ID: 1105704660

View in Genome Browser
Species Human (GRCh38)
Location 13:22961552-22961574
Sequence CTGGCAAAGCCTTCCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 2, 2: 1, 3: 34, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105704652_1105704660 11 Left 1105704652 13:22961518-22961540 CCTTGTGGTTCTTGGTCTCACTT 0: 1
1: 1
2: 1
3: 24
4: 365
Right 1105704660 13:22961552-22961574 CTGGCAAAGCCTTCCTCCCTGGG 0: 1
1: 2
2: 1
3: 34
4: 243
1105704651_1105704660 14 Left 1105704651 13:22961515-22961537 CCTCCTTGTGGTTCTTGGTCTCA 0: 1
1: 1
2: 3
3: 24
4: 192
Right 1105704660 13:22961552-22961574 CTGGCAAAGCCTTCCTCCCTGGG 0: 1
1: 2
2: 1
3: 34
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105704660 Original CRISPR CTGGCAAAGCCTTCCTCCCT GGG Intergenic
900080888 1:856547-856569 GTGGCCGAGGCTTCCTCCCTGGG + Intergenic
900748205 1:4375777-4375799 CTAGTAAATCCTTCATCCCTAGG - Intergenic
900829970 1:4959011-4959033 TTGGCAGAGCCATACTCCCTTGG + Intergenic
902192491 1:14773476-14773498 CTGGAAGGGCCTTCCTCCCTCGG - Intronic
903137444 1:21318667-21318689 GTGGCAAAATCCTCCTCCCTGGG + Intronic
903472004 1:23593787-23593809 CTGTCTCAGCCTCCCTCCCTCGG + Intronic
903545513 1:24121279-24121301 CTGGCAAAGACTCCCCCACTGGG - Exonic
904341123 1:29835599-29835621 ATGACAAAGCCTTTCTCCCATGG - Intergenic
905651036 1:39657155-39657177 CAGCCATACCCTTCCTCCCTGGG + Intergenic
906380900 1:45331726-45331748 GTGGCAGAGCTCTCCTCCCTGGG + Exonic
906815056 1:48870199-48870221 CTTGCAAAGCCTATCTCACTAGG + Intronic
907513634 1:54980200-54980222 CTGAGAACGCCTTCCTCCCCAGG + Intergenic
911059259 1:93733543-93733565 GTGACAAAGCCTGCCTTCCTTGG + Intronic
913703736 1:121397638-121397660 CTGGCAAGTCATTTCTCCCTCGG - Intergenic
915483597 1:156204448-156204470 CTGGCACTGCCTGCCTCCTTGGG - Intronic
915734718 1:158077526-158077548 CTGCCTCATCCTTCCTCCCTGGG + Intronic
917549969 1:176016356-176016378 CTGGAAAAACTTTCCTCGCTTGG - Intronic
919802174 1:201360619-201360641 CTGCCAAACCACTCCTCCCTGGG - Intronic
920021767 1:202961808-202961830 GTGGCAAACCCTTCCTCCCTAGG + Intergenic
920389073 1:205587677-205587699 CTGTCAGGGCCTTCCTCACTCGG - Intronic
920531614 1:206706561-206706583 TTGGCAAGGGCTTGCTCCCTGGG - Intronic
920541351 1:206780676-206780698 CTGGGAAAGTCTTCTTCTCTAGG - Intergenic
921709325 1:218357512-218357534 CTGAGAAAGCGGTCCTCCCTGGG + Intronic
922609147 1:226911508-226911530 CTGGCGCAGCCTCCCTGCCTGGG + Intronic
923287165 1:232507398-232507420 CTGGCAAACACTACCTCCCTAGG - Intronic
923369468 1:233295717-233295739 TGGGAAAATCCTTCCTCCCTCGG - Intergenic
1063367238 10:5498859-5498881 AGCGCAAAGCCTTCCTCCCAGGG + Exonic
1065084845 10:22164161-22164183 CTGGCAGAGCCTTAGACCCTTGG - Intergenic
1065086466 10:22183639-22183661 ATGACAAAGCTTTCCTGCCTCGG + Intergenic
1067804468 10:49383405-49383427 CCAGCAAAGCTCTCCTCCCTGGG - Intronic
1069321820 10:67181403-67181425 CTTGGAAAGACTTCCTCTCTTGG - Intronic
1070805761 10:79269843-79269865 CTGGGAAAGGCTTCCTCGCCAGG - Intronic
1071023373 10:81083789-81083811 CAGGCAAAGCCTACTTCCCTGGG - Intergenic
1072831260 10:98661052-98661074 CTGACACAGCCTTCCTCCCAGGG + Intronic
1072915772 10:99536611-99536633 GGGGGAAAGCCATCCTCCCTGGG + Intergenic
1073327118 10:102649524-102649546 CTGGGAAAGCCTTCCTTTCCCGG + Intronic
1074545620 10:114400092-114400114 CAGAAAAAGCCATCCTCCCTTGG + Intronic
1074919546 10:117993353-117993375 CTGGCAAAGTCTGCCTTCCTGGG - Intergenic
1075443564 10:122498392-122498414 CTGGCAGATCCTTCCTGCCCTGG + Intronic
1076373379 10:129968519-129968541 CTGGCAAAGCCTGCCCACCACGG + Intergenic
1077245198 11:1533554-1533576 CTGGGAAAGCCAGCCACCCTAGG - Intergenic
1077543234 11:3157476-3157498 CCTGCAAAGCCTGCCTCCATCGG - Intronic
1080130883 11:28793034-28793056 CTGACACATCCTTCCTCACTGGG - Intergenic
1080387911 11:31820351-31820373 CTGGCAGAGGCATCCTCTCTAGG + Intronic
1081061284 11:38481358-38481380 CTGGCAAGGGCTTCATCCCCAGG + Intergenic
1081069755 11:38595992-38596014 CTGGCAATGGCTACCTCCTTTGG - Intergenic
1081608757 11:44545771-44545793 CTGGAAATGCCTATCTCCCTTGG + Intergenic
1082279914 11:50260740-50260762 CTGGTCGAGCCTACCTCCCTAGG - Intergenic
1083315566 11:61813054-61813076 GTTGCAAAGCCATGCTCCCTTGG + Intronic
1083404559 11:62447639-62447661 CTGACATAGCCCTCCTCCCTCGG + Intronic
1083859553 11:65412548-65412570 CTGGGAAAGCCCTCCTCTCAGGG - Exonic
1084767719 11:71323461-71323483 CTGGCACTGGTTTCCTCCCTAGG - Intergenic
1084939343 11:72604046-72604068 CTGGAAAAGCCCTCCTCACAGGG + Intronic
1085081227 11:73635849-73635871 ATAGCAAAGACTTCCTCCCTTGG + Intergenic
1087913826 11:103784665-103784687 CAGGCAAAGCATTCTTCCTTTGG + Intergenic
1088905409 11:114151754-114151776 TTCGCATAGCCTTCCCCCCTTGG + Intronic
1088916945 11:114234765-114234787 CAGACAGAGCCTTCCTTCCTTGG + Intronic
1089637454 11:119824518-119824540 CTGGCAAGGCCTCCCTGCCTAGG - Intergenic
1089975032 11:122724861-122724883 CAGGCAAAGTCCTCATCCCTTGG - Intronic
1090403982 11:126466400-126466422 CAGACCCAGCCTTCCTCCCTGGG - Intronic
1090456059 11:126850652-126850674 CTGGTAAAGTCTTCCTCTGTTGG - Intronic
1090609311 11:128456083-128456105 CTGGCAAATGCTTCTGCCCTGGG - Intergenic
1091160004 11:133411432-133411454 CTGGCCTGACCTTCCTCCCTGGG - Intronic
1091401838 12:185867-185889 CTGGCAAACACATCCTCCCATGG + Intergenic
1091902545 12:4156172-4156194 CTGACAAAGCGTTACTCTCTTGG - Intergenic
1095869651 12:47012339-47012361 CTGGGAAAGGCTTCATCACTGGG + Intergenic
1095907436 12:47392294-47392316 ATAGCAATGCCTTCCTCCCAGGG + Intergenic
1098358930 12:69636425-69636447 CTGGCAAAGTCTTACTTGCTGGG + Intergenic
1102420765 12:112801095-112801117 CTGGCCAAGCCTTTCTCCAGGGG + Intronic
1104074308 12:125376166-125376188 CTGCCAAAGCCTCCCAGCCTGGG - Intronic
1105704660 13:22961552-22961574 CTGGCAAAGCCTTCCTCCCTGGG + Intergenic
1105857616 13:24386600-24386622 CTGGCAAAGGCTTCCTCCCTGGG + Intergenic
1107902750 13:45034207-45034229 CAGGCATAGTCTTCCTCCCTGGG + Intronic
1108503084 13:51085581-51085603 ATGGCAAGCCCTTCCTTCCTGGG - Intergenic
1109377964 13:61523115-61523137 CTGTCAAGGCCTCCCTCCTTGGG - Intergenic
1110552376 13:76824118-76824140 CTAACAATGCCTACCTCCCTGGG + Intergenic
1113321449 13:109236246-109236268 CTGCCAAAGCCTTCCTTCAATGG - Intergenic
1113438755 13:110312190-110312212 CTGTTAAAGTCTTCCTCCATGGG + Intronic
1116172219 14:41417421-41417443 CTGGCAAACCATAACTCCCTGGG - Intergenic
1117071016 14:52056444-52056466 ATGACAATGCCTTCCTCCCTGGG + Intronic
1117345064 14:54823388-54823410 CTGGCACAGTCTTGCTGCCTGGG + Intergenic
1119265094 14:73259667-73259689 ATGCCCAAGCTTTCCTCCCTGGG + Intronic
1119430649 14:74566363-74566385 CTGGGAACGCCTTCCTCTCTTGG - Intronic
1121021513 14:90583040-90583062 CTTGAAAAGCCTTCTTTCCTGGG + Intronic
1121715171 14:96068638-96068660 GTGGCCAAGCTTTCCTCCCAGGG - Intronic
1122529879 14:102418135-102418157 CTGGTCAAGACTTCTTCCCTGGG - Intronic
1122974282 14:105164674-105164696 CTGTAAAAACCTTCCTCCCTAGG + Intronic
1128060314 15:64731497-64731519 CTGGCACAGCCTCCTTCCTTTGG - Intergenic
1128539722 15:68518193-68518215 CTTGGAAAGCTTTCCTGCCTAGG - Intergenic
1128714800 15:69900414-69900436 TAAGCAAGGCCTTCCTCCCTGGG - Intergenic
1128725101 15:69982336-69982358 CTGGCAAGCACCTCCTCCCTGGG - Intergenic
1129178983 15:73859703-73859725 CTGGCTGTGTCTTCCTCCCTTGG + Intergenic
1129726963 15:77906299-77906321 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1130275312 15:82473104-82473126 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1130467672 15:84200499-84200521 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1130496593 15:84473043-84473065 CTGGCAGAGCCTGCCCCCCAGGG - Intergenic
1130589964 15:85205097-85205119 CTGGCAGAGCCTGCCCCCCAGGG + Intergenic
1131376303 15:91926845-91926867 CAGTCAAAGCTTTCCTCCCAGGG - Intronic
1131980694 15:97991852-97991874 TTGCCAGAGACTTCCTCCCTTGG - Intergenic
1133419855 16:5636932-5636954 CTGGCAAATCCTGGCTCCCAAGG - Intergenic
1135395422 16:22128010-22128032 CTGGAACACCCTTTCTCCCTAGG - Intronic
1136549686 16:30976394-30976416 CTGGCAAGGCCTTCCAGCATGGG - Intronic
1136676750 16:31916243-31916265 GTGGCAAAGCCTTCAACTCTAGG + Exonic
1137710664 16:50564433-50564455 CTTGCAAAGCCTTCCTCACAGGG + Intronic
1138511567 16:57511529-57511551 CTGGCAAATCCCTCCTCTCCAGG + Intergenic
1138742700 16:59329377-59329399 CTGGCAAGGCTGTCATCCCTGGG - Intergenic
1139132657 16:64164834-64164856 GAGGCAAAGCTTTCCTCCCAAGG + Intergenic
1139471039 16:67178393-67178415 CTGGCCAGGCCCTCCTCCGTGGG + Exonic
1140161389 16:72498364-72498386 CTCTTAAAGCCTTCCTCTCTTGG + Intergenic
1144827697 17:18115654-18115676 CTGCCAAAACCCTCCTCCCACGG + Intronic
1145064657 17:19753921-19753943 CTGACAAAGCCAGCATCCCTGGG - Intergenic
1146278446 17:31530035-31530057 CTGGCCATCCCTTCCTCCCTAGG - Intronic
1146379677 17:32319539-32319561 CTGGGACAGCCTTCCAGCCTTGG - Intronic
1147213849 17:38887690-38887712 TTGGCAAATCCTTTTTCCCTTGG - Intronic
1148477949 17:47941566-47941588 CTGGCAAATCCTTCCTTCCCCGG + Exonic
1148480162 17:47954802-47954824 CTGGCTGCGCCTTCCTTCCTGGG - Intronic
1149377933 17:56064461-56064483 CTGGCTCATCCTTCCTCACTGGG - Intergenic
1149647168 17:58249230-58249252 CTGCCAAGGCCTTTGTCCCTTGG + Intronic
1150147574 17:62782028-62782050 CAAACAAAGCCTTCCTCCCTAGG - Intronic
1150709700 17:67520198-67520220 CTGGAAAGGCCTTGCTACCTTGG + Intronic
1151554660 17:74840648-74840670 CTGCCACAGCCTTCCTCCCAGGG + Intergenic
1151947384 17:77327154-77327176 CTGGCAATGCCTCCCTCTCCTGG + Intronic
1152046934 17:77942925-77942947 CTGTCAAAGGCTTCCTGGCTGGG + Intergenic
1152230840 17:79113274-79113296 CATGCAGAGCCTTCCTACCTTGG - Intronic
1152649101 17:81483756-81483778 CTGACCACGCCGTCCTCCCTGGG - Intergenic
1153792025 18:8587378-8587400 GTGTAAAATCCTTCCTCCCTGGG + Intergenic
1155466262 18:26139050-26139072 CTTGTATAACCTTCCTCCCTTGG + Intronic
1158537899 18:58324459-58324481 CTCTCAAAGCCCACCTCCCTGGG + Intronic
1158642503 18:59215644-59215666 CTGGTAATGCTTCCCTCCCTAGG - Intergenic
1159937770 18:74382526-74382548 CTGGCAAAGCCTCTCCCTCTGGG + Intergenic
1160097648 18:75889973-75889995 CTGGCAGAGCCTCCCCTCCTTGG + Intergenic
1160754011 19:748354-748376 CTGGCCACGCCTTCCTCGCCAGG - Intergenic
1160929410 19:1563114-1563136 CTAGCAGAGCCTTTCTTCCTAGG + Intronic
1161118467 19:2512415-2512437 CTGGCAATGGCCACCTCCCTGGG + Exonic
1161152947 19:2719230-2719252 CTGCAAGACCCTTCCTCCCTGGG - Intronic
1161153700 19:2721695-2721717 CTGCCAAAGCCCTCCACCCCCGG - Intronic
1161379226 19:3955891-3955913 CTGGCCCAGCCTTCCTCAGTGGG - Intergenic
1161469999 19:4452461-4452483 TGGGCAGAGCCTTCCTCTCTGGG + Exonic
1162099596 19:8331822-8331844 TTGGCAAGGCCTCCCTCCCTGGG - Intronic
1163638852 19:18450447-18450469 CCGGCAACGCCCTCCTGCCTGGG + Intronic
1164636129 19:29792691-29792713 ATGGAAAAGCGTTCCTCCCAGGG + Intergenic
1166209972 19:41300188-41300210 GTTGAAAAGCCTCCCTCCCTGGG - Intronic
925127901 2:1474782-1474804 ATGGCAAATCCTGCCTCACTCGG + Intronic
925309888 2:2875004-2875026 GTGGCCAGGCCTTCCTCCCTGGG - Intergenic
927126539 2:20017004-20017026 CTGGAAAAGACTTCCACCTTGGG - Intergenic
927981572 2:27378086-27378108 CAGGCAAAGCCTTTGTCACTGGG + Exonic
927990851 2:27445886-27445908 CTGGCAAAAACCTCCACCCTCGG + Intronic
928432565 2:31233220-31233242 CTGGCAAAGCCTTTCATGCTTGG + Intronic
929919205 2:46160649-46160671 ATGGCAAATCCTCCCTGCCTGGG - Intronic
930353767 2:50291548-50291570 CTGAAAAAGCCATCCTCCCATGG + Intronic
932467091 2:71930918-71930940 CTGGCCACGTCTTCCTCCCCAGG + Intergenic
936985392 2:118307464-118307486 CTGGCAAAGGCTTCCCAACTGGG + Intergenic
937062730 2:118992372-118992394 CAGGCAAAGGCGTCCTGCCTGGG + Intronic
938209878 2:129458626-129458648 CTGGCATCCCCTCCCTCCCTGGG - Intergenic
938562877 2:132490083-132490105 CTGCCAAAGCCTGGCTCACTGGG + Intronic
939493732 2:142904703-142904725 CTGGCAAAACATTCCCCCCAAGG - Intronic
946809491 2:223508409-223508431 GAGGCTAAGCCTTCCTCCCTAGG - Intergenic
948274517 2:236697837-236697859 CTTGCAAAGCACTCCACCCTGGG + Intergenic
948776206 2:240290235-240290257 CTGGCCAGGCCTTCCGCCCGTGG - Intergenic
1169740945 20:8893651-8893673 CTGGCATAGGCTTATTCCCTGGG - Intronic
1170997550 20:21377863-21377885 CTGGTCAAGCCTATCTCCCTAGG - Intronic
1171341722 20:24434603-24434625 TCGCCAAAGCCTTCCTGCCTTGG + Intergenic
1172093126 20:32447547-32447569 CTGGGACAGCCTCCTTCCCTAGG + Exonic
1172292703 20:33787858-33787880 CTGGCAATGCGGTCCACCCTGGG - Intronic
1172839383 20:37892966-37892988 CTGAAATTGCCTTCCTCCCTGGG - Intergenic
1173585235 20:44177214-44177236 CTGCCATAGACTTCCTGCCTTGG - Intronic
1174568050 20:51481144-51481166 CTGGAAGAGCCTTCCTCGCCAGG + Intronic
1175817804 20:61892775-61892797 CTGGAAAACCCTTCCATCCTTGG + Intronic
1177256984 21:18677322-18677344 TTAGCAAAGACTACCTCCCTGGG + Intergenic
1177285402 21:19042193-19042215 CTGGCAAAGAATTTCTTCCTGGG + Intergenic
1178366201 21:31990974-31990996 CTGGCAGAGCCTGCTGCCCTGGG - Intronic
1180988123 22:19917534-19917556 CTGGCCCAGCCTTTCTCCCGGGG - Intronic
1181685353 22:24524221-24524243 CTGCCACAGCCTTCCTTCCTTGG + Intronic
1184109145 22:42384909-42384931 CAGGCAGGCCCTTCCTCCCTTGG - Exonic
950477518 3:13223403-13223425 CTGGCACAGCCTCCACCCCTGGG + Intergenic
950630455 3:14278625-14278647 CGGGAAAGGCCTTCCTTCCTGGG - Intergenic
951721104 3:25699203-25699225 ATGGAAAAGCATTCCTTCCTTGG + Intergenic
952946961 3:38484421-38484443 CTGCCAAGGCCTGCCTCGCTGGG + Exonic
953418470 3:42736351-42736373 TGGGCAAAGGCTTCCTGCCTAGG + Intronic
956170564 3:66430595-66430617 ATGGCATAGCCTTTCTCCCTGGG - Intronic
956376414 3:68618048-68618070 CTGTCAAGGCCCTCCTCCATGGG + Intergenic
957362064 3:79173435-79173457 CTGGCCAGCCCTGCCTCCCTGGG + Intronic
957584328 3:82114608-82114630 CTGACACATCCTTCCTCACTGGG - Intergenic
957684669 3:83486289-83486311 CTGGCAAAGCCATAGTCACTGGG + Intergenic
958164060 3:89856461-89856483 TGTGCAAAGCCTTCCTCCCTCGG - Intergenic
960233459 3:115255046-115255068 CTGACACATCCTTCCTCACTGGG + Intergenic
960987939 3:123292588-123292610 CTTGCCAAGCCTTCCTGCCCAGG + Intronic
962166370 3:133053340-133053362 CTGGCAAAGCCTTTCTCCCTTGG - Intronic
962199644 3:133390782-133390804 CTGGGAAGGCTTTCCTCCTTGGG - Intronic
966985988 3:185180932-185180954 AAGGCTATGCCTTCCTCCCTAGG + Intergenic
968689461 4:1983258-1983280 CTGGCAAAGCCATCGTCCCGTGG + Exonic
968753193 4:2401095-2401117 CCTGCCCAGCCTTCCTCCCTAGG - Intronic
969122106 4:4918352-4918374 AAGGCAAAGCCTTACCCCCTGGG - Intergenic
969585072 4:8086948-8086970 AAAGCAAAGCCTTCATCCCTTGG - Intronic
972568069 4:40286640-40286662 CTGGTAAACCCACCCTCCCTGGG - Intergenic
978405328 4:108372809-108372831 CAGGCCAAGTCTTCCTCCTTCGG + Intergenic
984520215 4:180793267-180793289 CTTGCACAACCTTTCTCCCTTGG + Intergenic
984713257 4:182903544-182903566 CTAGCAGAGCCCTCCTCTCTGGG - Intronic
985729322 5:1538455-1538477 CCGCCAAAGCCTTTCTCCCTCGG + Intergenic
986267940 5:6206382-6206404 CTGGCACTGCCTTCCATCCTGGG + Intergenic
986608947 5:9547684-9547706 CTTGGCAAGCATTCCTCCCTGGG + Intergenic
990320738 5:54627769-54627791 CTGGCCAAGCCATGCTCCCTAGG + Intergenic
992780063 5:80119643-80119665 CTGGAAAAGTCCTCCTCTCTGGG - Intronic
993144775 5:84079954-84079976 CCTCCAAAGCCTTCCTCCTTAGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
999383847 5:151140451-151140473 TTGGCCAAGCCCCCCTCCCTTGG - Intronic
1001049942 5:168406060-168406082 CCTGCTAACCCTTCCTCCCTAGG - Intronic
1001426442 5:171625679-171625701 CTCCCACAGCCTTCCTCACTGGG - Intergenic
1001585520 5:172831548-172831570 GTGGGAAGGCCTGCCTCCCTGGG + Intergenic
1002086451 5:176778797-176778819 CTGGCAAACCCTTCTAGCCTCGG + Intergenic
1002389116 5:178895813-178895835 CTGGCACAGCCTTGCCCTCTGGG + Intergenic
1003248761 6:4406042-4406064 CTGACACATCCTTCCTCACTGGG + Intergenic
1003632104 6:7796305-7796327 CTGCCAAAACATTCCTCCCTTGG - Intronic
1004760118 6:18656787-18656809 CTGACACATCCTTCCTCACTGGG + Intergenic
1005121029 6:22389702-22389724 CTGACACATCCTTCCTCACTGGG - Intergenic
1005743031 6:28810380-28810402 CTGGTCCAGCCTACCTCCCTAGG - Intergenic
1006181231 6:32154531-32154553 ATGGCAACACCCTCCTCCCTCGG - Intronic
1007095824 6:39212425-39212447 TTGGCAGAGCCTGCCTCCCCTGG + Intronic
1007234649 6:40381892-40381914 GTGCAAAAGCCTTCCTCCCAGGG + Intergenic
1008399620 6:51049618-51049640 CTGGGAAGGCCTTCCTCCTTAGG - Intergenic
1008534720 6:52499114-52499136 TTGGTAAAGTCTTCCTCACTGGG + Exonic
1008636983 6:53420352-53420374 ATGGAAAAGCATTCCTTCCTTGG - Intergenic
1008905398 6:56672183-56672205 CTGCCACAGCCTTCCTGCCCCGG - Intronic
1009832974 6:68962957-68962979 CTGATAAAGCTTTCCTACCTGGG + Intronic
1013274552 6:108571693-108571715 TTGGCAAAGCCATGCTCCCTGGG - Intronic
1013561533 6:111309912-111309934 CAAGCAAATCCTTCCACCCTTGG - Exonic
1014377944 6:120700304-120700326 CTGACAAAGCCTTCTGTCCTTGG + Intergenic
1016330242 6:142946459-142946481 CTGGTTCAGCCTCCCTCCCTGGG - Intergenic
1016685881 6:146881636-146881658 CTAGCAAAGCCTTCCTTCTCAGG + Intergenic
1018138837 6:160806607-160806629 CAGCCACAGCCTTCCTCACTTGG - Intergenic
1019487995 7:1298263-1298285 CTGGCACTGCCTGCCTCCGTGGG + Intergenic
1019912679 7:4110267-4110289 CTGGCCAAGTCTTCCTCTCTAGG + Intronic
1020111312 7:5449508-5449530 CTGGCCCAAGCTTCCTCCCTGGG + Intronic
1020893552 7:13910717-13910739 CAGGCAAAGCTTTCCTACCACGG + Intronic
1021993080 7:26154958-26154980 CTGGCAGTGCCTTCCTGGCTGGG + Intronic
1022368900 7:29752062-29752084 GTGGGGCAGCCTTCCTCCCTTGG - Intergenic
1022394372 7:29972537-29972559 GTGGAAAAGCCAGCCTCCCTTGG - Intronic
1023939324 7:44759867-44759889 TGGGCAGAGCCTACCTCCCTGGG + Intronic
1028013971 7:85683981-85684003 CTGGCAAAGGCTACCTTCTTTGG + Intergenic
1029652864 7:101905715-101905737 CTGGCAATGCCTTCCCATCTTGG - Intronic
1029968550 7:104766279-104766301 CTACCAAAGCCTTGCTCCCATGG - Intronic
1031534545 7:122917029-122917051 CTTGCAAAGTCATCTTCCCTGGG + Intergenic
1032414095 7:131722902-131722924 TTGGCAAAGTCTTCCTTTCTTGG + Intergenic
1032559291 7:132872012-132872034 CTGCCACAGCATTCCTTCCTAGG - Intronic
1032654252 7:133910386-133910408 ATTGCAAAGCCTTTTTCCCTTGG + Intronic
1032716610 7:134514240-134514262 CTGGCACATGCTGCCTCCCTGGG + Intergenic
1035524380 8:300915-300937 GTGGCCGAGGCTTCCTCCCTGGG - Intergenic
1036133566 8:6138755-6138777 CTGGCATTGCCCTGCTCCCTGGG + Intergenic
1037658508 8:20907543-20907565 CTAGCAAAGCCCTCATCCCTAGG - Intergenic
1040784443 8:51148929-51148951 TTGGCAGAGCCATGCTCCCTGGG - Intergenic
1040959780 8:53019327-53019349 CTGACACACCCTTCCTCACTGGG + Intergenic
1040995750 8:53400357-53400379 CTGGCAAATGCTTTCTCCTTGGG + Intergenic
1041023229 8:53658800-53658822 CTAGCTGAGCCTCCCTCCCTTGG + Intergenic
1041409139 8:57534265-57534287 CTGGGATATCCTTGCTCCCTGGG - Intergenic
1041990496 8:63984246-63984268 CTTGCAAATCGTTCCTCACTTGG + Intergenic
1044466841 8:92516550-92516572 CAGTCACAGCCTTCCTGCCTTGG - Intergenic
1044621391 8:94193774-94193796 CTATCAGAGCCTTCCTCCCGGGG - Intronic
1045242791 8:100416970-100416992 CTAGCAAGGCCTCCCTCCCCTGG - Intergenic
1045282043 8:100757798-100757820 CAGGCAACTCCTTCCTCGCTGGG + Intergenic
1047249396 8:123170367-123170389 CTGGGAAACCCTTCTTCCATAGG - Intergenic
1047682525 8:127268802-127268824 CTCGCAAAGCCTTGCTTCTTAGG - Intergenic
1047810256 8:128400836-128400858 ATGGCAGAGCTTTTCTCCCTGGG + Intergenic
1049554239 8:143274266-143274288 CTCACAAAGCCTTCCTGCCTTGG - Intronic
1050008282 9:1157940-1157962 TTAGCTAAGCTTTCCTCCCTAGG - Intergenic
1051714204 9:19964579-19964601 ATGGCAAAGCCATCATACCTTGG - Intergenic
1052975730 9:34408571-34408593 TTGGAAAAGGCTTCCTCCCTTGG + Intronic
1061260655 9:129479118-129479140 GAGGCAAAACCTACCTCCCTTGG + Intergenic
1062053257 9:134457971-134457993 CAGGCAAACCCTTCCTGCCCTGG - Intergenic
1062269210 9:135701026-135701048 CTGCCAACGCCCTCCTGCCTGGG - Intergenic
1062403054 9:136380790-136380812 GTGGCAGGGCCTTCCTCTCTCGG + Exonic
1188092171 X:25977171-25977193 CTGACACATCCTTCCTCACTGGG + Intergenic
1189359657 X:40340143-40340165 CTGGCAAAATCTCCCTCCCAGGG + Intergenic
1191846150 X:65549679-65549701 CTGGGAAAGCCCTCCTCTCAGGG + Intergenic
1192221675 X:69201361-69201383 CTGGGAAGTCCTTTCTCCCTTGG + Intergenic
1195244173 X:102980784-102980806 CTGGCAATGCCTTTCTGACTTGG - Intergenic
1195325016 X:103751465-103751487 TGGGCAAAGCCTTGCTCCCAAGG + Intergenic
1196918289 X:120561283-120561305 CTGGCAGCGCCTTCCTTCCCTGG + Intronic
1197241422 X:124127046-124127068 CTGGCCAAGGCCTCCACCCTTGG + Intronic
1199870425 X:151893592-151893614 CTGCCAACGCTTTCCTCCCAGGG + Intergenic
1200166339 X:154038221-154038243 CTAGCCCAGCCTCCCTCCCTTGG - Intronic
1200249433 X:154544734-154544756 CTGGCAGAGCCCTTCTCCCTCGG + Intronic