ID: 1105704673

View in Genome Browser
Species Human (GRCh38)
Location 13:22961594-22961616
Sequence TTCATAATGAACCCTGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105704673 Original CRISPR TTCATAATGAACCCTGTGCC CGG (reversed) Intergenic
902938599 1:19783003-19783025 TATAGCATGAACCCTGTGCCAGG - Intronic
904327553 1:29737200-29737222 TACATAATGAATTATGTGCCAGG + Intergenic
904330327 1:29754360-29754382 TCCCTAATGAATCCTGGGCCTGG + Intergenic
906135041 1:43492948-43492970 ATCACAAGGAACACTGTGCCAGG + Intergenic
906229983 1:44153711-44153733 TTCTTATAGAACCCTGGGCCAGG - Intergenic
908045056 1:60159903-60159925 TTCATAATAATCTCTATGCCTGG + Intergenic
908105737 1:60839923-60839945 TTCATCATGAAGTCTTTGCCAGG - Intergenic
908819905 1:68075087-68075109 TTCATCATGAAATCTTTGCCAGG + Intergenic
909490640 1:76222336-76222358 TTCATCATGAAATCTTTGCCAGG - Intronic
910008662 1:82432884-82432906 GTCATAGTGAACCTTGTGCTTGG + Intergenic
910082462 1:83357265-83357287 TTCATCATGAAGTCTTTGCCAGG + Intergenic
910453399 1:87370761-87370783 TCCATTGTGAACCCTGTGGCTGG + Intergenic
911374794 1:97038992-97039014 TTCATCATGAAGTCTCTGCCAGG + Intergenic
916032711 1:160892297-160892319 TTCATCATGAAATCTTTGCCAGG - Intergenic
917011455 1:170478755-170478777 TTCATCATGAAATCTCTGCCAGG + Intergenic
917253005 1:173082700-173082722 TTCATTATGAACTCTTTGCCAGG - Intergenic
917832589 1:178908958-178908980 TTCATCATGAAGTCTTTGCCAGG + Intronic
917845306 1:179015390-179015412 TTCATACTGATCCCTCTGCCTGG + Intergenic
918867725 1:189925005-189925027 TTCATCATGAAATCTTTGCCAGG - Intergenic
918948692 1:191106409-191106431 TTCATCATGAAATCTTTGCCAGG + Intergenic
919614643 1:199790847-199790869 TTTATAATGAAACCTTTGCAAGG - Intergenic
921095214 1:211880969-211880991 TTCATCATGAAATCTTTGCCAGG + Intergenic
921675059 1:217967927-217967949 TTCATCATGAAATCTTTGCCAGG + Intergenic
921939971 1:220829244-220829266 TTCATGATGAGCACAGTGCCTGG - Intergenic
922405529 1:225309088-225309110 TTCATAATAAACCTTGTCCTAGG - Intronic
923324142 1:232865883-232865905 TTGATAATAAAACCTGTGCATGG + Intergenic
923645548 1:235816814-235816836 TTCGTCATGAAACCTTTGCCAGG - Intronic
1063068220 10:2631731-2631753 TTCATAATGGAGTCTGAGCCGGG + Intergenic
1063322550 10:5064468-5064490 TTCATCATGAAATCTTTGCCAGG - Intronic
1064912890 10:20422492-20422514 TTCATCATGAAATCTTTGCCAGG + Intergenic
1064917628 10:20478901-20478923 TTCAAAATGAGTCCTGTGCTAGG - Intergenic
1066299117 10:34081286-34081308 TTCAAAAGGAACCCTCAGCCCGG + Intergenic
1066436068 10:35397626-35397648 TACCAAATGAACCCTGTCCCTGG + Intronic
1067545601 10:47190288-47190310 TTAATCATGAACACTGAGCCAGG - Intergenic
1068088624 10:52405575-52405597 TTCATCATGAAATCTTTGCCAGG + Intergenic
1069167258 10:65177414-65177436 TTCATCATGAAATCTTTGCCAGG + Intergenic
1072839725 10:98758274-98758296 TTCATCATGAAATCTTTGCCAGG - Intronic
1073944617 10:108735968-108735990 TTCATTATGAAATCTGTGCCAGG + Intergenic
1074851299 10:117441645-117441667 TTCTTAATGTGCCCTGTGGCTGG - Intergenic
1075545177 10:123349924-123349946 GTCCTAATGAACCCACTGCCTGG - Intergenic
1077607485 11:3621886-3621908 TTCATGATAACCCCAGTGCCAGG - Intergenic
1078027000 11:7705665-7705687 TTGATCCTGAACCCAGTGCCAGG + Intronic
1078210037 11:9263545-9263567 TTCATAAGAAACACTGGGCCGGG + Intronic
1078694347 11:13615368-13615390 TTCATCATGAAATCTTTGCCAGG + Intergenic
1079547558 11:21652136-21652158 TACATAGTGATCACTGTGCCAGG + Intergenic
1080256953 11:30300999-30301021 TTCATCATGAAATCTTTGCCAGG - Intergenic
1085813209 11:79705379-79705401 TTCATCATGAAACGTTTGCCAGG - Intergenic
1085901622 11:80706945-80706967 TTCATCATGAAGCCTTTGCCAGG - Intergenic
1088031198 11:105252990-105253012 TTCATAAAGAGTTCTGTGCCTGG + Intergenic
1088236581 11:107731566-107731588 TTCATTATATACCCAGTGCCTGG + Intergenic
1089062494 11:115637231-115637253 TTTATAAAGAACTCTGGGCCAGG + Intergenic
1090096707 11:123749279-123749301 TTCATCATGAAATCTTTGCCAGG + Intergenic
1093476750 12:19564357-19564379 TTCATCATGAAATCTTTGCCAGG + Intronic
1093491131 12:19705851-19705873 TTCATCATGAAATCTTTGCCAGG - Intronic
1093655803 12:21693103-21693125 TTCATCATGAAATCTTTGCCAGG - Intronic
1094407395 12:30131828-30131850 TTCATCATGAAGTCTTTGCCAGG - Intergenic
1095593715 12:43935900-43935922 CTCATGCTGAACCCTCTGCCTGG - Intronic
1096900027 12:54867532-54867554 TTCATAATGAAATCTTTGCCAGG + Intergenic
1097480443 12:60117375-60117397 TTCATAATGAAATCTTTGCCAGG - Intergenic
1098143848 12:67478173-67478195 TTCAAAAACATCCCTGTGCCCGG - Intergenic
1099323331 12:81179230-81179252 TTCATCATGAAATCTTTGCCAGG - Intronic
1099825651 12:87774108-87774130 TTCATCATGAAATCTTTGCCAGG + Intergenic
1101355225 12:103970802-103970824 TTCTTAATGAACTCTATGCGTGG + Intronic
1101796831 12:107982702-107982724 TTCAAACTGAACCCAGTGCCAGG - Intergenic
1102860027 12:116327946-116327968 TTCATTATGAAATCTTTGCCAGG - Intergenic
1105482198 13:20788350-20788372 TTCTTAAAAAACCCTGGGCCAGG - Intronic
1105704673 13:22961594-22961616 TTCATAATGAACCCTGTGCCCGG - Intergenic
1106742137 13:32655880-32655902 TTCATCATGAAATCTTTGCCAGG + Intronic
1108739099 13:53316708-53316730 CTCATTATGAACACAGTGCCAGG + Intergenic
1108917341 13:55631180-55631202 TTCATCATGAAATCTTTGCCAGG + Intergenic
1109377506 13:61516505-61516527 TTTATAATGAATGCTGTGCTAGG + Intergenic
1109567881 13:64142194-64142216 TTCATCATGAACTCTTTGCTAGG - Intergenic
1110823525 13:79944937-79944959 TACAAAATCAACCATGTGCCAGG - Intergenic
1110992006 13:82053671-82053693 TTCATCATGAAATCTTTGCCAGG - Intergenic
1111370056 13:87305786-87305808 TTCATCATGAAATCTTTGCCAGG + Intergenic
1113202342 13:107880329-107880351 TTTATCATGAAACCTTTGCCAGG - Intergenic
1113528452 13:111001025-111001047 TGCAAGATGTACCCTGTGCCAGG - Intergenic
1114759477 14:25297198-25297220 TTCATAATGAAGCCAGTTCATGG - Intergenic
1115021444 14:28685417-28685439 TTCATCATGAAATCTTTGCCAGG + Intergenic
1116188189 14:41626662-41626684 TACATAGTGAACATTGTGCCAGG - Intronic
1116648519 14:47560761-47560783 TTCATCATGAAATCTTTGCCAGG + Intronic
1117542521 14:56762135-56762157 TTCATGATGCATCCTTTGCCTGG - Intergenic
1118115002 14:62765457-62765479 TTCATCATGAAATCTTTGCCAGG - Intronic
1122157992 14:99762127-99762149 TGCACAATGAGCCCTGTTCCAGG + Intronic
1122502217 14:102208301-102208323 TCCGCAGTGAACCCTGTGCCTGG + Intronic
1124151581 15:27183908-27183930 TTCATCACTAACTCTGTGCCAGG + Intronic
1125549290 15:40533075-40533097 TTCATCATGAGCTCTGTACCAGG + Intronic
1127022069 15:54759429-54759451 TTCATCATGAAATCTTTGCCAGG - Intergenic
1127058454 15:55156615-55156637 TTCATCATGAAATCTTTGCCAGG - Intergenic
1127182807 15:56441495-56441517 TTCATCATGAAATCTTTGCCAGG - Intronic
1127914132 15:63441620-63441642 TCCAAAATGATCCCTTTGCCTGG - Intergenic
1128356441 15:66930773-66930795 TTCCCAATGAAACCTGGGCCAGG + Intergenic
1128475063 15:67990510-67990532 TTTAAAATGAGCTCTGTGCCTGG - Intergenic
1128751583 15:70154100-70154122 TTCATCATGATCCCAGCGCCGGG - Intergenic
1133197092 16:4178735-4178757 CTCAGAATAAACCCTGTGCCTGG - Intergenic
1133331292 16:4976121-4976143 TGTAGAATGAACCATGTGCCAGG + Intronic
1133424168 16:5673276-5673298 GTCAGAAGGAAGCCTGTGCCTGG + Intergenic
1138998715 16:62482415-62482437 TTCATCATGAAGACTTTGCCAGG + Intergenic
1139472016 16:67183545-67183567 TTCATTATGCACCCAGTGCTGGG - Exonic
1140868939 16:79089278-79089300 TTTATAATCAAACCTTTGCCAGG - Intronic
1142016092 16:87748481-87748503 TTCATACAGAAGCCTGGGCCGGG - Intronic
1143428249 17:6857883-6857905 TTCATCATGAAATCTCTGCCAGG + Intergenic
1146271978 17:31490515-31490537 AACACAATGAGCCCTGTGCCAGG - Intronic
1149346948 17:55748489-55748511 TTCCTAATGATGCCTGTGCCTGG - Intergenic
1149604443 17:57914905-57914927 TTGAAAATGAACCATATGCCAGG + Intronic
1150758343 17:67936755-67936777 TTCATCATTGACTCTGTGCCAGG + Intronic
1150894102 17:69189576-69189598 TTCATCATGAAGTCTTTGCCAGG + Intronic
1151532010 17:74712620-74712642 TTCATAATGAAGCCAGTGCAAGG - Intronic
1151614867 17:75203188-75203210 TAAATAATGTACACTGTGCCCGG + Intergenic
1152177700 17:78798676-78798698 TTCACAATGACCCCTGTGCACGG + Intronic
1153543529 18:6182594-6182616 TTCATCATGAAATCTTTGCCAGG + Intronic
1154371862 18:13770821-13770843 TTCATCATGAAATCTTTGCCAGG - Intergenic
1155129174 18:22913307-22913329 TACATTGTGAACCCTGTACCTGG + Intronic
1155392914 18:25354374-25354396 TGCATAAAGAACCATGTGCAAGG + Intergenic
1156113334 18:33755112-33755134 TTATTGATGAACCCTGTTCCAGG - Intergenic
1157003504 18:43554672-43554694 TTCATTATGAAATCTTTGCCAGG + Intergenic
1158293481 18:55968429-55968451 TTTAAAATGTACCCTGTGCTAGG + Intergenic
1161226925 19:3151083-3151105 TTCCTAGAGAACCCTGTTCCCGG + Intronic
1163966654 19:20752619-20752641 GTCATAATGACTCCTGTTCCGGG + Intronic
1165796831 19:38524501-38524523 TTGAGCATGACCCCTGTGCCAGG - Intronic
1166176047 19:41070983-41071005 TTCATCATGAAATCTTTGCCAGG + Intergenic
1168049967 19:53822296-53822318 TTCATACTAATCCCTGAGCCTGG - Intronic
925477837 2:4238463-4238485 TTCATCATGAAATCTTTGCCAGG - Intergenic
926452727 2:13025104-13025126 GTTATTATGCACCCTGTGCCAGG - Intergenic
926736507 2:16077590-16077612 TTTATTATGAACACTGTTCCTGG - Intergenic
926823909 2:16883170-16883192 TTTATTATGTGCCCTGTGCCAGG + Intergenic
926836138 2:17023274-17023296 TTCATCATGAAACCTTTGCCAGG + Intergenic
928955532 2:36863232-36863254 TTCATCATGAAATCTTTGCCAGG + Intronic
930839623 2:55831141-55831163 TTCATCATGAAATCTTTGCCAGG - Intergenic
931779919 2:65570317-65570339 TTCATAATGAAGTCTTTGCCTGG + Intergenic
932506257 2:72234499-72234521 TTCATAATGAAATCTTTGCCGGG - Intronic
932793514 2:74675473-74675495 TACATAATTGCCCCTGTGCCTGG - Intronic
933137283 2:78753507-78753529 TACATAGTTAAACCTGTGCCAGG - Intergenic
938591361 2:132739521-132739543 TTTATAATGAGCACTCTGCCAGG - Intronic
938943823 2:136192750-136192772 TTCAAACTGAACCGTGAGCCAGG - Intergenic
939650709 2:144758795-144758817 TTCATCATGAAATCTTTGCCAGG + Intergenic
939834245 2:147108572-147108594 TTAATAATGAATGCTGTGCTTGG + Intergenic
940871901 2:158867573-158867595 GTCATAATGACTCCTGTTCCGGG - Intergenic
941107336 2:161370801-161370823 TTAAAAATGTACTCTGTGCCTGG + Intronic
941680918 2:168398199-168398221 TTCATCATGAAATCTTTGCCAGG + Intergenic
943172777 2:184424834-184424856 GTTATAATTAACCCTGTTCCTGG - Intergenic
943256145 2:185595860-185595882 TTCATTATGAAATCTTTGCCAGG - Intergenic
943312073 2:186338355-186338377 TTCATCATGAAATCTTTGCCAGG + Intergenic
944788677 2:203101111-203101133 TTCATCATGAAATCTTTGCCAGG + Intronic
945342789 2:208677284-208677306 TTCATCATGAAATCTTTGCCAGG + Intronic
946147245 2:217740377-217740399 ATCATAATCAACCATGTGGCTGG - Intronic
1169334867 20:4747875-4747897 TTCAAAATGCATCCTGTTCCAGG + Intergenic
1171279909 20:23887617-23887639 TCCTTACTGAACCCTGTGCTAGG - Intergenic
1171400716 20:24871694-24871716 TTCTCAAAGCACCCTGTGCCTGG - Intergenic
1173059758 20:39650401-39650423 TGCATACTGCCCCCTGTGCCTGG + Intergenic
1173702415 20:45084603-45084625 TTAATATTTAACCTTGTGCCAGG + Intergenic
1174563784 20:51449868-51449890 TTAATAATGAACTATGTGCCAGG - Intronic
1175695220 20:61098230-61098252 ATCATAATGAATCCTATACCTGG - Intergenic
1178796084 21:35745659-35745681 TGCAAAGTGAACCATGTGCCAGG + Intronic
1178903220 21:36614403-36614425 TTGATAATGAACCCATTCCCTGG - Intergenic
1182061125 22:27398483-27398505 TACATAAGTAACACTGTGCCTGG + Intergenic
1183613209 22:38924816-38924838 ATCATAATGAAGACTGTGCTTGG - Intergenic
953709827 3:45260574-45260596 AACATATTGAGCCCTGTGCCAGG - Intergenic
955112994 3:55967782-55967804 TTCATAAGGAACCCACTCCCAGG - Intronic
955726877 3:61942514-61942536 TTCATAATGAGACCTGTGTTAGG + Intronic
957421222 3:79974362-79974384 TTTATTATGCACCCTGTGCCTGG + Intergenic
957879325 3:86189690-86189712 TTCATTATGAAGTCTTTGCCTGG - Intergenic
959804416 3:110533663-110533685 TTCATTAATAACCCTGTGCCAGG - Intergenic
959881863 3:111452761-111452783 TTCATCATGAAATCTTTGCCAGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960560540 3:119078652-119078674 TTCATCATGAAATCTTTGCCAGG - Intronic
960858792 3:122130239-122130261 TTCATCATGAAGTCTTTGCCAGG - Intergenic
961274812 3:125718476-125718498 GTCATAATGACTCCTGTTCCAGG - Intergenic
961277731 3:125741107-125741129 GTCATAATGACTCCTGTTCCGGG - Intergenic
961876690 3:130028555-130028577 GTCATAATGACCCCCGTTCCGGG + Intergenic
962472693 3:135726760-135726782 TTCATCATGAAATCTTTGCCAGG + Intergenic
962514308 3:136135698-136135720 TTTATCATGAGCCATGTGCCAGG - Intronic
962655228 3:137537175-137537197 TTCATCATGAAATCTTTGCCAGG + Intergenic
964868355 3:161286628-161286650 TTCATCATGAAATCTTTGCCAGG - Intergenic
965087798 3:164121846-164121868 TTCATCATGAAATCTTTGCCAGG - Intergenic
965230527 3:166045935-166045957 TTCATCATGAAATCTTTGCCAGG + Intergenic
966076963 3:175948074-175948096 TTCATCATGAATTCTTTGCCAGG - Intergenic
967058736 3:185852758-185852780 TTCATACTCTACCCTGGGCCTGG - Intergenic
967622079 3:191645680-191645702 TTCATCATGAAATCTTTGCCAGG - Intergenic
970379895 4:15496286-15496308 TTCATAATGAAGTCTTTGCCAGG + Intronic
971128604 4:23781123-23781145 TTCACTTTGAGCCCTGTGCCAGG - Intronic
971174912 4:24272903-24272925 TTAATAATGAATACTGTACCTGG - Intergenic
971305662 4:25478734-25478756 TTCATCATGAAACCTTTGCCAGG - Intergenic
972214941 4:36886682-36886704 TTCATCATGAAATCTTTGCCAGG + Intergenic
972836613 4:42878290-42878312 TTGATTATGAGCTCTGTGCCTGG - Intergenic
973072790 4:45885984-45886006 TTCATCATGAAATCTTTGCCAGG + Intergenic
973335113 4:48948188-48948210 ATTATAATGAACTCTATGCCAGG - Intergenic
973617904 4:52697805-52697827 TTCATCATGAAATCTTTGCCAGG - Intergenic
974270038 4:59638707-59638729 TTCATCATGAAATCTTTGCCAGG - Intergenic
974411593 4:61548335-61548357 TTCATCATGAAATCTTTGCCAGG + Intronic
975169377 4:71215537-71215559 TGTCAAATGAACCCTGTGCCAGG + Intronic
975372053 4:73600246-73600268 TTCACACTGTATCCTGTGCCTGG + Intronic
975692400 4:76978856-76978878 TTCATACTGAAGCATGTGGCTGG + Intronic
975709987 4:77151403-77151425 TTCATAAGAAACCCTGAGCAAGG + Intergenic
975909564 4:79250567-79250589 TTCATCATGAAATCTTTGCCGGG - Intronic
976076971 4:81310328-81310350 TTCATCATGAAGTCTTTGCCAGG - Intergenic
977484343 4:97623200-97623222 TTCATCATGAAATCTTTGCCAGG - Intronic
978656584 4:111072740-111072762 TTCATCATGAAATCTTTGCCAGG - Intergenic
979496226 4:121385947-121385969 TTAATGATGAACACAGTGCCTGG - Intergenic
980456523 4:133050995-133051017 TTCATCATGAAATCTTTGCCAGG - Intergenic
980539299 4:134172597-134172619 TTCATCATGAAATCTTTGCCAGG - Intergenic
982226318 4:153170711-153170733 TCCAGATTGAACCCTATGCCAGG + Intronic
982782746 4:159508043-159508065 TTCACAATGAACCATTTTCCTGG - Intergenic
984164094 4:176287036-176287058 TTCATAATCAACTAAGTGCCTGG - Intergenic
984315705 4:178128783-178128805 TTCTTAATGACCCCTCTACCTGG - Intergenic
986620830 5:9672227-9672249 TTCATCATGAAACCTTTGTCAGG - Intronic
986989950 5:13540294-13540316 TTCATCAAGAACCATATGCCAGG + Intergenic
987020343 5:13863940-13863962 TGCATAATGCACCATCTGCCTGG + Intronic
987159581 5:15127624-15127646 TTCATCATGAAATCTTTGCCAGG + Intergenic
987785731 5:22496158-22496180 TTCAACATGAATCCTGTGCTTGG + Intronic
988056381 5:26102960-26102982 TTTATAATGAAGTCTTTGCCTGG - Intergenic
988332484 5:29860402-29860424 TTCATAAATAACCCAGTGTCAGG - Intergenic
988401362 5:30765006-30765028 TTCAAAATAAACGCTGTGCTTGG + Intergenic
988979820 5:36555964-36555986 TTCATCATGAAATCTTTGCCAGG + Intergenic
989013577 5:36902313-36902335 TTCATCATGAAATCTTTGCCAGG + Intronic
989734071 5:44681649-44681671 TTCATCATGAAATCTTTGCCAGG - Intergenic
990885121 5:60582696-60582718 TTCATCATAAAACCTTTGCCAGG + Intergenic
991504823 5:67313663-67313685 TTCATTATGAAATCTTTGCCAGG - Intergenic
993821364 5:92621065-92621087 TTCATTATGAAATCTTTGCCAGG + Intergenic
994848080 5:105016226-105016248 TTCATCATGAAATCTTTGCCAGG - Intergenic
997019722 5:129985076-129985098 TTCATCATGAAGTCTTTGCCAGG + Intronic
998697819 5:144660542-144660564 TTCATCATTAACCATGTACCAGG + Intergenic
999504816 5:152183774-152183796 AGCATAATGAAGCCTGTGCATGG + Intergenic
999567323 5:152878941-152878963 TTCATCATGAAATCTTTGCCAGG - Intergenic
999853373 5:155566852-155566874 TTCGTCATGAACTCTTTGCCAGG - Intergenic
1000668178 5:164025071-164025093 TTCATTATGAAACCTTTGCTAGG + Intergenic
1001166368 5:169372642-169372664 TTCATCATGAAATCTTTGCCTGG + Intergenic
1001767723 5:174265744-174265766 TTCATCATGAAATCTTTGCCAGG - Intergenic
1004092863 6:12522896-12522918 TTCATCATGAAATCTTTGCCAGG + Intergenic
1004413539 6:15403643-15403665 TTAATAATGAACACTGTGTCAGG + Intronic
1005524341 6:26631077-26631099 TTCAAAATGAACCCTGGGGCCGG - Intergenic
1005909795 6:30298676-30298698 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1006117952 6:31785238-31785260 TTCACCATGGACCCTGTGCGTGG - Exonic
1009459394 6:63894143-63894165 CTCCAAATGCACCCTGTGCCAGG - Intronic
1009915617 6:69991955-69991977 TTCATCATGAAATCTTTGCCAGG + Intronic
1009997380 6:70911213-70911235 TTCATCATGAAATCTTTGCCAGG + Intronic
1011100099 6:83710173-83710195 TGCATACTGAACACTGTACCAGG - Intergenic
1011595824 6:89014949-89014971 TTCATCATGAAATCTTTGCCAGG + Intergenic
1011896722 6:92236898-92236920 TTCATCATGAAATCTTTGCCTGG + Intergenic
1011978171 6:93334335-93334357 TTCATCATGAAATCTTTGCCAGG - Intronic
1012834489 6:104247936-104247958 TTCATCATGAAATCTTTGCCAGG - Intergenic
1014238974 6:118993564-118993586 TTAATCATTTACCCTGTGCCAGG - Intronic
1016541500 6:145170799-145170821 TTCCTAAAGCACCCTGTGCCGGG + Intergenic
1016869524 6:148803058-148803080 TTCCTAATAAATCCTGTGGCAGG + Intronic
1016998820 6:149980981-149981003 TTCATCATGAAATCTCTGCCAGG - Intergenic
1018262185 6:161981332-161981354 TTAATAATGAAACCTCTGCATGG - Intronic
1020747817 7:12100003-12100025 TTCATCATGAAGTCTTTGCCTGG + Intergenic
1022972096 7:35527877-35527899 TTCATCATTGACCCTGTGCCTGG + Intergenic
1024287296 7:47769604-47769626 TTCATAATAAAACCTGTGCAAGG - Intronic
1024493063 7:50008896-50008918 TGCAAAATGAGCACTGTGCCTGG - Intronic
1026929803 7:74217556-74217578 TTCACATTTCACCCTGTGCCGGG - Intronic
1027173286 7:75887987-75888009 TCCAGACTGAACCCGGTGCCTGG + Exonic
1028938792 7:96495842-96495864 TACAGAATGAAACCTCTGCCTGG - Intronic
1030012170 7:105180822-105180844 TTCATCATGAAATCTTTGCCAGG - Intronic
1031429345 7:121647658-121647680 TTCATCATGAAATCTTTGCCAGG + Intergenic
1033605744 7:142927442-142927464 TTTATAAATTACCCTGTGCCAGG - Intronic
1036099154 8:5758127-5758149 TTCATAATGTACCCAGTTCCAGG + Intergenic
1036404595 8:8443207-8443229 TTCATAATTAACAGTGTGTCTGG + Intergenic
1039168861 8:34717917-34717939 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1039521530 8:38176304-38176326 TTCAAAATGAACTATATGCCTGG - Exonic
1043398798 8:79864009-79864031 TTCATGATGGAACCTGTGCTGGG - Intergenic
1043732415 8:83700084-83700106 TTCATATAGTACCCTGTGGCTGG + Intergenic
1044769243 8:95612247-95612269 TTCATCATGAAATCTTTGCCAGG + Intergenic
1044914023 8:97092758-97092780 TTCATCATGAAGTCTTTGCCAGG - Intronic
1046323167 8:112604721-112604743 TTCATTATGAAACCTTTGCCAGG - Intronic
1047278276 8:123422698-123422720 TTCATCATGAAATCTTTGCCAGG + Intronic
1047864098 8:129002657-129002679 TTAATTATGAAGCCTGTGACAGG + Intergenic
1048743999 8:137593018-137593040 TCCACAATGACCCCTGTGGCAGG + Intergenic
1048877358 8:138847299-138847321 ATCATAACGAACCCCATGCCTGG - Intronic
1049414398 8:142488691-142488713 TTCATCTTGACCCCTCTGCCTGG - Intronic
1050928135 9:11291774-11291796 TTCATCATGAAATCTTTGCCAGG + Intergenic
1051976698 9:22958798-22958820 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1052360724 9:27553647-27553669 TTCATCATAAAATCTGTGCCAGG - Intronic
1052402507 9:28018294-28018316 TTCATCATGAAATCTTTGCCAGG - Intronic
1052501274 9:29293535-29293557 TTCATTATGAAGTCTTTGCCAGG + Intergenic
1055337259 9:75245589-75245611 TTCATCATGAAATCTTTGCCAGG + Intergenic
1055963972 9:81847252-81847274 TTCACAATGGTCCCTTTGCCAGG + Intergenic
1056877846 9:90352309-90352331 TTCATCATGAAATCTTTGCCAGG - Intergenic
1056917473 9:90757854-90757876 GTCATAATGACTCCTGTTCCGGG + Intergenic
1058571787 9:106354047-106354069 TTCCTAATGAAATCTTTGCCAGG + Intergenic
1058790317 9:108438154-108438176 CTGATCATGAACCCTGTGCTAGG + Intergenic
1060340638 9:122773100-122773122 TTCATCATGAAATCTTTGCCAGG - Intergenic
1061243377 9:129387269-129387291 TGCAGAATGCAGCCTGTGCCAGG - Intergenic
1061587312 9:131577329-131577351 TTCAGAACAGACCCTGTGCCTGG - Exonic
1186107606 X:6224809-6224831 TTCATAATAATGCCTGTGCGTGG - Intronic
1187107416 X:16258447-16258469 TTCATCATGAAATCTTTGCCCGG + Intergenic
1187405615 X:19001087-19001109 TTCATAATGAAAGATTTGCCAGG - Intronic
1187615233 X:20986548-20986570 TTCATCATGAAATCTTTGCCGGG - Intergenic
1188921395 X:35982514-35982536 TTCATCATGAAATCTTTGCCAGG + Intronic
1188959665 X:36475305-36475327 TTCATCATGAAATCTTTGCCAGG - Intergenic
1189188477 X:39074452-39074474 TTCATGATCACCCCTGTGTCTGG - Intergenic
1189210978 X:39281928-39281950 TTCATCATGAAATCTTTGCCAGG - Intergenic
1190880533 X:54488985-54489007 TTCATTATGAAATCTTTGCCAGG - Intronic
1190940465 X:55035444-55035466 TTGATATTGTACCCTCTGCCTGG - Intergenic
1190993411 X:55578071-55578093 TTCATCATGAAATCTTTGCCGGG - Intergenic
1191018623 X:55837140-55837162 TTCATCATGAAATCTTTGCCAGG + Intergenic
1191961654 X:66709677-66709699 TTCATAATGAAATATTTGCCAGG - Intergenic
1192075847 X:67995597-67995619 TTCGTCATGAACTCTTTGCCAGG + Intergenic
1192625711 X:72725749-72725771 TACATAAAGAACCCTGAGGCTGG - Intergenic
1192837617 X:74818546-74818568 TTCATCATGAAATCTTTGCCAGG - Intronic
1192886728 X:75343129-75343151 TTCATCATGAAATCTTTGCCTGG + Intergenic
1193308922 X:79982034-79982056 TTCATCATGAAATCTTTGCCAGG + Intergenic
1193310900 X:80009521-80009543 TTCATAATGAAATCTTTGCCAGG + Intergenic
1193411840 X:81173767-81173789 CTCATAATGAGCACAGTGCCTGG + Intronic
1193428825 X:81374839-81374861 TTCATCATGAAATCTTTGCCAGG + Intergenic
1193611264 X:83634178-83634200 TTCATCATGAAATCTTTGCCAGG + Intergenic
1193854781 X:86586468-86586490 TTCATCATGAAACCTTTGCCAGG + Intronic
1193913220 X:87330586-87330608 TTCATTATGAGGCCTTTGCCAGG - Intergenic
1194786583 X:98092357-98092379 TTCATAATAAAATCTTTGCCAGG + Intergenic
1194797734 X:98233622-98233644 TTCATCATGAAGTCTTTGCCAGG - Intergenic
1194842009 X:98754318-98754340 GTCATAAAGGCCCCTGTGCCAGG - Intergenic
1195024063 X:100857971-100857993 TTCATCATGAAATCTTTGCCAGG + Intronic
1195238093 X:102921988-102922010 TTCATCATGAAGTCTTTGCCAGG + Intergenic
1196040547 X:111198380-111198402 TTCATCATGAAATCTTTGCCAGG + Intronic
1198280876 X:135141153-135141175 TTCATCATGAAATCTTTGCCAGG + Intergenic
1198290082 X:135231361-135231383 TTCATCATGAAATCTTTGCCAGG - Intergenic
1199594406 X:149495112-149495134 TTCAAAATGGACTGTGTGCCAGG - Intronic
1199917308 X:152357676-152357698 TTCATCATGAAATCTTTGCCAGG + Intronic