG + Intergenic
1002909872 6:1481589-1481611 GCTAGGGCATGAGAGTGCTGAGG + Intergenic
1003639665 6:7865987-7866009 ACTAGTGCACAGCAGTGGAGAGG + Intronic
1005507671 6:26483964-26483986 GCTACTGCAGAGCTGTGGTGGGG - Intergenic
1007262728 6:40575181-40575203 ACTAGTGCACAGCAGTGAGGAGG - Intronic
1012140151 6:95616510-95616532 GCTTCTGCTTAGCAGTGCTGTGG - Intergenic
1015047431 6:128793247-128793269 GTTAGTGTATAGCAGGGCTAGGG - Intergenic
1019352373 7:560638-560660 GCTGGTGCATTGCAGAGCTGAGG - Intronic
1019615215 7:1956340-1956362 GCAAGTGCAGAGCAGTGAAGCGG - Intronic
1019767478 7:2862571-2862593 GCTAGTGCCTGGCAGAGCTGGGG - Intergenic
1019772218 7:2890846-2890868 GCATGTGCATAGCAGTGCCTAGG + Intergenic
1020480649 7:8656027-8656049 TCTAGTGCATAGCAGTTTGGTGG + Intronic
1021585587 7:22203960-22203982 GCTAGTGAAAAGCAGTGATTCGG - Intronic
1021774896 7:24043908-24043930 GCTAGTATGTGGCAGTGCTGGGG - Intergenic
1022277372 7:28868595-28868617 GCTAGTGTATAGCAATGTTCTGG + Intergenic
1023840603 7:44095509-44095531 GCTGGTGAACAGCAGTGTTGGGG + Intergenic
1026451080 7:70530201-70530223 GCAAATGCATATCCGTGCTGGGG + Intronic
1030079825 7:105767711-105767733 GCCAGTGAATAGCAGAGCTAAGG + Intronic
1032840725 7:135711500-135711522 GCTGCTTCATAGCACTGCTGTGG - Intronic
1034280318 7:149849351-149849373 TTTAGTGCCCAGCAGTGCTGCGG - Intronic
1035286061 7:157807991-157808013 GCTAGTGAGCAGCAGAGCTGAGG + Intronic
1035959634 8:4122939-4122961 GCTACTGCAAAGCAGCACTGTGG + Intronic
1036553124 8:9832729-9832751 GTTAGTGCATAGCAATGCCCGGG + Intergenic
1037775640 8:21833830-21833852 GCTAGTGCTGGGCAGAGCTGGGG - Intergenic
1038986022 8:32811302-32811324 GCCAGTGCAGAGCAGTCTTGTGG - Intergenic
1045592611 8:103614400-103614422 GCTAGTGCATTGGAGAGGTGTGG + Intronic
1048182040 8:132204336-132204358 GATAGTGCACAGCTGTGGTGTGG - Intronic
1048330357 8:133466707-133466729 GCTGGAGCCCAGCAGTGCTGGGG - Intronic
1049388051 8:142354188-142354210 GCTGGTGCAGGGCAGAGCTGGGG - Intronic
1050051762 9:1609415-1609437 GCTAGTGAATATCAGAGCTGAGG - Intergenic
1050697139 9:8291876-8291898 GGAACTGCACAGCAGTGCTGAGG - Intergenic
1051557659 9:18403037-18403059 GCTAGTAAATGGCAGAGCTGTGG + Intergenic
1052182361 9:25545540-25545562 GGAAGTGCAGAGCAGTCCTGTGG - Intergenic
1052459232 9:28741580-28741602 TCCAGAGCATAGCACTGCTGGGG + Intergenic
1052530386 9:29675603-29675625 GATAGTGGATAGAAGGGCTGGGG + Intergenic
1052786566 9:32833512-32833534 GCTAGTTAGTAGCAGAGCTGGGG - Intergenic
1056782704 9:89563257-89563279 GCACGTGCATAGGTGTGCTGAGG - Intergenic
1057225457 9:93290695-93290717 GCTATAGCAGAGCAGTGCGGTGG + Intronic
1057796597 9:98162148-98162170 GCTAGTGAACAGCAGGCCTGGGG + Intronic
1057859755 9:98631026-98631048 TCTACTGCATAGCGCTGCTGGGG + Intronic
1060153416 9:121302809-121302831 GCTAGGTCAGGGCAGTGCTGGGG + Intronic
1061766689 9:132886029-132886051 GCTTGTGCATGGCAGTCCTTGGG + Intronic
1061812612 9:133171177-133171199 GCCAGTAAGTAGCAGTGCTGGGG - Intergenic
1062394292 9:136346532-136346554 CCTAGTGAATGGCAGTGATGAGG - Intronic
1062599358 9:137313008-137313030 GCTGGTGCACAGGAGTGGTGAGG + Intronic
1190877319 X:54469192-54469214 GCTAGTGAATGGCAGAGCTTAGG - Intronic
1194385027 X:93242158-93242180 GTTAGTGTATAGCAGTGCTACGG - Intergenic
1196753723 X:119139894-119139916 GCTAGTTAATTGCAGAGCTGGGG - Intronic
1200696269 Y:6363711-6363733 ACTAGTGCATTGCATTGGTGAGG + Intergenic
1201037845 Y:9800989-9801011 ACTAGTGCATTGCATTGGTGAGG - Intergenic