ID: 1105705815

View in Genome Browser
Species Human (GRCh38)
Location 13:22966806-22966828
Sequence CCTGAAGTCCAGGCCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 2, 1: 0, 2: 2, 3: 46, 4: 484}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105705811_1105705815 -1 Left 1105705811 13:22966784-22966806 CCTAGCGCCTCGTGTGGGATGTC 0: 2
1: 0
2: 0
3: 2
4: 95
Right 1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG 0: 2
1: 0
2: 2
3: 46
4: 484
1105705812_1105705815 -8 Left 1105705812 13:22966791-22966813 CCTCGTGTGGGATGTCCTGAAGT 0: 2
1: 0
2: 0
3: 5
4: 80
Right 1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG 0: 2
1: 0
2: 2
3: 46
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105705815 Original CRISPR CCTGAAGTCCAGGCCAGCCC AGG Intergenic
900385133 1:2407104-2407126 CCTGAGCTCCAGACCAGCCTTGG + Intronic
900410630 1:2510965-2510987 CCTGCAGCCCAGCCCAGTCCCGG - Intronic
901012944 1:6211325-6211347 CCTGAAGTCCATGGCAGACCGGG + Intronic
901400752 1:9013814-9013836 CCTGGATTCCAGGGCAGCGCCGG - Intronic
901657974 1:10781449-10781471 CAGGCAGTCCAGGCCAGCCCAGG + Intronic
902260218 1:15219510-15219532 GCTGACGTGGAGGCCAGCCCTGG + Exonic
902529425 1:17081029-17081051 CTTGAGGCCCAGGCCAGGCCCGG - Intronic
902559048 1:17265590-17265612 CCTGAGATCAAGGCCTGCCCTGG + Intronic
903050355 1:20595800-20595822 ACTGCACTCCAGCCCAGCCCGGG + Intronic
903058428 1:20652994-20653016 CCTCCAGTCATGGCCAGCCCTGG - Intronic
903946540 1:26967493-26967515 GCTGAGGTCCAGGCCAGGCGTGG - Intergenic
903999734 1:27332151-27332173 CCAGAAGGCCTGGCCCGCCCCGG - Intronic
904370743 1:30046021-30046043 CCTGGGGTCCCTGCCAGCCCCGG - Intergenic
904417398 1:30371749-30371771 CACGATGGCCAGGCCAGCCCTGG + Intergenic
904477481 1:30774591-30774613 CCTCAAGTCCATGCCTGCTCAGG - Intergenic
904602841 1:31683333-31683355 CCTGAATGCCAGGCAAACCCGGG + Exonic
904978437 1:34476575-34476597 CATGAGGCCCAAGCCAGCCCAGG + Intergenic
905250235 1:36643661-36643683 CCTGACGACCAGGGCAGCACTGG + Intergenic
905403230 1:37717677-37717699 CCAAAAGTCCTGGCCAGGCCGGG - Exonic
905671684 1:39794779-39794801 CCAGTAGTTCAGGCCAGCCTGGG + Intergenic
905873377 1:41417317-41417339 CCTGGAGTCCACACCCGCCCAGG - Intergenic
905884447 1:41484326-41484348 CAAGAGCTCCAGGCCAGCCCAGG + Intronic
906196139 1:43931889-43931911 GCTGGAGTCCCGGCCATCCCAGG + Intergenic
906380442 1:45328962-45328984 GCTGAACTCCCAGCCAGCCCCGG - Intergenic
906477709 1:46181029-46181051 TCTGAAGCCAGGGCCAGCCCAGG + Intronic
906484796 1:46226031-46226053 CCAGGAGTTCAGGCCAGCCTGGG + Intergenic
906576231 1:46892781-46892803 CTTGTGGTCCAGGCAAGCCCAGG - Intergenic
906595690 1:47074805-47074827 CTTGTGGTCCAGGCAAGCCCAGG + Intronic
907311270 1:53540428-53540450 CCTGAGCCCCAGGCCATCCCTGG - Intronic
907530019 1:55085731-55085753 CCTGAATTCCTGGCCTACCCTGG + Intronic
908350934 1:63286103-63286125 CCTGGAGGCCAGGCCAGCAGGGG - Intergenic
908703865 1:66930179-66930201 CCTCCAGTCCAGCCCAGCCGGGG + Intronic
908747045 1:67385918-67385940 ACTGAAGTCCAGGCCGGGCACGG + Intronic
909957776 1:81801002-81801024 CCCGAGGACCAGGCCGGCCCCGG - Intronic
911731321 1:101294935-101294957 CCTGAACTCCAGGCTGGCCGAGG - Intergenic
911863041 1:102979244-102979266 CCGGAGTTCCAGGCCAGCCTGGG - Intronic
912547644 1:110462443-110462465 CCTGCAGCCCACCCCAGCCCTGG - Intergenic
914666524 1:149837415-149837437 ACTGAAGTCCTCGCCAGCTCTGG - Intergenic
914669243 1:149856383-149856405 ACTGAAGTCCTCGCCAGCTCTGG + Intronic
914899564 1:151704538-151704560 CCTGAAGTCCAGGGAAACCAGGG + Intronic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
916100315 1:161388687-161388709 CCTGAAGGCAAGGCCAGTGCTGG - Intergenic
917135745 1:171786696-171786718 ACTGAACTCCAGTCCAGCCTGGG - Intronic
918310429 1:183281717-183281739 CCTGTGGTCTAGGGCAGCCCTGG + Intronic
918317871 1:183338101-183338123 ACTGGAGCCCAGACCAGCCCAGG + Intronic
919807726 1:201390669-201390691 CCTGTGATCCAGGACAGCCCTGG - Intronic
920431283 1:205920895-205920917 TCTGGAGTCCAGGCCAGCCTTGG - Intronic
922242324 1:223763900-223763922 ACTGCAGTCCAGCCCAGCCTGGG + Intronic
922481267 1:225941256-225941278 CCTTCACCCCAGGCCAGCCCAGG - Exonic
922595219 1:226808332-226808354 CCTGGAATCCAGACCAACCCAGG + Intergenic
922721478 1:227902183-227902205 CCTGATGGCCAGGCCAGGCCAGG + Intergenic
922808956 1:228405613-228405635 CCAGAAATGCAGGGCAGCCCTGG + Intronic
922866855 1:228867962-228867984 CCGCAGGTCCAGTCCAGCCCTGG + Intergenic
924027286 1:239847654-239847676 CATGAGTTCCAGGCCAGCCTGGG + Intronic
924751963 1:246901790-246901812 TCTGATGCCCAGGCCAGTCCAGG - Intronic
1063124349 10:3126055-3126077 CTTGACGTCCAAGCCAGCTCCGG + Intronic
1063370802 10:5521753-5521775 CCTCAAGTTCAGGCCTGCCTCGG + Intergenic
1064353766 10:14600196-14600218 TCTGGAATCCAGGCCAGCTCAGG + Intronic
1065382256 10:25102238-25102260 CTTGAAGTTCAGTCCTGCCCTGG + Intergenic
1065490486 10:26277299-26277321 GCAGAAGTCTTGGCCAGCCCAGG + Intronic
1067582156 10:47452662-47452684 CCTGAGTTCCAGGCCAGGCTGGG - Intergenic
1067836114 10:49642830-49642852 CCTGAAGGCCAGCCAAGCCGGGG - Intronic
1069712948 10:70501370-70501392 CATGATGTCCTGGCCAGACCAGG - Intronic
1070264012 10:74885278-74885300 CCTGGAGTCCAGACCAGCTTGGG - Intronic
1070457199 10:76629185-76629207 CCTGAGTTCCAGCCCAGCCTTGG - Intergenic
1070809687 10:79291334-79291356 CCTTATCTGCAGGCCAGCCCTGG - Intronic
1070829635 10:79410589-79410611 CTTGGAGGCCAGGCCAGTCCAGG + Intronic
1071257088 10:83880553-83880575 CCTGCAGCCCATGACAGCCCTGG + Intergenic
1073285526 10:102385286-102385308 CCTGAAGTCCAGGCCATGCCTGG + Intergenic
1075468048 10:122666148-122666170 CCTGCAGCCCTGGCCAGACCAGG - Intergenic
1075512221 10:123081775-123081797 TCTGATTTCCAGGCCAGCTCTGG - Intergenic
1076257023 10:129035511-129035533 TCTGAACTCCAAGGCAGCCCAGG - Intergenic
1076281467 10:129250186-129250208 CTCACAGTCCAGGCCAGCCCAGG + Intergenic
1076372075 10:129962107-129962129 TCTGAAGCCCAGGACAACCCAGG + Intronic
1076627160 10:131829222-131829244 CCTGGAATCCCGGCCAGACCTGG - Intergenic
1076728345 10:132424226-132424248 ACTGAATGCCAGGCCACCCCAGG - Intergenic
1076744903 10:132507974-132507996 CCTGATGTCCAGGCCATGCCCGG + Intergenic
1076834676 10:133015023-133015045 CCTGCAGGCCAGGCCGGCTCCGG + Intergenic
1076847438 10:133076207-133076229 CCTGACGTCCTGGGCAGCCTTGG + Intronic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1077053767 11:580031-580053 CCTGAACTCGAGGGCAGCTCTGG + Intronic
1077236965 11:1486510-1486532 CCTGAAGACCAAGCCCGGCCCGG - Exonic
1077453790 11:2665983-2666005 TGTGAATTCCAGGCCAGTCCTGG - Intronic
1077466964 11:2738052-2738074 CCAGCAGTCCAGGCCAGGCTCGG - Intronic
1077469960 11:2752938-2752960 CCTCAAGCCCAGACCAGCCAGGG - Intronic
1077506493 11:2932068-2932090 CCTGGAGGCCAGGCCTCCCCAGG + Intergenic
1078137224 11:8661602-8661624 CCTCAAGCCCAGGAAAGCCCTGG + Intronic
1078170878 11:8928341-8928363 ACTGAAGTACAGGCCAGGCCTGG + Intronic
1078183013 11:9028245-9028267 CCTGAGTTCCAGACCAGCCTGGG - Intronic
1078432953 11:11301768-11301790 CCCAATGCCCAGGCCAGCCCTGG - Intronic
1078635208 11:13043198-13043220 CCTGAATTCCAGGCCAGCCATGG - Intergenic
1080947488 11:36990679-36990701 CCTGATGTCAAAGTCAGCCCAGG - Intergenic
1081580056 11:44345967-44345989 CCTGTAGGAGAGGCCAGCCCTGG + Intergenic
1081605198 11:44523018-44523040 CCTGAACTCCAGGCTAGGCTGGG - Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1081854770 11:46296347-46296369 GGTGAAGTCCAGGGCTGCCCTGG - Intronic
1083971182 11:66076686-66076708 CTTCAAGTCCAGGCCAGTCCAGG - Intronic
1084212246 11:67629648-67629670 CCAGAGGTCCCTGCCAGCCCCGG + Intronic
1084962171 11:72722617-72722639 CCTGCAGTCCAGCCAATCCCTGG - Intronic
1084965245 11:72741199-72741221 CCAGAAGTCCAGGCAAGCTGAGG - Intronic
1085305895 11:75485974-75485996 CCTCAACCCCAGCCCAGCCCTGG + Intronic
1086001232 11:81987956-81987978 GCTGCAGTCCAGGCCTGCTCAGG - Intergenic
1086699974 11:89890235-89890257 CTTGATTTCCAAGCCAGCCCAGG + Intergenic
1086706196 11:89954281-89954303 CTTGATTTCCAAGCCAGCCCAGG - Intergenic
1086734064 11:90283807-90283829 CTTGTGGTCCAGGCGAGCCCAGG - Intergenic
1089172634 11:116526071-116526093 CCTGACATCCAGGCAAGACCAGG + Intergenic
1089582325 11:119489187-119489209 CCTCAAGGACAGGCCAGCCAGGG + Intergenic
1089698861 11:120232192-120232214 AGTGAGGTCCAGCCCAGCCCGGG - Intergenic
1090049244 11:123362850-123362872 CCGGAAGGCAAGGGCAGCCCTGG + Intergenic
1090772431 11:129932974-129932996 CTTGAGTTCCAGACCAGCCCAGG - Intronic
1091835552 12:3583276-3583298 CCCCAAGTCAAGGCCAGCTCTGG - Intronic
1096127121 12:49128132-49128154 CTTGTGGTCCAGGCGAGCCCAGG + Exonic
1096134073 12:49185184-49185206 CTTGTGGTCCAGGCGAGCCCAGG + Exonic
1096145066 12:49273037-49273059 CTTGTGGTCCAGGCGAGCCCAGG - Exonic
1096629346 12:52915670-52915692 ACTGAACTCCAGCCCAGCCTGGG + Intronic
1097011189 12:55954554-55954576 CCTGAGGACCATGCCACCCCAGG + Intronic
1097074966 12:56386116-56386138 GAAGAAGTCCAGGCCAGGCCAGG + Intergenic
1098643623 12:72869551-72869573 ACTGCATTCCAGTCCAGCCCGGG - Intergenic
1099058441 12:77874417-77874439 CCAGAAGTTCAAGCCAGCCTGGG - Intronic
1100397365 12:94196703-94196725 CCTCGAGTCCAGGCCTGGCCAGG + Intronic
1102027570 12:109722259-109722281 CCAAACATCCAGGCCAGCCCTGG - Intronic
1102060094 12:109925357-109925379 CCAGAACTCCAGTCCAGGCCCGG - Intronic
1102146914 12:110661203-110661225 CCTGAAGTCAAGGGGGGCCCTGG + Exonic
1102670453 12:114614531-114614553 CAGGAATTCCAGACCAGCCCTGG + Intergenic
1103763828 12:123268532-123268554 CCTGAGTCTCAGGCCAGCCCTGG + Intronic
1104001611 12:124863923-124863945 CCTGAAGCCCAAGGCTGCCCGGG - Intronic
1104421269 12:128637610-128637632 CACGAGTTCCAGGCCAGCCCGGG - Intronic
1104736658 12:131139446-131139468 CCTGATGCCCAGGCCAGCGTGGG + Exonic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1106231703 13:27825840-27825862 CCTGGAGTCCCCGCCAGCCCAGG - Intergenic
1106676623 13:31966383-31966405 CCAGGAGTCAAGACCAGCCCAGG - Intergenic
1106692557 13:32133986-32134008 CCAGAATTCCAGACCAGCCTGGG - Intronic
1108402339 13:50058773-50058795 ACTGAACTCCACTCCAGCCCAGG + Intergenic
1110572550 13:77022264-77022286 CTTGAATTCCAGGCCAACCAGGG + Intronic
1112330715 13:98475114-98475136 CCTCAAAGCCAGCCCAGCCCAGG + Intronic
1112385113 13:98932015-98932037 CCTGAAGCCCAGGCCGGGCATGG - Intronic
1112459417 13:99590173-99590195 CCTGCAGCCCAGCCCAGCCCAGG - Intergenic
1112618830 13:101034450-101034472 CCTGAAGTCCCTGCCACCACAGG + Intergenic
1113406703 13:110047574-110047596 CCTTATTTCCAGGCCACCCCAGG + Intergenic
1116453413 14:45089619-45089641 CATGAGTTCCAGACCAGCCCAGG - Intronic
1116994094 14:51304308-51304330 CCTGGAGTGCAGACCAGCCTGGG + Intergenic
1117072460 14:52069097-52069119 CCTGGAGTCCCGCCCCGCCCAGG - Intronic
1117876044 14:60250084-60250106 GCTGAAGCCCAGGACAGCCGGGG - Intronic
1118447512 14:65865180-65865202 CCTGAATGCCAGTCCAGCCACGG - Intergenic
1119263375 14:73251097-73251119 CCTGGAGTCTAGGCCAGAGCAGG - Intronic
1119753517 14:77098081-77098103 CCGGAAGACCAGGCCGGCGCGGG - Exonic
1120805021 14:88737489-88737511 CCTGGAGCCCAGTGCAGCCCGGG + Intronic
1121777914 14:96602960-96602982 CATGCAGTCCAGGCCAGGCCAGG + Intergenic
1122691864 14:103535352-103535374 CTAGGAGACCAGGCCAGCCCAGG + Exonic
1123961117 15:25402243-25402265 CCCAGACTCCAGGCCAGCCCCGG - Intronic
1124504663 15:30262296-30262318 GCTGAAGTCCAGCCAAGCCCTGG + Intergenic
1124575716 15:30906459-30906481 CCTGAAGTCCTTGGCAGCCAGGG + Intronic
1124600593 15:31129992-31130014 GCTGAAGACCAGCCCTGCCCAGG - Intronic
1124738889 15:32276339-32276361 GCTGAAGTCCAGCCAAGCCCTGG - Intergenic
1124911221 15:33922639-33922661 CCAGGAGTCCAGACCAGCCTGGG - Intronic
1125512898 15:40302412-40302434 CAGGAAGTCCAGGCTATCCCAGG + Intronic
1125716565 15:41822969-41822991 ACTGATGTCGAGACCAGCCCAGG + Exonic
1126167201 15:45663555-45663577 CATGAGGTCAAGGCCAGCCTGGG + Intronic
1127365697 15:58287531-58287553 CCAGAATTCAAGGCCAGCCTGGG - Intronic
1128349170 15:66877718-66877740 CCTGGAGCCCAGTCCAGCACAGG + Intergenic
1129220329 15:74128555-74128577 CCTGCAGTCCAGGGAAGCTCTGG + Exonic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1129886267 15:79039975-79039997 CAGGAATTCAAGGCCAGCCCGGG - Intronic
1131457431 15:92593462-92593484 CCTAAAGTTCAGGCCAACTCCGG + Intergenic
1131644186 15:94324201-94324223 GCTGAAGTTCAAGCCAGGCCTGG - Intronic
1132366878 15:101264284-101264306 GCTGAAGCCCAGCCCAGGCCTGG + Intergenic
1132403571 15:101528741-101528763 CCTGAAGGACAGCCCAGCCTGGG - Intergenic
1132881884 16:2165943-2165965 CCTTAAGCCAAGGCCAGCCCAGG + Intronic
1133037194 16:3040361-3040383 CCAGAAGTCGAGACCAGCCTAGG - Intergenic
1133145126 16:3779381-3779403 CCAGGAGTTCAGGCCAGCCGGGG - Intronic
1133202686 16:4213924-4213946 CCTGAGTTCCAGCCCATCCCTGG - Intronic
1134080676 16:11323017-11323039 CCAGGATTCCAGGCCAGGCCAGG + Intronic
1134291149 16:12903333-12903355 CCCGGAGTCCACGCCAGCCAGGG - Intronic
1134341045 16:13346388-13346410 CCTGAAGACTAGGCCAGACTTGG + Intergenic
1134563405 16:15230366-15230388 CCTGAACTTGAGGCCAGGCCTGG - Intergenic
1134743638 16:16570506-16570528 CCTGAACTTGAGGCCAGGCCTGG + Intergenic
1134923930 16:18141992-18142014 CCTGAACTTGAGGCCAGGCCTGG - Intergenic
1135528270 16:23230437-23230459 CAGGAGCTCCAGGCCAGCCCTGG + Intergenic
1135732720 16:24908006-24908028 CCTGTGGTCCAGGCCAGCCAGGG + Exonic
1136409246 16:30066661-30066683 CTTGGAGCCCGGGCCAGCCCTGG + Intronic
1136626959 16:31467115-31467137 CCAGAGGTCTAGGCCAGGCCAGG - Exonic
1137555289 16:49466616-49466638 TGTGAATGCCAGGCCAGCCCAGG + Intergenic
1137587654 16:49673448-49673470 CCCGCAGTCCAGGCCAGCCTCGG - Intronic
1138044006 16:53702724-53702746 CATGAATTCAAGGCCAGCCCGGG - Intronic
1138095359 16:54207072-54207094 CCTGAAATCCAGGCATGCCCAGG - Intergenic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1138612914 16:58141655-58141677 CAGGAATTCCAGACCAGCCCAGG - Intergenic
1140416034 16:74774579-74774601 GCTGATGTCCTGGCCCGCCCTGG + Exonic
1141634390 16:85306209-85306231 CCTAAAGAACAGTCCAGCCCTGG + Intergenic
1141898942 16:86977531-86977553 ACTGAAGAGGAGGCCAGCCCAGG + Intergenic
1141927041 16:87176899-87176921 CCTGAAGCCCAGGCCTGCCTCGG - Intronic
1142173139 16:88633290-88633312 GCTGGAGTCCAGGCCACCCTGGG + Intergenic
1142317947 16:89361028-89361050 CCTGGAGCCCAGGGCTGCCCAGG - Intronic
1142338988 16:89508490-89508512 CCTGGACTCCAGGCCGGGCCTGG - Exonic
1142780392 17:2176981-2177003 AATGCAGCCCAGGCCAGCCCAGG + Intronic
1143173527 17:4943783-4943805 CCGGGAGTTCAGGCCAGCCTGGG + Intronic
1143357781 17:6343410-6343432 ACAGAAGTCCAGGCCAGGCGTGG + Intergenic
1143658924 17:8312970-8312992 TCTGAGCTCCAGGCCAGGCCGGG - Exonic
1144072883 17:11690150-11690172 CTGGAATTCCATGCCAGCCCAGG - Exonic
1144310380 17:14008524-14008546 CAGGAATTCCAGGTCAGCCCAGG - Intergenic
1145799525 17:27673964-27673986 CCTTAAGTCCAGTGCAGCACAGG + Intergenic
1145997429 17:29112712-29112734 CCTGAAGGCCAGGCCAGAATAGG - Intronic
1146159494 17:30552351-30552373 CCTTAAGTCCAGCCCAGCACAGG - Intergenic
1146376991 17:32301356-32301378 CCAGAAGTCAAGACCAGCCTGGG + Intronic
1146596926 17:34177400-34177422 TCTGAAGGCCTGTCCAGCCCTGG + Intergenic
1146627014 17:34442588-34442610 CCTGACCCCCAGGCCAGCGCTGG + Intergenic
1147220730 17:38928235-38928257 CAAGAATTCCAGACCAGCCCAGG + Intergenic
1147597895 17:41728357-41728379 CCTGAAGGCCAGGGGAGCCAGGG - Intronic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1148015133 17:44516433-44516455 CCTGAGGTGCAGCCCAGGCCAGG + Intergenic
1148331556 17:46816945-46816967 CCTGAAGTCCCTGGCTGCCCTGG + Intronic
1148444155 17:47727585-47727607 CCTGGGCTCCAGGCCAGGCCTGG - Intergenic
1148794702 17:50191436-50191458 CCTGAAGGCCAGGGGCGCCCTGG + Exonic
1148863811 17:50618352-50618374 CCTGGAGCCTAGGCCAACCCTGG - Intronic
1149541153 17:57469125-57469147 TCTGAAATCCAGAACAGCCCTGG + Intronic
1150884279 17:69067335-69067357 CCAGAAGTTCAGACCAGCCTGGG + Intergenic
1151302731 17:73239809-73239831 TCTGAAGCTCAGGCCAGGCCTGG - Intronic
1151539082 17:74755524-74755546 CCTGAGGTCCAGGTCACCTCGGG + Intronic
1151620533 17:75242284-75242306 CCTGAAGGGCAGCGCAGCCCCGG + Intronic
1151947488 17:77327509-77327531 CCTGAAGGCCAGGGCAGGCAAGG + Intronic
1152065057 17:78107777-78107799 CCAGGACTCCAGGCAAGCCCCGG - Exonic
1152137314 17:78512106-78512128 CATTAAGTCCCAGCCAGCCCAGG - Intronic
1152225068 17:79089074-79089096 ACTCAGGTCGAGGCCAGCCCTGG - Intergenic
1152467089 17:80472628-80472650 TCTCAAGTCCAGGCCAGCAGTGG - Intronic
1152528559 17:80903438-80903460 CCTGCACCCCAGGCCTGCCCAGG + Intronic
1152562003 17:81083271-81083293 GCTGACGTCCAGGCCACCGCCGG - Intronic
1152572445 17:81126744-81126766 CCTTCAGTCCAGCCCAGCCCTGG - Intronic
1152621282 17:81366133-81366155 CCTGCAGCCCAGGGCAGGCCTGG - Intergenic
1152735260 17:81994125-81994147 CCTGATGTGCATGGCAGCCCGGG - Intronic
1152905774 17:82970181-82970203 CCTGGAAGCCAGGCCAGCCAAGG + Intronic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1154313656 18:13286579-13286601 CAGGAGGTCGAGGCCAGCCCGGG - Intronic
1156501268 18:37560175-37560197 ACTGAAATCTAGGCCAGCCCTGG + Intronic
1156881751 18:42088407-42088429 CCTGAGGACCAGTACAGCCCAGG + Intergenic
1157378597 18:47190235-47190257 GCTCAAGTCCACCCCAGCCCTGG - Intergenic
1157653152 18:49357938-49357960 CCAGAATTCAAGGCCAGCCTGGG + Intronic
1158079182 18:53568223-53568245 CCTGCAATCCAGGCCATCGCAGG - Intergenic
1158509423 18:58077373-58077395 CAGGAATTCCAGGCCAGCCTGGG - Intronic
1158532236 18:58273958-58273980 CCTGGAGTCCAGGCTGGCCTTGG + Intronic
1159117833 18:64135810-64135832 CCTGACCTCCAGGCCTGCCTCGG + Intergenic
1160004574 18:75060343-75060365 CGTGAGGGCCAGGCCAGGCCTGG + Intronic
1160517783 18:79488017-79488039 CCTGGGGTCCAGGCGAGCCTCGG + Intronic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160827377 19:1086864-1086886 CCTGCAGCCCAGGGCAGTCCAGG + Exonic
1161356142 19:3820518-3820540 CCTGAAGGCCATGGCTGCCCGGG - Intronic
1161768138 19:6217895-6217917 CCTGAGCTCCAGGCCCTCCCCGG + Intronic
1162767618 19:12929541-12929563 CATGAATTCAAGGCCAGCCTGGG - Intronic
1162964577 19:14149861-14149883 CCTGCGGCCCGGGCCAGCCCGGG - Exonic
1163832026 19:19551669-19551691 CCTGGAATCCTGGCCAGGCCGGG + Intergenic
1164812075 19:31165136-31165158 ACTGAAGTGCAGCCCTGCCCCGG + Intergenic
1164964029 19:32464626-32464648 CAAGAATTCCAGGCCAGCCTAGG + Intronic
1164989755 19:32675277-32675299 CATGGAGTCCAGCCCAGCCGGGG + Intronic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
1165236111 19:34423006-34423028 CCAAAAGTCCAGGCCAGGCGTGG - Intronic
1165595520 19:37009062-37009084 CTTGAAGCCAAGGCCAGCCACGG - Intronic
1165879156 19:39030896-39030918 TCTGAAGTTCAGGCCAGCCATGG - Intronic
1166364115 19:42269901-42269923 CCCGGAGCCCAGGCCAGCCCAGG - Intronic
1167048485 19:47065436-47065458 CCTGCACTGCAGCCCAGCCCCGG - Exonic
1167245401 19:48370160-48370182 GCTGAAGTCCAGTCTAGCGCTGG + Intronic
1167608937 19:50496870-50496892 CCTCCAGGCCAGGCCAGGCCAGG - Intergenic
1167906565 19:52665338-52665360 TGGGAAGTCCAGGCCAGCCTGGG + Intronic
1167909648 19:52691052-52691074 CCTGGGGTCCAGGCCAGCCTGGG + Intergenic
1167935018 19:52898409-52898431 CCGGAGGTCCAGGCCAGCGTGGG + Intergenic
925026108 2:608557-608579 CCTGAACTCAAAGCCAGCCCTGG - Intergenic
925090991 2:1155974-1155996 CCAGAAGGCCAGGCCAGGCCAGG + Intronic
925357555 2:3252784-3252806 CCTCAGGTCCCCGCCAGCCCTGG - Intronic
925961077 2:9017194-9017216 CCAGAAGTTCAGACCAGCCTGGG - Intergenic
927177708 2:20422105-20422127 CCTGGAGCCAAGGCCAGCACTGG + Intergenic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
928960610 2:36922308-36922330 CAGGAGGTCCAGACCAGCCCTGG + Intronic
929144286 2:38693052-38693074 CTTGAGCTCCAGGCCAGCCTGGG - Intronic
929584472 2:43105190-43105212 CCTGAGCCCCAGGTCAGCCCTGG + Intergenic
930171034 2:48251957-48251979 CCTGTACTCCACTCCAGCCCAGG + Intergenic
931365877 2:61618322-61618344 CCTGAATTCAAGACCAGCCTGGG + Intergenic
932720742 2:74137667-74137689 CCTGAGGTCCTGGCCATACCTGG + Intronic
933454052 2:82499044-82499066 CTTGAGTTCCAGGCCAGCCTGGG + Intergenic
933698260 2:85236343-85236365 CCTGGAGTCCAGGACAACCATGG - Intronic
933995988 2:87670264-87670286 ACTGAAGGCCAGGCCAGGCATGG - Intergenic
934088428 2:88529622-88529644 GCTGTAGCCCAGGGCAGCCCGGG - Intergenic
934519483 2:95010868-95010890 CCAGCAGTCCAGCCCAGCGCAGG + Intergenic
934766717 2:96883889-96883911 CTAGAGGTCCAGCCCAGCCCAGG + Intronic
934900861 2:98158871-98158893 CCTGACCTCAATGCCAGCCCAGG + Intronic
935956012 2:108377369-108377391 CCTGGGGTGCAGGCCAGGCCGGG + Intergenic
936285600 2:111178880-111178902 CCAGCAGGCCAGGGCAGCCCTGG + Intergenic
936297869 2:111280648-111280670 ACTGAAGGCCAGGCCAGGCATGG + Intergenic
937085222 2:119167217-119167239 GCTGAAGTCCAGGCCTTTCCCGG + Intergenic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
937354282 2:121188186-121188208 TCTGAAGTCCTGGGCAGCCAAGG - Intergenic
938473706 2:131589333-131589355 CCTGAGTTCCAGCCCAGCCATGG - Intergenic
938669973 2:133577343-133577365 CCTGTCTTCCAGGCCAGACCAGG - Intergenic
939008005 2:136811178-136811200 CCCGGAGTCCAGGCCAGATCTGG - Intronic
940919419 2:159290454-159290476 CCTGAAGTCTAGGCCGGCTGAGG + Intergenic
942061266 2:172230749-172230771 CCTGAATTCCTGGGCAGCCTCGG - Intergenic
946605802 2:221402782-221402804 CCTGAACTCCAGTCAAGCCATGG + Intergenic
947376112 2:229496921-229496943 CCTGAAGTACAGTCCAGCTCTGG - Intronic
947726365 2:232403372-232403394 CATGAGTTCCAGGCCAGCCTGGG - Intergenic
947749257 2:232524215-232524237 CCTCCAGCCCAGCCCAGCCCTGG + Intronic
948065478 2:235075573-235075595 CCTGAAGTGAAGGTCAGGCCGGG - Intergenic
948480849 2:238249552-238249574 GCTGTAGTCCAGCCCAGCACAGG - Intronic
948648036 2:239421143-239421165 ACTGAACTCCAGCCCAGCCTGGG + Intergenic
948779514 2:240310211-240310233 CCTGGAGTCCAGGCCGGCATGGG + Intergenic
948870430 2:240795195-240795217 GCAGAAGTCTAGGCAAGCCCAGG - Intronic
1168814158 20:725277-725299 CCTGGAGGCCAGGCCAGGCAAGG + Intergenic
1168967432 20:1907350-1907372 TCTGAAGAGCAGGCCAGCACTGG - Intronic
1169206311 20:3742158-3742180 ACTGTGGTCCAGACCAGCCCTGG - Intronic
1170066962 20:12321926-12321948 CCTGAGGGCTAAGCCAGCCCAGG - Intergenic
1171183623 20:23109559-23109581 CCTGAGGTCCAGGCAGGCCATGG + Intergenic
1171439715 20:25150251-25150273 CCTGTGCCCCAGGCCAGCCCAGG + Intergenic
1172215291 20:33231434-33231456 CCAGGAGTTCAGGCCAGCCTAGG + Intergenic
1172600090 20:36177456-36177478 AGTGAAATCCAGGGCAGCCCAGG - Intronic
1173630211 20:44507658-44507680 CCTGAGTTCCAGACCAGCCCAGG + Intronic
1174452531 20:50628975-50628997 CCTGAGCTCCAGACCAGGCCAGG - Intronic
1174482522 20:50841677-50841699 CCTGGAGTCCCCACCAGCCCAGG + Intronic
1174795294 20:53517261-53517283 CCTGCTGTCCAGTCCAGTCCTGG - Intergenic
1175193209 20:57224990-57225012 CCTGAGCTCCAGGAAAGCCCCGG - Intronic
1175252689 20:57618985-57619007 TCAGCAGTCGAGGCCAGCCCAGG - Intronic
1175566913 20:59987468-59987490 CCTGAAGGCCGAGCCAGCCAGGG + Exonic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1176131086 20:63497131-63497153 GCTGCTGTCCAGGGCAGCCCTGG - Intronic
1176517705 21:7798583-7798605 CTTGGAGTCCTGGCCAACCCAGG - Intergenic
1176525001 21:7859428-7859450 CCTGAGCTACTGGCCAGCCCTGG - Intergenic
1177835835 21:26185296-26185318 AGTGAAGTCCAGGCCTGCCAAGG - Intergenic
1178556679 21:33597522-33597544 GCTGGAGTCCAGGCCAGCCTGGG - Intronic
1178651733 21:34428595-34428617 CTTGGAGTCCTGGCCAACCCAGG - Intergenic
1178659021 21:34489441-34489463 CCTGAGCTACTGGCCAGCCCTGG - Intergenic
1179998839 21:44986108-44986130 CCAGGGGCCCAGGCCAGCCCGGG + Intergenic
1180228449 21:46412206-46412228 CCTGAAGCTCGGGCCAGCCTGGG + Intronic
1180738516 22:18036585-18036607 CCTGCATCCCAGGCCAGCCAAGG - Intergenic
1181063247 22:20291989-20292011 CCTCAAGACTATGCCAGCCCGGG + Intergenic
1181116478 22:20635191-20635213 CCTGAGGCCCAGGGCAGCCATGG + Intergenic
1181467678 22:23118860-23118882 CATGCAGGCCAGGCCAGGCCAGG + Intronic
1181504328 22:23341438-23341460 CCAGAAGACCAGTCAAGCCCTGG - Intergenic
1181655440 22:24294049-24294071 CCAGAAGACCAGTCAAGCCCTGG - Intronic
1181667090 22:24405930-24405952 ACTGAAGTCCAAGACAGCCAGGG + Intronic
1181709319 22:24671672-24671694 CCAGAAGACCAGTCAAGCCCTGG - Intergenic
1181852158 22:25757303-25757325 CTTGAAGTCCTGGTCAGGCCAGG + Intronic
1182110220 22:27717910-27717932 CCTGGAGTACAGGGCAGCCAGGG + Intergenic
1182420711 22:30247260-30247282 TCTAAAGTCCACGCCGGCCCCGG - Intergenic
1182459518 22:30473863-30473885 CCTGCAGTCCAGGCTACTCCGGG - Intergenic
1182756196 22:32681561-32681583 GCTGAAGTCCAGTCTTGCCCTGG - Intronic
1183350506 22:37332133-37332155 CCTCAAGTCCAGCCCAGCAGGGG + Intergenic
1183509886 22:38228490-38228512 TCTGATGTCCAGCCCAGCCTGGG - Intronic
1184533452 22:45071161-45071183 CCTGATGCCCAGGCCAGGTCGGG + Intergenic
1184650786 22:45918670-45918692 TCGGAAGTCAGGGCCAGCCCAGG + Intergenic
1184818386 22:46889825-46889847 TCTGCAGTCCATCCCAGCCCTGG - Intronic
1184901909 22:47451578-47451600 TCTGAAGGCCAGGCTTGCCCTGG + Intergenic
1184924007 22:47624853-47624875 ACTGAAGTGCGGGCCAGCCGAGG - Intergenic
1185005720 22:48275709-48275731 CCTGAGGTCCAGCCCAGCTCTGG - Intergenic
1185058452 22:48593180-48593202 CCTGAGGCCGAGGCCAGCCCAGG + Intronic
1185068508 22:48643793-48643815 CATGGTGTCCAGGCCACCCCAGG - Intronic
1185269929 22:49924767-49924789 GCTTAAGTCCAGGCCTGCCATGG + Intronic
949535739 3:4995116-4995138 GCTCAAGTCCCAGCCAGCCCAGG + Intergenic
950582891 3:13874145-13874167 CCTGAAAGCCAGGTCAGCCTTGG - Intronic
951816620 3:26761955-26761977 CCTGAGCCTCAGGCCAGCCCAGG - Intergenic
952206154 3:31182682-31182704 GCTGAAGTCCAGGTGACCCCTGG + Intergenic
952463407 3:33554016-33554038 CAGGAAGTCAAGGCCAGCCGGGG + Intronic
952819096 3:37470710-37470732 CAGGAATTCCAGGCCAGCCTGGG - Intronic
953247749 3:41210999-41211021 CAGGAATTCAAGGCCAGCCCTGG - Intronic
954003908 3:47577980-47578002 CCTGGAGCCCCGGCCCGCCCCGG + Intronic
954144710 3:48628836-48628858 GCTGCAGTCCAGGCCCTCCCAGG + Intronic
954446264 3:50548458-50548480 CGGGAGGTCAAGGCCAGCCCGGG - Intergenic
954670361 3:52287891-52287913 TCTGAAGGCCATGCGAGCCCTGG - Intronic
954744158 3:52777678-52777700 CCTGCAGGCCATGCCTGCCCTGG + Exonic
954990874 3:54839725-54839747 CCTGAGGCCCAGGAAAGCCCAGG - Intronic
955392135 3:58529688-58529710 TCTGAAGCCCAGGCCAGGCGAGG + Intronic
956194816 3:66642670-66642692 ACTGAAGTCCAAGCCATCCGTGG - Intergenic
956421163 3:69087219-69087241 CCAGAAGTCAAGACCAGCCTGGG - Intronic
956479872 3:69662666-69662688 CATCAAGCCCAGCCCAGCCCAGG - Intergenic
956952756 3:74301312-74301334 CCTGAACTCCAGGCCAGCAGGGG - Intronic
958560523 3:95742978-95743000 TTTGTAGGCCAGGCCAGCCCAGG - Intergenic
960800732 3:121536852-121536874 CCTGAGTTCCAGACCAGCCTGGG - Intronic
960989324 3:123300539-123300561 CCTGAAACCCAGGGCAGCCTGGG - Intronic
961225490 3:125241356-125241378 CCTGAATTCGAGACCAGCCTAGG - Intronic
961365883 3:126398944-126398966 CCTGCAGCCCTGGCCAGGCCAGG + Intronic
962567225 3:136673892-136673914 CATGAATTCAAGGCCAGCCTGGG + Intronic
962915642 3:139901055-139901077 ACTCAAGTCCAGGCCAGCAGTGG - Intergenic
963933169 3:151025386-151025408 CATGAATTCAAGGCCAGCCTGGG - Intergenic
965622737 3:170656884-170656906 CCTGAAACCCAGGCCTCCCCTGG - Intronic
968525957 4:1057272-1057294 CCTGCAGTCCAGTCCACCCCTGG - Intronic
968548938 4:1212710-1212732 CCTGAAGGCCACCCCAGCCCAGG + Intronic
968657183 4:1783686-1783708 CTGGAAGCCCAGGCAAGCCCAGG + Intergenic
969262510 4:6043035-6043057 GAGGAAGTCCAGGCCAGCACAGG + Intronic
969285307 4:6199262-6199284 CCTGAAGGCTGGGCCAGCCTCGG - Intronic
969417841 4:7072707-7072729 CCTGTCCTTCAGGCCAGCCCAGG - Intergenic
969659494 4:8518144-8518166 CCTCAAGTCCGGGTCACCCCAGG - Intergenic
970906867 4:21226201-21226223 CAGGAAGTCGAGGCCAGCCTGGG + Intronic
977592845 4:98845743-98845765 TCTGAAGTCAAGCCCAGGCCAGG + Intergenic
977594517 4:98864183-98864205 CTTGAGGTCAAGACCAGCCCTGG + Intergenic
977716848 4:100191853-100191875 CCTGAAGGTCAGGCGAGCCAAGG + Intergenic
977913049 4:102559731-102559753 CATGAGTTCAAGGCCAGCCCGGG + Intronic
978574988 4:110180926-110180948 CCGGAATTCAAGACCAGCCCAGG + Intronic
979524645 4:121704378-121704400 CAAGAAGTCGAGGCCAGCCTGGG + Intergenic
980713477 4:136600825-136600847 CCTGCACTCCAGTCCAGCCTGGG + Intergenic
983201780 4:164868671-164868693 AATGAAGTCCAGGCCAGGCATGG - Intergenic
984808827 4:183776154-183776176 CCTGGAGAGCAGCCCAGCCCTGG + Intergenic
985034022 4:185820488-185820510 TCTGAAGGCCAGCCCTGCCCTGG - Intronic
986132342 5:4943003-4943025 CCTGCAGTCCAGGACGGCCACGG + Intergenic
986273581 5:6254383-6254405 CCTGAAGTCCAGAGCAGCTATGG - Intergenic
986282544 5:6335408-6335430 CCTGAGGGCCAGGCGAGCTCAGG + Intergenic
986345806 5:6834052-6834074 CCTGAAGGCCATGACAGACCAGG + Intergenic
987089955 5:14501741-14501763 CCTGACCTGCAGTCCAGCCCAGG - Intronic
987835363 5:23153758-23153780 CCTGGAGTCCAGACTAGCCTGGG - Intergenic
988907199 5:35801877-35801899 CCTGAAGTTGAGGCAAGGCCTGG + Intronic
991316244 5:65309896-65309918 CATGAATTCCAGACCAGCCTGGG + Intronic
991618318 5:68519070-68519092 TCTGAAGTCCACTCCACCCCTGG + Intergenic
992413962 5:76535080-76535102 CCTGAGGTCCAGCCCTGACCTGG - Intronic
995433759 5:112112348-112112370 GCTGAAGTCCAGGCATGGCCAGG + Intergenic
996125735 5:119723554-119723576 CCTGGAGTCAAGACCAGCCCGGG + Intergenic
997437075 5:133883339-133883361 CTTGGAGTCCAGGCCAGTCAGGG - Intergenic
997474284 5:134133693-134133715 CCTGGAGCCCTGGCCACCCCAGG + Intronic
999373104 5:151068184-151068206 CCAGAAGTCCAGGCCCTCCAGGG - Intronic
999701289 5:154230847-154230869 TCTGGAATCCAGGCCAGTCCTGG + Intronic
1000079676 5:157833058-157833080 GCAGAAGTCCAGGCCAGGCGCGG + Intronic
1000317570 5:160107726-160107748 CCCCAAGTCCAGGCCAGGCGCGG + Intronic
1001293845 5:170485270-170485292 CCAGAGGCCCAGGCCAGGCCAGG - Intronic
1001425568 5:171619873-171619895 CCTGATGCCCAGGCCATCCCAGG + Intergenic
1001497760 5:172201798-172201820 CAGGAGTTCCAGGCCAGCCCGGG + Intronic
1001956783 5:175853299-175853321 CCTCAATTCTGGGCCAGCCCTGG + Intronic
1002153510 5:177256489-177256511 CAGGAAGTCGAGGCCAGCCCAGG - Intronic
1002322233 5:178382877-178382899 CTTGACTTCCAGGCCAGCCGAGG - Intronic
1002506247 5:179681087-179681109 CCTCCAGGCCAGGCCACCCCAGG + Intronic
1002939507 6:1703726-1703748 CCTCAAGTGCAGCTCAGCCCTGG - Intronic
1003587722 6:7408325-7408347 CCTGAAGACCTGGCCAGGCAAGG - Intronic
1004408755 6:15360712-15360734 CCAGGAGTCCAAGACAGCCCTGG - Intronic
1004741994 6:18471363-18471385 CCTGAATTCCAGCCTGGCCCTGG + Intergenic
1005689630 6:28290303-28290325 CCAGAAGTTCAAGCCAGCCTGGG - Intronic
1007828197 6:44617606-44617628 GGTGATGTCCAGGCCAGCCTAGG + Intergenic
1008426688 6:51366501-51366523 ACTGAAGTCAAGGTCAGCCTTGG - Intergenic
1008509040 6:52259180-52259202 CAGGAACTCCAGACCAGCCCGGG + Intergenic
1009697320 6:67123715-67123737 CATGAAGTCCCAGCCATCCCAGG + Intergenic
1011850355 6:91620109-91620131 CCAGAGGGCCAGCCCAGCCCTGG + Intergenic
1012887273 6:104859899-104859921 CCAGAAGGCCACGCGAGCCCGGG - Exonic
1014253604 6:119139999-119140021 CCTGAGGTCCAAGCCACCCTGGG - Intronic
1016318247 6:142813773-142813795 CCAGGAGTCGAGACCAGCCCGGG - Intronic
1016446515 6:144138410-144138432 TCTGAATTCCAGGCCAACCATGG - Intergenic
1016950343 6:149573656-149573678 CCTGAGTTCGAGACCAGCCCGGG + Intronic
1017676474 6:156819768-156819790 CCTGAACTCCAGGCCCGGGCAGG - Intronic
1017760302 6:157563096-157563118 CCAGGAGTCCAGCCCAGCTCCGG - Intronic
1018479979 6:164180548-164180570 CCTGTAGTCCATGCCAGCTACGG - Intergenic
1018913279 6:168116612-168116634 CCTGGAGTCCAGGCCACTCGAGG + Intergenic
1019177338 6:170166822-170166844 TCTGAAGGGCAGGCCAGCCTGGG - Intergenic
1019217948 6:170455558-170455580 GCTGGAGCCGAGGCCAGCCCTGG - Intergenic
1019605376 7:1907495-1907517 CCTGAGGCCCAGGCCAAGCCAGG + Intronic
1019652599 7:2168535-2168557 ACTGAAGTTCAGGAAAGCCCAGG - Intronic
1019671667 7:2283306-2283328 CCTGGAGGCCAAGCCCGCCCCGG + Intronic
1019892200 7:3955571-3955593 CGTGCAGTGCAGGCCAGCCGAGG + Intronic
1020264297 7:6550199-6550221 CCTGAGTTCAAGGCCAGCCTGGG - Intronic
1021617453 7:22517521-22517543 CCTGAGGTTCAGTCCTGCCCTGG + Intronic
1022028127 7:26467378-26467400 ACTGGAGTCCAGGCCAGCAGCGG + Intergenic
1022864634 7:34405149-34405171 GCTGAGGTCCAGGCAAGCACAGG - Intergenic
1022927040 7:35066935-35066957 CCTGAGGTTCAGTCCTGCCCTGG + Intergenic
1023453999 7:40318725-40318747 GCTGAAGGCCAGGCCAGGCATGG - Intronic
1024333249 7:48177860-48177882 CCTGAAGGCCAGGGAAGCCCAGG - Intronic
1025758078 7:64364094-64364116 TCTGAAGTCAAGCCCAGCCATGG + Intergenic
1026917103 7:74127128-74127150 CCAGAAGTTCAAGCCAGCCTGGG + Intergenic
1028375221 7:90138588-90138610 CCTGAGGTTCAGTCCTGCCCTGG - Intergenic
1028583037 7:92426116-92426138 CCTGAAGTGCAGCCCAGACTCGG + Intergenic
1028593884 7:92528122-92528144 CCACAAGTCCAGTGCAGCCCTGG - Intronic
1029268970 7:99365065-99365087 TCTGAAGCCCAGGGCTGCCCTGG - Intronic
1029274394 7:99395690-99395712 CCTACAGGCCAGGCCAGGCCAGG + Exonic
1029356421 7:100055483-100055505 TCTCAAGTCCAGGCCTGCCTCGG + Intronic
1029524970 7:101088725-101088747 CCGGGAGCCCAGCCCAGCCCTGG + Exonic
1029525089 7:101089188-101089210 CCTGGAGGCAAGGCCAGCCGGGG + Exonic
1029541645 7:101186582-101186604 ACTGCACTCCAGCCCAGCCCAGG - Intergenic
1029646096 7:101857003-101857025 TCTGAAGTCCTGCCCAGCTCCGG + Intronic
1031425090 7:121595656-121595678 CCTGAATCCCAGACCAGCCTTGG + Intergenic
1032084131 7:128874694-128874716 CCGCAAGCCCAGGCCAGCTCAGG - Intronic
1033127827 7:138720461-138720483 CCTCAAGTCCTGGCCTGTCCAGG - Intronic
1033492274 7:141855126-141855148 CATGAACTCCTGGCCAGGCCAGG + Intergenic
1034339141 7:150341081-150341103 CCCGAGGTCCAGGCCAGCCGGGG + Exonic
1034540303 7:151754216-151754238 CAGGATGTGCAGGCCAGCCCTGG + Intronic
1034993401 7:155562289-155562311 CCTGAAGTCCAGCTCCACCCGGG - Intergenic
1035035120 7:155889809-155889831 CCAGAGGTCATGGCCAGCCCTGG - Intergenic
1035047913 7:155981257-155981279 CCTGAAGGCAAAGCCAGACCAGG + Intergenic
1035087512 7:156273325-156273347 CCTGATGTGCAGGCCTTCCCAGG - Intergenic
1035117095 7:156533691-156533713 CCTCCATGCCAGGCCAGCCCTGG + Intergenic
1035662625 8:1359374-1359396 TCTGAAGCCCAGGGCAGCACAGG - Intergenic
1036283730 8:7424397-7424419 CTGCAAGACCAGGCCAGCCCAGG - Intergenic
1036337741 8:7887132-7887154 CTGCAAGACCAGGCCAGCCCAGG + Intergenic
1036562432 8:9908039-9908061 CCTTCAGTCCAGGCCAACTCGGG - Intergenic
1038059061 8:23892196-23892218 CCTCAAGGGCAGGCCAGCCTTGG + Intergenic
1038218442 8:25584744-25584766 CCTGGGCTTCAGGCCAGCCCAGG + Intergenic
1038303967 8:26382991-26383013 CCTGACGTCAGGGCCCGCCCAGG - Exonic
1038410441 8:27354338-27354360 CCTGTGGTCCAGGCCAGGACGGG + Intronic
1038459579 8:27704613-27704635 CCTCTAGTCCAGCCCAACCCAGG - Intergenic
1038495805 8:28001340-28001362 TCTGAAATCCAGGCCAGGCACGG - Intergenic
1038847419 8:31243227-31243249 CATGAGGTCCAGACCAGCCAGGG + Intergenic
1038882880 8:31634175-31634197 GCTGAAGTTCAGGCCAGGCACGG - Intergenic
1039212964 8:35236422-35236444 CCCGAGGTCCCAGCCAGCCCTGG + Intronic
1040317865 8:46274462-46274484 CAGCAAGTCCAGGACAGCCCTGG - Intergenic
1040408839 8:47134608-47134630 CCTGAATTCCAGCCCAGCCATGG + Intergenic
1040630858 8:49208441-49208463 CCTGAAGTCCATGCCTGCAGAGG + Intergenic
1041436617 8:57848779-57848801 CCAGACGTCCAGGGCAGCCTGGG - Intergenic
1042906519 8:73777559-73777581 CCGGAAGTCCAGGGAGGCCCAGG - Intronic
1043864555 8:85360481-85360503 CAGGAATTCCAGACCAGCCCGGG + Intronic
1045333377 8:101176879-101176901 GCTGAACTCTAAGCCAGCCCTGG - Intergenic
1049197684 8:141324590-141324612 CCAGGATTCCAGCCCAGCCCTGG - Intergenic
1049200432 8:141337378-141337400 CCTGAAGTCCAGGAGAGCCGAGG - Intergenic
1049322843 8:142006151-142006173 CCTGAGGACCAGGCCACGCCAGG + Intergenic
1049470464 8:142773055-142773077 CCTGGAGTCCCTCCCAGCCCTGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049658253 8:143808384-143808406 CTTGGACTCCAGGCCTGCCCTGG - Intronic
1049711280 8:144064466-144064488 CCTGTAGCCCTGGCCTGCCCTGG - Intergenic
1050983537 9:12052328-12052350 CCTGATGTCAAGGCCAGACAAGG - Intergenic
1055389868 9:75808960-75808982 CCTGTAGTCCAAGCTACCCCAGG - Intergenic
1056206333 9:84322986-84323008 CCTTAGGTCCCTGCCAGCCCAGG - Intronic
1056796837 9:89664348-89664370 CCTGAATGCAGGGCCAGCCCTGG + Intergenic
1057184523 9:93049512-93049534 CCTGTGGTCCAGCCCAACCCTGG + Intergenic
1057467169 9:95324890-95324912 TTTGAAGTCCAGCCCAGCCATGG + Intergenic
1058456589 9:105143439-105143461 CCTGAAGGCCAGGGCTGCTCAGG - Intergenic
1058862826 9:109133591-109133613 TCTAAAGTCCTGGCCAGCACTGG + Exonic
1059408905 9:114119737-114119759 CAGGAAGCCCAGGCAAGCCCGGG + Intergenic
1059414492 9:114154864-114154886 CCAAAACTCCAGTCCAGCCCTGG - Intergenic
1061104133 9:128515992-128516014 ACTGTAGTCCAGTCCAGCCTGGG - Intronic
1061110784 9:128568802-128568824 GCTGAAGTGCAGGCCAACTCAGG + Exonic
1061587641 9:131579038-131579060 CCTGCAGGACAGGCCACCCCAGG + Exonic
1061743558 9:132724082-132724104 GCTGAACGCCAGGCCAGCCCAGG - Intergenic
1061774083 9:132948968-132948990 CCTCACGGCCAGGCCAGGCCAGG - Intronic
1062261520 9:135665401-135665423 TCTGAAGTCCGGCCCAACCCTGG + Intronic
1062326623 9:136015469-136015491 CTGGAAGGCGAGGCCAGCCCAGG + Intronic
1062442997 9:136579404-136579426 CCTGGGGCCCAGGGCAGCCCTGG + Intergenic
1062578418 9:137219088-137219110 CCTGAAGGTCAGGCCAGCCGGGG + Intergenic
1185852915 X:3506080-3506102 CCAGAAGTTCAGACCAGCCTGGG + Intergenic
1187034403 X:15522637-15522659 GCTGAGGTCCAGGGCAGCCGGGG - Intronic
1189491517 X:41474553-41474575 GCTGAGGTCCAGGCCGGCCACGG - Exonic
1190258915 X:48786052-48786074 CCTGCAGGCCAGGCCAGTGCTGG - Intergenic
1195165738 X:102218502-102218524 CAGGAAGTCAAGGCCAGCCTGGG + Intronic
1195193120 X:102468589-102468611 CAGGAAGTCAAGGCCAGCCTGGG - Intronic
1197320182 X:125019120-125019142 CCACAAGTCCAGGCTAGCACAGG + Intergenic
1197373199 X:125649754-125649776 CCTGAGGCCCAGTCCAGGCCTGG + Intergenic
1199982296 X:152927775-152927797 CCTGAGCCCCAGGCCTGCCCTGG - Intronic
1200161249 X:154010909-154010931 CCTGCAAGCCAGGCCATCCCTGG - Exonic
1200958845 Y:8978533-8978555 CCAGAATTCCAGACCAGCACAGG + Intergenic