ID: 1105706756

View in Genome Browser
Species Human (GRCh38)
Location 13:22971971-22971993
Sequence CCGTCCCACCCAGACTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105706750_1105706756 3 Left 1105706750 13:22971945-22971967 CCCTGAGTCGGGAGGCATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG 0: 1
1: 0
2: 0
3: 23
4: 178
1105706752_1105706756 2 Left 1105706752 13:22971946-22971968 CCTGAGTCGGGAGGCATCCTGGC 0: 1
1: 0
2: 1
3: 12
4: 94
Right 1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG 0: 1
1: 0
2: 0
3: 23
4: 178
1105706749_1105706756 10 Left 1105706749 13:22971938-22971960 CCGGCTGCCCTGAGTCGGGAGGC 0: 1
1: 0
2: 0
3: 27
4: 174
Right 1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG 0: 1
1: 0
2: 0
3: 23
4: 178
1105706745_1105706756 24 Left 1105706745 13:22971924-22971946 CCAGGCTCGCTCAGCCGGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG 0: 1
1: 0
2: 0
3: 23
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105706756 Original CRISPR CCGTCCCACCCAGACTCACA CGG Intergenic
900076185 1:819875-819897 CCGTCCCACTCAGCCCCACCTGG + Intergenic
900326437 1:2110711-2110733 CCACCCCACCCACACTCACAGGG - Intronic
900518544 1:3094835-3094857 CCTTCCCACCCAGAGTCCCTCGG - Intronic
900899207 1:5505436-5505458 CCAGCCCACCCTGACTAACATGG + Intergenic
902036067 1:13459065-13459087 CCGTCCCACCCACACTCAAGGGG + Intergenic
902331222 1:15732086-15732108 CTGACCCACCCAGACCCCCAGGG + Intronic
904703399 1:32372613-32372635 CCGTCCTACCCTGTCACACAAGG + Intronic
905536839 1:38728965-38728987 CCTTCCCACCCAGAGTGAGAGGG + Intergenic
906432859 1:45769716-45769738 AGGTCCCACCCACACTCAAAGGG + Intergenic
909207594 1:72779120-72779142 CCCTCCTGCCAAGACTCACAAGG - Intergenic
914826815 1:151143103-151143125 CCCTCCCTCCCAGACCCCCACGG + Intronic
917122028 1:171652757-171652779 CAGCCCCACCCAGCCTCACGTGG - Intergenic
918290836 1:183106520-183106542 CTGTGCCTCCCAGACTCACCTGG + Intronic
918724916 1:187908487-187908509 CAGTCCTACCCACACTTACAGGG - Intergenic
921337413 1:214102112-214102134 CCCTCCCATCCATACTCAGAGGG - Intergenic
922301665 1:224306799-224306821 CCTTGTCACCCAGACTGACATGG - Intronic
923030517 1:230245896-230245918 CCTCCCCACCCAGACCCAGAAGG - Intronic
923624561 1:235603483-235603505 CCCTCCCACCCAGACACCCAGGG + Intronic
1062832559 10:615627-615649 CCGCCCCACACACACACACAGGG + Intronic
1062899712 10:1133848-1133870 CCGTCCCACCCAGAAGCTCTGGG + Intergenic
1062956547 10:1544110-1544132 CCGTCCCAGGCAGACTCTCTGGG + Intronic
1064229348 10:13516320-13516342 CCGGGCCTCGCAGACTCACATGG - Intronic
1069404328 10:68082177-68082199 CCGCCGCACCCAGCCTCAAAAGG - Intergenic
1069806999 10:71132364-71132386 CCCTCCCAGCCAGTCCCACAAGG - Intergenic
1069871645 10:71536688-71536710 CTGTCCCATCCAGACCCAAACGG + Intronic
1071565277 10:86668389-86668411 CCGGTCCACCATGACTCACACGG - Intergenic
1073100316 10:101002963-101002985 CCGTTCTACCCAGGCCCACAAGG - Intronic
1073267953 10:102239901-102239923 CCTTCCCAACCAGACTGAGAGGG + Intronic
1073435517 10:103513637-103513659 GGGACCTACCCAGACTCACAGGG + Intronic
1074896068 10:117778634-117778656 CCCCCCAACCCAGACTGACATGG + Intergenic
1076067597 10:127461125-127461147 TTGTCCCTCCCAGGCTCACATGG - Intergenic
1076560696 10:131361468-131361490 CAGCCCCACCCAGCCTCACCTGG + Intergenic
1077144938 11:1040519-1040541 CAGCCCCACCCAGCCACACAAGG - Intergenic
1078090061 11:8259531-8259553 CCCACCCTGCCAGACTCACAAGG + Intronic
1083323555 11:61862175-61862197 CCATCCCACCCAGTCACCCACGG - Intronic
1084595998 11:70117468-70117490 CCTTCCCACCCAGGCTCCCCAGG + Intronic
1084731428 11:71076102-71076124 CCTCCCCACCCAAGCTCACAGGG + Intronic
1087166789 11:95012711-95012733 CAGTCTCATCCAGATTCACAGGG - Intergenic
1090185837 11:124738686-124738708 CTGTCCCAACCAGAGCCACAGGG + Intergenic
1090214959 11:124953950-124953972 CAGTCCCACCGCGCCTCACATGG + Intergenic
1091283888 11:134397515-134397537 CATTCCCACCCAGAGCCACAGGG + Intronic
1096465983 12:51848078-51848100 CCCTCCCACACACACACACAGGG + Intergenic
1103327692 12:120132379-120132401 CCGCCCCTCCCTGCCTCACAGGG - Intronic
1104066320 12:125310138-125310160 CAGGCCCACCCAGACTCAAAGGG + Intronic
1105330557 13:19411814-19411836 CCCCCTCACCCTGACTCACAAGG - Intergenic
1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG + Intergenic
1105918628 13:24940589-24940611 TCCTCTCACCCTGACTCACAAGG - Intergenic
1106853249 13:33818262-33818284 CCGGCCCCCGCAGACTCACCAGG - Exonic
1107833484 13:44395216-44395238 CCTCCCCACCAAGGCTCACAAGG - Intronic
1108889205 13:55232219-55232241 CCTTCCCACCCTGCCTCATATGG + Intergenic
1111222591 13:85223666-85223688 CCTTGCCACCCAAACTCACAGGG + Intergenic
1113520416 13:110936646-110936668 CCGCCCCGCCCACACTCACCTGG - Intergenic
1115709041 14:36029789-36029811 GTGTCCCAGCCTGACTCACAAGG + Intergenic
1117885869 14:60362335-60362357 AGGCCCCACCCACACTCACAGGG + Intergenic
1118223578 14:63878172-63878194 CCATCACACCCAGCCTAACATGG + Intronic
1118309528 14:64682302-64682324 CCCTCCCCCACAGACACACAGGG - Intergenic
1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG + Intergenic
1122274854 14:100586305-100586327 CCGCCCCACCCATACCCCCAGGG + Intronic
1122690717 14:103531000-103531022 CCCTCCCACCCAGACACCCCAGG - Intronic
1122754281 14:103965551-103965573 CCCTCCCTCCCAGTCTCACCTGG - Exonic
1124018157 15:25895941-25895963 GCGTCCAAGTCAGACTCACATGG + Intergenic
1124401593 15:29353350-29353372 CCTTCCCAGGCAGACACACAGGG - Intronic
1125862087 15:43008758-43008780 CAGACTCAGCCAGACTCACATGG + Intronic
1127489702 15:59450958-59450980 AGGTCCCACCCACACTCAAAGGG + Intronic
1129462273 15:75705314-75705336 TAGTCCCACACAGACTCACGGGG + Intronic
1129521547 15:76189577-76189599 CCCTTCCTCCCAGACTCTCAGGG - Intronic
1131864991 15:96698773-96698795 CCTTCCCACTCAGACTCAAAAGG - Intergenic
1132457009 16:29622-29644 CCGGCTCCCCCAGACTCAGAGGG - Intergenic
1137704661 16:50526326-50526348 CCGTCGCACCCAGGCTGCCAGGG + Intergenic
1137717636 16:50608476-50608498 CACCCCCACCCAGAGTCACAAGG - Intronic
1138782700 16:59808284-59808306 CCCTCACACCCACACCCACAGGG + Intergenic
1138928488 16:61621910-61621932 CTGTCACACCCAGAAGCACAAGG - Intergenic
1139640374 16:68287412-68287434 CTTTCCCACCCAGACTCCCAAGG - Intronic
1141717729 16:85736367-85736389 CAGGCCCACCCAGGCGCACAAGG + Intronic
1142046787 16:87930601-87930623 CCTCCCCACCCAGCCTGACAGGG - Intronic
1142428625 16:90013910-90013932 CCGCCCCACCCAGTATCACACGG - Intronic
1143306573 17:5952294-5952316 AGATCCCACCCACACTCACATGG + Intronic
1143620423 17:8077132-8077154 CAGTCCCACTCAGAATCACTGGG + Exonic
1144504372 17:15817509-15817531 CGGTCACATCCAGACTCACCAGG + Intergenic
1144634128 17:16893177-16893199 CGGTCACATCCAGACTCACCAGG + Intergenic
1145168226 17:20633018-20633040 CGGTCACATCCAGACTCACCAGG + Intergenic
1145200201 17:20938097-20938119 CGGTCACATCCAGACTCACCAGG + Intergenic
1146164315 17:30575987-30576009 CGGTCACATCCAGACTCACCAGG + Intergenic
1147160586 17:38567496-38567518 GCATCCCACCCAGACTCCCCAGG - Intronic
1147656652 17:42094969-42094991 CAGACCCACCCTGACACACATGG - Intergenic
1152069505 17:78127939-78127961 CGGCCCCACCCAGCCTAACACGG + Intronic
1153503033 18:5768230-5768252 CTGTCCCAATCAGACTCACTTGG - Intergenic
1154235295 18:12599861-12599883 AGGTCCCACCTAGACTCAAAGGG - Intronic
1157414742 18:47492695-47492717 CAGGCCTACCCTGACTCACATGG - Intergenic
1157750643 18:50175084-50175106 AGGTCCCACCCAGCCTCTCAGGG + Intronic
1158155590 18:54422371-54422393 ACTTCCCACCCAGTCTCAAAAGG - Intergenic
1161421656 19:4179192-4179214 GCGGCCCACGCAGACCCACATGG - Exonic
1161578513 19:5067818-5067840 CCGTGCCACCCGGGCACACAGGG + Intronic
1161620268 19:5293667-5293689 CGGTCCCACCCAGACTGGGAGGG - Intronic
1162341113 19:10092007-10092029 CCCTCCTCCCCAGACTCTCATGG + Intronic
1163607458 19:18282732-18282754 CCACCCCACCAATACTCACAAGG + Intergenic
1164453918 19:28391088-28391110 CCGCCCCACTCAGCCTCCCAAGG + Intergenic
1164574645 19:29398606-29398628 ACCTCCCACCCACACTCACCTGG + Intergenic
1164880087 19:31725604-31725626 TCCTCCCACCCAGTCTCCCAAGG - Intergenic
1165305731 19:35001354-35001376 ACGTCACACTCAGACACACAGGG - Intronic
1167423095 19:49415224-49415246 CCCTCCCAGCCACACACACAGGG + Intronic
1167958158 19:53084654-53084676 GCAACCCACTCAGACTCACAAGG + Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
927812794 2:26189372-26189394 CCATCTCACCCAGAACCACAGGG + Exonic
931640519 2:64377077-64377099 CTGTACAAACCAGACTCACAGGG + Intergenic
933716264 2:85363185-85363207 GGGTCCCACCCAGACTCCAAGGG - Intronic
935810714 2:106794469-106794491 CAGTCTTACCCAGACCCACATGG + Intergenic
936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG + Intronic
936062305 2:109303117-109303139 CCGTCCGCCTCAGCCTCACAAGG + Intronic
938792379 2:134688285-134688307 CCCTCCCACCAAGACACAAATGG + Intronic
948633002 2:239313912-239313934 CCTCCCCACGCACACTCACAGGG - Intronic
949031292 2:241798697-241798719 CCGTCCCATACAGTCTCCCAGGG + Intronic
1168805335 20:669451-669473 CAGTCTCTCCCAGACTCCCAAGG + Intronic
1169826193 20:9771514-9771536 CCCTCCCACTCAGCCTCCCAAGG + Intronic
1170576501 20:17665953-17665975 CCTTCCCCCACAGACTCAGATGG + Intronic
1171342322 20:24440095-24440117 TGGTCCCACCCAGATTCAAAGGG + Intergenic
1172445366 20:34990518-34990540 CCGTCCCTCCCAGAGCCCCAGGG - Intronic
1172611146 20:36253345-36253367 CAGGCCCACCCAGAGACACAGGG - Intronic
1173780170 20:45749369-45749391 CCTACCCATCCAGACTCACCTGG - Intronic
1174195864 20:48772406-48772428 ACGTCTCACCCAGTGTCACAGGG - Intronic
1174823342 20:53746337-53746359 GTGTCCCACCCAGACCCACATGG - Intergenic
1175698043 20:61117183-61117205 CAGTCCCACCCACACTCACCAGG + Intergenic
1176129616 20:63491132-63491154 TCGCCCCGCCCACACTCACAGGG - Intronic
1178792326 21:35711964-35711986 CCTTCCCACACAGCCTCACAAGG - Intronic
1179067537 21:38040075-38040097 AGGTCCCACCCAGACTCAAAGGG - Intronic
1179312155 21:40206174-40206196 CAGGCACACACAGACTCACACGG - Intronic
1179909263 21:44439271-44439293 CGGTCCCACCCAGCTTCACCAGG + Intronic
1183373520 22:37449143-37449165 CCATCCCAGCCAGCCTCCCAGGG - Intergenic
1185376800 22:50486472-50486494 CTGCCCCACCCAGAATCACGGGG + Intergenic
949535884 3:4995799-4995821 CCCTCCCACCCAGTCACACTAGG - Intergenic
950014590 3:9746706-9746728 GGCTCCCACCCAGACTCAGATGG + Intronic
953384076 3:42495559-42495581 CAGGCCCACCCACACTCACAGGG - Intronic
954464442 3:50646279-50646301 CTGTCCCAGCCTGACTCACCTGG + Intronic
955015532 3:55065556-55065578 CCTTCCCACTCAGTCTCCCAAGG - Intronic
965640940 3:170828410-170828432 CCATGTGACCCAGACTCACATGG + Intronic
967224820 3:187281328-187281350 CCTTCCCACCCAGGCCCATAGGG - Intronic
968310098 3:197675936-197675958 CAGTTCCTCCCAGACACACAGGG + Intronic
968449267 4:667487-667509 CCGTCCCTCCCACACACACACGG - Intronic
969492148 4:7505510-7505532 CAATGCCACCCAGACTCACTGGG - Intronic
969833542 4:9818791-9818813 CCATCCCACACACACTCACAAGG - Intronic
970793650 4:19888700-19888722 CTCTCCCACCCATACTCACTTGG + Intergenic
971982394 4:33769398-33769420 CCTTCCCACTCATCCTCACATGG - Intergenic
976583159 4:86763801-86763823 TCCTCCCACCCAGCCTCCCAAGG - Intronic
977809834 4:101346526-101346548 GCGTCCCACCCAGCCTCACTTGG - Intronic
979637932 4:122978395-122978417 CCGACTCAGCCAGACTCACTGGG - Intronic
980219363 4:129895528-129895550 TCCTCACACCCAGACTCTCAGGG - Intergenic
982306352 4:153935217-153935239 CCACCACACCCAGTCTCACAGGG + Intergenic
985249101 4:188005361-188005383 CCTTCCCTCCCAGCCTCAGAAGG - Intergenic
985398451 4:189569481-189569503 GCTTTCCACCCAGACACACAAGG - Intergenic
985425660 4:189828104-189828126 CCCTCTCACCCAGCCTCACGGGG + Intergenic
986252774 5:6075904-6075926 CCCTCCCAACCAAACACACATGG + Intergenic
987828522 5:23064423-23064445 CCTACTCACTCAGACTCACAGGG + Intergenic
988484384 5:31656411-31656433 CCTTCCCTCCCAGACTCAGCTGG + Intronic
988936363 5:36086979-36087001 CCACCCCACCCCAACTCACAGGG + Intergenic
995538275 5:113159034-113159056 CGCTCCCACCCAAAATCACATGG - Intronic
996854939 5:127995282-127995304 CAGTCCCACCCAGAGCCTCAGGG + Intergenic
997250801 5:132387159-132387181 CCCTCTCACCCACACCCACATGG - Intronic
997508439 5:134436705-134436727 CATTTCCACCCAGACTCACATGG - Intergenic
999732797 5:154487872-154487894 CCATCCCACCCTGCCTCACAGGG + Intergenic
1000234844 5:159347858-159347880 AAGTCCCACCAAGACTCCCAAGG + Intergenic
1007401802 6:41606956-41606978 CGGGACCACCCAGACTAACATGG + Intergenic
1007501363 6:42300225-42300247 CTGTCCCACACAGAGTCATAAGG - Intronic
1018906950 6:168081051-168081073 CCTTCCCACCCAGAGTCTCAGGG + Intronic
1019162897 6:170080880-170080902 CCGCCCCACCGCCACTCACACGG - Intergenic
1019167327 6:170107308-170107330 ACCTCCCACCCAAACTCACATGG + Intergenic
1019352058 7:558991-559013 CCGTCCCAGCCAGGTTCCCATGG + Intronic
1019505626 7:1389065-1389087 CCTTCCCAGCCAGCCTCACACGG - Intergenic
1019754845 7:2761390-2761412 CTGTGCCACACAGACTCCCAAGG + Intronic
1022444248 7:30456720-30456742 CTGCCCCACCCAGCCTGACAAGG - Exonic
1023939329 7:44759883-44759905 CCGGCGCACCCAGGCTCCCAGGG - Intronic
1024456853 7:49618137-49618159 GGGTCCCACCCACACTCAGAAGG - Intergenic
1024480569 7:49857682-49857704 CATTCCCACCAAGAGTCACAAGG - Intronic
1026863589 7:73809614-73809636 CCTTCCCACCGTCACTCACACGG - Intronic
1027129525 7:75581198-75581220 CCGTCTAACCCAGGCTCTCATGG - Intronic
1027999912 7:85480733-85480755 TGGTCCCACCCAGAATCTCATGG - Intergenic
1033233709 7:139621639-139621661 CCACCCCACCCAGACTAAAAGGG - Intronic
1035297362 7:157874642-157874664 CCGTGCCACCCAGCAGCACAAGG + Intronic
1035404663 7:158589115-158589137 CCTTCACACCCAGACGCCCAGGG + Intergenic
1035533822 8:375871-375893 CCGTCCCACTCAGCCCCACCTGG - Intergenic
1035699296 8:1626258-1626280 CCGTCCAACCCACACCCAGAGGG - Intronic
1035699336 8:1626426-1626448 CCGTCCAACCCACACCCAGAGGG - Intronic
1037741586 8:21613027-21613049 CCGTCCCTTCCAGGCTCACACGG + Intergenic
1039329724 8:36523879-36523901 CCTCCCCACCCAGACTCCAAGGG + Intergenic
1040580313 8:48693590-48693612 CCGCCCCACCCCAGCTCACAGGG - Intergenic
1044636740 8:94332731-94332753 CCCTCCCACCCAACCTTACATGG + Intergenic
1048194538 8:132321529-132321551 CCTTCCCACACAGACACACAAGG + Intronic
1048511184 8:135064233-135064255 CCGCCCCAGCCACACACACATGG - Intergenic
1049659406 8:143813011-143813033 CAGCCCCACCCTGACTCACCGGG + Exonic
1053196909 9:36126610-36126632 CAGACCCACCCAGGCTCACCTGG - Intergenic
1056816548 9:89805962-89805984 GAGTCCCACCCAGTCTCCCAAGG - Intergenic
1057016578 9:91657657-91657679 ACGTCCCACCCAGCAGCACAGGG + Intronic
1057231400 9:93323775-93323797 CCGGCCCACACAGCCTCACTGGG - Intronic
1058634065 9:107019414-107019436 CCGTCCCACTCTTACTCACTTGG - Intergenic
1061128926 9:128696055-128696077 TTATCCCACCCAGATTCACATGG - Exonic
1062060017 9:134490218-134490240 CCCAACCACCCTGACTCACAAGG - Intergenic
1062539630 9:137035825-137035847 CCGGCCCACCCAGCCACCCAGGG + Exonic
1062677754 9:137757811-137757833 CGCACCCACCCAGACGCACAGGG - Intronic
1187163661 X:16786251-16786273 CCGATCCGCGCAGACTCACACGG + Intergenic
1190260593 X:48794410-48794432 CCGCCTCAGCCAGCCTCACATGG - Intergenic
1192562928 X:72139382-72139404 TCGTCCCACCCAGATGCTCAGGG + Exonic
1195659024 X:107360436-107360458 CACTCCCACTCAGACTCACTAGG - Intergenic
1200399352 X:156010104-156010126 CCGGCTCCCCCAGACTCAGAGGG + Exonic