ID: 1105708106

View in Genome Browser
Species Human (GRCh38)
Location 13:22981365-22981387
Sequence AGGTCTGAGCAGAGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105708100_1105708106 1 Left 1105708100 13:22981341-22981363 CCTCATCCAGGAATCCAGGGCTG 0: 1
1: 0
2: 2
3: 28
4: 272
Right 1105708106 13:22981365-22981387 AGGTCTGAGCAGAGGGTCCCTGG 0: 1
1: 0
2: 4
3: 41
4: 347
1105708102_1105708106 -5 Left 1105708102 13:22981347-22981369 CCAGGAATCCAGGGCTGCAGGTC 0: 1
1: 0
2: 2
3: 48
4: 398
Right 1105708106 13:22981365-22981387 AGGTCTGAGCAGAGGGTCCCTGG 0: 1
1: 0
2: 4
3: 41
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105708106 Original CRISPR AGGTCTGAGCAGAGGGTCCC TGG Intergenic
900160156 1:1219566-1219588 GGGGCTGAGCAGAGCTTCCCAGG + Intronic
900791526 1:4684027-4684049 GGGAGTGAGCAGAGGGCCCCGGG + Intronic
900892391 1:5458728-5458750 AGGTTTGCTCAGAGGGACCCAGG + Intergenic
901024511 1:6271983-6272005 AGCTGTGAGCCGAGCGTCCCGGG - Intronic
901876029 1:12167466-12167488 GGGGCTGAGCAGCGGGTCCTGGG + Intronic
902599214 1:17529753-17529775 AGGAATGATCAGGGGGTCCCTGG + Intergenic
902728361 1:18352136-18352158 AGGCCTCAGCAGAGGGGCACAGG - Intronic
902987014 1:20161047-20161069 GGGTCTGAGCAGAGAGTGCCAGG + Intergenic
903016511 1:20365531-20365553 GTGGCTCAGCAGAGGGTCCCAGG + Intergenic
903296090 1:22343881-22343903 AGGGCAGAGCAGAGAGCCCCGGG + Intergenic
903776520 1:25797565-25797587 GGATTTGAGCAGAGGGACCCGGG - Intergenic
904495004 1:30881615-30881637 AGGCCTGAGCATCAGGTCCCAGG + Intronic
905281996 1:36855199-36855221 AGGTCTGAGTAGTGGGAGCCTGG + Intronic
905663442 1:39746515-39746537 AGGTTAAAGCAGAGGGTCTCTGG - Intronic
905914487 1:41675332-41675354 ATGTACGAGCAGAGTGTCCCAGG - Intronic
906033474 1:42737246-42737268 AGGTCTGAGCAGAGAGTTTGGGG - Intronic
906147736 1:43569876-43569898 AGGGCTGAGCGGAGGGTACCTGG + Intronic
907243029 1:53091081-53091103 AGGTCTGAGCAGCAGGGCCCTGG + Intronic
912331688 1:108826066-108826088 AGGTGTAATCGGAGGGTCCCTGG - Intronic
912524454 1:110270793-110270815 AGGTCTGAACACAGGATGCCTGG + Intronic
913597543 1:120393273-120393295 AGGTCAGTGAAGAGGGTCCCAGG - Intergenic
914089787 1:144486041-144486063 AGGTCAGTGAAGAGGGTCCCAGG + Intergenic
914308823 1:146448175-146448197 AGGTCAGTGAAGAGGGTCCCAGG - Intergenic
914512504 1:148346315-148346337 AGGTCAGTGAAGAGGGTCCCAGG + Intergenic
914593285 1:149124956-149124978 AGGTCAGTGAAGAGGGTCCCAGG + Intergenic
914945681 1:152063399-152063421 AGATCAGAGCCGAGAGTCCCAGG - Intergenic
915282331 1:154830956-154830978 AGGTCTGGGCAGAGGGGAACTGG + Intronic
915604187 1:156940398-156940420 GGGTCCCAGCAGAGGGTCCAAGG - Exonic
916676330 1:167066814-167066836 AGGCCGGAGCACCGGGTCCCCGG + Intronic
917894948 1:179478536-179478558 AGGGCACAGCAGAGGGACCCTGG + Intronic
918856874 1:189766869-189766891 AGTTATGAGCAAAGGGTCCGGGG - Intergenic
919937883 1:202266616-202266638 TGTGCTGAGCAGAGGGTCCTGGG - Intronic
920512806 1:206563325-206563347 AGTTATGAGCAGAGCTTCCCAGG - Intronic
922271724 1:224041808-224041830 AGATCTGAGAAGGGGCTCCCTGG - Intergenic
922729556 1:227942568-227942590 AGGGCTGAGAGGAGGGGCCCTGG - Intronic
1063457509 10:6194657-6194679 AGGTCTAAGCTGAGGATCCCAGG + Intronic
1065326043 10:24551637-24551659 ACCTCTGAGAAGAGAGTCCCAGG + Intergenic
1067479705 10:46586956-46586978 AGGTCAGAGCACCAGGTCCCTGG - Intronic
1067615032 10:47754841-47754863 AGGTCAGAGCACCAGGTCCCTGG + Intergenic
1068285087 10:54923238-54923260 AGTGCAGAGCAAAGGGTCCCTGG + Intronic
1068428812 10:56905867-56905889 AGGGGTGAGCAGTGGGGCCCAGG + Intergenic
1070450862 10:76555583-76555605 AGGACAGAGCAGATGCTCCCTGG - Intronic
1070960601 10:80497783-80497805 AGGACTGTGCAGAGGGCTCCAGG - Intronic
1071630436 10:87214807-87214829 AGGTCAGAGCACCAGGTCCCTGG + Intergenic
1072816040 10:98510380-98510402 AGATCTGAGCAGAGGATTCAGGG - Intronic
1073453566 10:103623360-103623382 GGGTCTGAGCAGAGGGTGCAGGG - Intronic
1074535515 10:114325895-114325917 AGGTCTCCCCAGTGGGTCCCAGG + Intronic
1074910403 10:117903277-117903299 AGGTCTGAGTAGCAGGTCACAGG - Intergenic
1075584143 10:123644981-123645003 AGGTCTGAGAAGAGGGCCTAAGG - Intergenic
1075714512 10:124548345-124548367 AGCTCTGGGCAGGGGGTTCCGGG - Intronic
1076839424 10:133038746-133038768 GGGTCTGAGCAGTGGGTCCCTGG + Intergenic
1077300070 11:1842695-1842717 AGATCTGAGCACAGGGACCTTGG - Intergenic
1077332740 11:1990506-1990528 AGCTCTGAGCATATGGACCCAGG - Intergenic
1077420190 11:2446370-2446392 ATGTCTGGGTAGAGGCTCCCAGG - Intronic
1077727454 11:4689135-4689157 AGGTCTGAGAACAAAGTCCCAGG + Intronic
1078184039 11:9036515-9036537 ATGGCTGAGCAGAGGGGCTCTGG - Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083652037 11:64209454-64209476 AGGCAGGAGAAGAGGGTCCCAGG + Intronic
1083882158 11:65554043-65554065 AGATCTCAGCAGAAGGTACCAGG - Exonic
1084489207 11:69469196-69469218 AGGTCTGGGCAGGGGCTCCGGGG + Intergenic
1084636960 11:70398930-70398952 AGCTCTGAGGGGAGGGTCCCTGG + Intronic
1084637028 11:70399089-70399111 GGGTCTGAGCGGAGGGGGCCGGG + Intronic
1084723623 11:70925876-70925898 AGGTGTGACCAGAGGCTCTCAGG - Intronic
1085154096 11:74277434-74277456 ACATCTGAACAGAGGGACCCGGG + Intronic
1087914804 11:103797752-103797774 AGGTCTTAGCAGAGAGTACTAGG - Intergenic
1088695470 11:112362452-112362474 AGGCCTGAGCAGAGTGTGCGAGG + Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088897939 11:114092025-114092047 AGGACTGAGCAGAGGGGCCGAGG + Intronic
1090653690 11:128826635-128826657 AGGGGTCAGCAGAGGGGCCCAGG + Intergenic
1091300736 11:134506002-134506024 AGGTCTGAGCAAAGGGCCATGGG + Intergenic
1202815723 11_KI270721v1_random:45682-45704 AGCTCTGAGCATATGGACCCAGG - Intergenic
1091831068 12:3551525-3551547 AGGGCTGAGCATGGTGTCCCTGG + Intronic
1092076903 12:5681448-5681470 AGGCCAAAGCAGAGTGTCCCAGG + Intronic
1092086696 12:5768615-5768637 AGGGCTGAGGAGAGGGGCCCAGG - Intronic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1096193517 12:49634605-49634627 AGGCCTGGGCAGAGGGAGCCAGG + Intronic
1096332804 12:50729141-50729163 AGGTCTGAGATGAGGTTCCCTGG - Intronic
1097191107 12:57220103-57220125 GGGTCATAGGAGAGGGTCCCAGG + Intronic
1098757816 12:74388077-74388099 AGGTCTTATCTGCGGGTCCCTGG + Intergenic
1099437823 12:82664870-82664892 AAGTCTGATCAGTGGCTCCCTGG - Intergenic
1100780344 12:98018966-98018988 AGGTCTGAGGTCAGAGTCCCAGG + Intergenic
1101364198 12:104056314-104056336 AGGTCTGAGAAGAGGTTCTGGGG - Intronic
1103340067 12:120216416-120216438 AGGTATAAGCTGAGGGCCCCAGG + Intronic
1104068578 12:125326093-125326115 GGGTTTGTGCAGAGGCTCCCTGG - Intronic
1104762367 12:131305174-131305196 AGGTGTGAGTAGAGGGTCGCTGG - Intergenic
1104817409 12:131655622-131655644 AGGTGTGAGTAGAGGGTCGCTGG + Intergenic
1104948935 12:132429992-132430014 AGGTGTGCGCAGAGGTTCCCAGG - Intergenic
1105618310 13:22041317-22041339 AGGTTTGAGCAGCGGGGCACTGG + Intergenic
1105708106 13:22981365-22981387 AGGTCTGAGCAGAGGGTCCCTGG + Intergenic
1105846730 13:24300033-24300055 AGGACAGAGCAAAGGGTCCCAGG - Intronic
1106173448 13:27308645-27308667 AGGTCTGAGTAGCGGGGCACTGG - Intergenic
1109448971 13:62483659-62483681 AGGCCTCAGCTGAGGGTCCATGG - Intergenic
1109784597 13:67156865-67156887 AGGTCTGAGCAGTGGGGCACTGG + Intronic
1110355495 13:74562181-74562203 TGGTCCCAGGAGAGGGTCCCAGG - Intergenic
1112999011 13:105610456-105610478 AGGTGTGAGAAGAGGGTGTCGGG - Intergenic
1113390727 13:109893882-109893904 ATGTCTGAGCACTGGGTCCCAGG + Intergenic
1113794252 13:113047801-113047823 AGGTGTGAGCAGAGGGGACGGGG - Intronic
1113871871 13:113564769-113564791 AGGTCTGACGGGAGGGTCCGTGG - Intergenic
1113871955 13:113565083-113565105 GGGTCTAAGAAGAGGGTCCAAGG - Intergenic
1113872055 13:113565501-113565523 GGGTCTGAGCCGAGGGTCTGAGG - Intergenic
1114600781 14:23953989-23954011 AGGTCTGAGGACAGGGGCACCGG - Intronic
1114605010 14:23989148-23989170 AGGTCTGAGGACAGGGGCACTGG - Intronic
1114610460 14:24036701-24036723 AGGTCTGAGGACAGGGGCACTGG - Intergenic
1117375576 14:55115609-55115631 AGGCCTGAGCAGTGAGTGCCTGG + Intergenic
1118815855 14:69313416-69313438 GGGTCTGAGCAGAGACTGCCTGG + Intronic
1119429613 14:74557913-74557935 AGGCCTGAGCAGAGGCTTCCAGG - Intronic
1120827565 14:88969383-88969405 AGGTCAGAGCAGTGGGTTGCTGG + Intergenic
1121109552 14:91303282-91303304 GGGTCTCAGGAGAGGGTCTCAGG - Intronic
1121271132 14:92638985-92639007 ATCGCTGAGCAGAGGTTCCCTGG + Intronic
1122129084 14:99594687-99594709 TGGGCTGAGCTGAGAGTCCCAGG - Intronic
1122341043 14:101028668-101028690 AGGTCTGAGAAGAAAATCCCAGG - Intergenic
1123510278 15:20991884-20991906 AGGCCTGAGAAGAAGGTCCTGGG + Intergenic
1124345020 15:28916483-28916505 AGGTGGGAGCAGAGGGGGCCTGG - Intronic
1124962432 15:34409025-34409047 AGGTGGGAGCAGAGGGGGCCTGG - Intronic
1124979056 15:34555247-34555269 AGGTGGGAGCAGAGGGGGCCTGG - Intronic
1125475828 15:40047517-40047539 AGCGCTGAGCTGAGAGTCCCGGG + Intergenic
1125597833 15:40899013-40899035 AGATCTGAGGAGGGGGTCTCTGG + Intronic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1127639447 15:60901988-60902010 AGGTGTGAGCTGAGGCACCCTGG - Intronic
1128087354 15:64895212-64895234 GAGTCTGTGCAGAGGGTGCCTGG - Intronic
1129322212 15:74781810-74781832 AGACCTGAGGAGAGGGGCCCAGG + Intergenic
1129661291 15:77554440-77554462 AGGGCAGAGGAGAGGGACCCAGG + Intergenic
1130085787 15:80777834-80777856 AGGACTGGGGAGAGGGGCCCTGG + Intergenic
1130856082 15:87841221-87841243 AGCTCTCAGCAGAGAGGCCCTGG + Intergenic
1131112811 15:89776208-89776230 AAGTCTGGGCAGGGGGCCCCTGG - Intronic
1132214302 15:100051332-100051354 AGGTCAGAGCTGTGGGGCCCTGG + Intronic
1132240943 15:100256657-100256679 AGGTCTGGCCAGAGGGATCCTGG + Intronic
1132599994 16:769077-769099 GGGCCTGAGCAGGGGGGCCCGGG - Intergenic
1132614085 16:831784-831806 AGCTCTGACCAGCGGGTGCCTGG + Intergenic
1132655748 16:1041072-1041094 AGGTGTGAGCTGGGGGTCTCAGG - Intergenic
1132655756 16:1041099-1041121 AGGTGTGAGCTGGGGGTCTCAGG - Intergenic
1132655764 16:1041126-1041148 AGGTGTGAGCTGGGGGTCTCGGG - Intergenic
1132655811 16:1041280-1041302 AGGTGTGAGCTGGGGGTCTCGGG - Intergenic
1132655820 16:1041307-1041329 AGGTGTGAGCTGGGGGTCTCGGG - Intergenic
1132931286 16:2460391-2460413 AGGTCTGGCCAGTGGGTCCGGGG - Intronic
1135110955 16:19690523-19690545 AGGTTTGAGGAGAGGGTGACAGG + Intronic
1136091132 16:27920815-27920837 AGGGCTGAGCAGAGGCAACCAGG + Intronic
1136280502 16:29206231-29206253 AGGTCTGCAGAGAGGGCCCCTGG + Intergenic
1137272584 16:46912053-46912075 AGCTGTGAGAAGAGGGTCTCTGG + Intronic
1138069734 16:53981044-53981066 AGGTGTGAGCCAAGGTTCCCAGG - Intronic
1138300104 16:55918968-55918990 AGGTCTGAGCAGAGGATCTATGG + Intronic
1138658522 16:58504110-58504132 ATGGCTGAGCAGAGGGGCCGGGG - Intronic
1138747565 16:59381197-59381219 ATGCCTGAGCAGAAGGTCTCTGG - Intergenic
1138824717 16:60305109-60305131 ATGTCTGAGCATAGAGTCTCAGG - Intergenic
1138862763 16:60778048-60778070 AGGGCTGAGCAAAGGTTCCTAGG - Intergenic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139706942 16:68747314-68747336 AGGAGGGAGGAGAGGGTCCCAGG + Intronic
1139965356 16:70742243-70742265 AGGCCTGGGCAAAGGGTCCCTGG - Intronic
1141875228 16:86819661-86819683 TGGTTTGAGAAGAGGCTCCCTGG + Intergenic
1142084869 16:88172190-88172212 AGGTCTGCAGAGAGGGCCCCTGG + Intergenic
1142227864 16:88886198-88886220 AGGTCCGAGCAGAGGGGGCCTGG + Intronic
1142627713 17:1203215-1203237 CGGTGTGAGCAGAGGATCCTGGG + Intronic
1143030293 17:3963926-3963948 AGGACCGCGCAGAGGGTGCCAGG + Intronic
1143606512 17:7989959-7989981 AGCTCTAAGCAGCGGGCCCCGGG + Intergenic
1144029424 17:11306169-11306191 AGGTCTGAGTTCAGGATCCCTGG + Intronic
1144872085 17:18377894-18377916 GGGACTGAGCAAAGGCTCCCAGG + Exonic
1145781448 17:27566427-27566449 GGGCCTGAGCCCAGGGTCCCCGG - Intronic
1146913446 17:36662980-36663002 AGGTATGGGCAGAGAGACCCTGG + Intergenic
1146915614 17:36676514-36676536 AGGTCTGAGCAGAGTGCTCCTGG - Intergenic
1147635821 17:41963206-41963228 AGGTATCTGCAGAGGGTCTCAGG - Intronic
1147756746 17:42773574-42773596 AGGGCTGAGCCCAGGGTCCGGGG - Intronic
1147876931 17:43628414-43628436 AAGTCTGAGCAGAGAGTCTCTGG - Intergenic
1147960884 17:44166998-44167020 AGGACTGAGCAGGGGGACCGGGG - Intergenic
1148857019 17:50584429-50584451 AGGGCTGGGAAGAGGGTCCCTGG + Intronic
1149901200 17:60481077-60481099 AGGTCTGAAAAGAGGGCCCGTGG - Intronic
1151749204 17:76027168-76027190 GGGGCTGAGCAAAGGCTCCCAGG - Exonic
1151758383 17:76087517-76087539 TGTGCTCAGCAGAGGGTCCCTGG - Intronic
1152367256 17:79863424-79863446 AGGTCTGAGCTGAGCATGCCGGG + Intergenic
1152544360 17:80993313-80993335 AGGTCTCAGTGGAGGGTCACAGG - Intronic
1152757275 17:82092288-82092310 AGGTCTGAGCAGAGGCACTGAGG - Intronic
1152845552 17:82597483-82597505 AGGTCTCAGCAGAGGCTCGGAGG - Intronic
1153612432 18:6899819-6899841 AGGCCAAAGCAGAGGTTCCCTGG + Intronic
1153773321 18:8432771-8432793 AGGGCTGAGCAGAGGCTGCTGGG - Intergenic
1154434826 18:14335380-14335402 AGGTCTTGGCCCAGGGTCCCTGG + Intergenic
1155075484 18:22350230-22350252 CTGTCTGAGTAGAGGGTTCCAGG - Intergenic
1155308100 18:24498687-24498709 AGGGCTGCGGAGAGGGTCTCTGG + Intergenic
1158856569 18:61548675-61548697 GGGTCTGAGCTCAGCGTCCCAGG + Intronic
1160474298 18:79168249-79168271 GAGTCTGAGCAGGGGGTCCGTGG + Intronic
1160659727 19:292278-292300 AGCCCTGAGCTGAGGGTGCCTGG + Intergenic
1160721082 19:597149-597171 GGGTCAGAGCAGAGGGGCCTAGG - Intronic
1161411686 19:4121534-4121556 AGGGCAGAGCAGGGGGTCCTAGG - Intronic
1161455943 19:4369763-4369785 GGAGCTGAGCAGAGGGACCCGGG - Intronic
1161943773 19:7421834-7421856 ACTTCTGAGCAGAGGGTCCTGGG + Intronic
1162793957 19:13077182-13077204 AGGTCTGGGCACAGGAGCCCAGG - Intronic
1163268145 19:16233771-16233793 AGGGCTGAGCAGAGGCAGCCTGG - Intronic
1163797918 19:19347926-19347948 AGGGCTGAGGAGGGGATCCCGGG - Intronic
1164539923 19:29114651-29114673 GGGTCTGGGCAAAGGCTCCCTGG - Intergenic
1164593325 19:29518019-29518041 CCCTCTGAGCAGAGGGTCCAAGG + Intergenic
1164932619 19:32187055-32187077 AGGTGTGAGCACAAGGTCACTGG - Intergenic
1165062917 19:33213646-33213668 AGGTCTGGGGACAGGGACCCTGG - Intronic
1166503127 19:43355434-43355456 AGGTCTGGGTAGAGGCACCCAGG - Intronic
1166507327 19:43379324-43379346 AGGTCTGGGTAGAGGCACCCAGG + Intergenic
1167203774 19:48086229-48086251 AGTTCTGAGCACAGGCTGCCTGG + Intronic
1167713067 19:51124289-51124311 AGGACTGAGCAGAGGGACATGGG - Intergenic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1167769056 19:51502372-51502394 AGGACTGAGCAGAGAGACACGGG + Intergenic
1168599945 19:57709349-57709371 AGGTTGGTGCAAAGGGTCCCCGG - Intronic
925679093 2:6398249-6398271 AGGCCTGAGCAGACTGGCCCAGG - Intergenic
927220500 2:20703709-20703731 AGGTTAGAGCAGAAGGTCTCAGG - Intronic
927485536 2:23486171-23486193 AGGCCACAGCAGAGGGTCCTGGG + Intronic
928432594 2:31233464-31233486 AGGCATGAGCAGAGGGTCATGGG - Intronic
929120013 2:38476750-38476772 AGGGCTGAGCCCAGGATCCCAGG + Intergenic
932697585 2:73969614-73969636 AAGTCTGAGGAGAGAGTCCAGGG - Intergenic
933653082 2:84864801-84864823 AGGCCTAAGGAGAGGATCCCGGG - Intronic
934491208 2:94762929-94762951 AGGTCTCAGCCCAGGCTCCCTGG - Intergenic
934562989 2:95322870-95322892 TGCTCTGAGCAGAGGGGCACAGG - Intronic
934968154 2:98740993-98741015 AGGACAGAGCAGAGGGGCCAGGG + Intergenic
936012391 2:108933401-108933423 AGGTGGGAGAAGGGGGTCCCAGG + Intronic
936261116 2:110960138-110960160 AGGTCTGAGGGGAGTGTTCCAGG + Intronic
937933012 2:127220079-127220101 GGGGCCGAGCCGAGGGTCCCCGG - Intergenic
937989638 2:127655022-127655044 AGGCTGGAGCAGTGGGTCCCAGG + Intronic
941613526 2:167692145-167692167 AGGTGTGAGCAAATGGTACCTGG - Intergenic
943211374 2:184971986-184972008 AGTTCTGATCCCAGGGTCCCTGG + Intergenic
943784521 2:191862344-191862366 AGGTCTGAGGAGTCAGTCCCAGG + Intergenic
945133598 2:206601255-206601277 AGGTCTGACCAAAGCTTCCCAGG - Intronic
948536712 2:238652291-238652313 AGGCAGGAGCAGAGGGGCCCCGG - Intergenic
948556650 2:238816189-238816211 AGATCTGACCAGAGGGACCAAGG - Intergenic
948659643 2:239499104-239499126 AGGCCAGAGCAGATGGCCCCTGG - Intergenic
949082993 2:242120145-242120167 TGGTCTGGGCAGGGGGTTCCTGG + Intergenic
1169167181 20:3434085-3434107 AGGACTGAGAAGTGGGTCCAGGG - Intergenic
1169236064 20:3930866-3930888 AGGTCTGAGCTGAGGGATACAGG - Intronic
1169379815 20:5096632-5096654 TGGCCTGGGCAGAGGGTGCCAGG + Intronic
1170808887 20:19658154-19658176 AGACCTCAGCAGAGGGGCCCTGG + Intronic
1171383533 20:24751753-24751775 AGGTGTGAGCTGGGGCTCCCAGG + Intergenic
1172009295 20:31837115-31837137 AGGACTGAGCAAGGGTTCCCAGG + Intergenic
1172361332 20:34314702-34314724 AGGTCAGAGCAGAGAGTCCAAGG + Intergenic
1174110380 20:48194326-48194348 GGGTCTCAGCAGAGGGGCCCAGG + Intergenic
1174146264 20:48454856-48454878 ATGTCTGAGCAGATGGGCCTGGG - Intergenic
1174171409 20:48620186-48620208 GGGTCTCAGCAGAGGGGCCCAGG - Intergenic
1174514075 20:51077786-51077808 AGGTCTGAGCAGAAGTGCCAGGG - Intergenic
1175201813 20:57283310-57283332 AGGGCTGAGCAAAGGGCCGCCGG - Intergenic
1175943053 20:62546702-62546724 AGCACAGACCAGAGGGTCCCGGG - Intergenic
1176093754 20:63330220-63330242 AGGTGTGGGGACAGGGTCCCAGG + Intronic
1176127474 20:63482420-63482442 ACGTCTGGGCAGGGGGTCCAGGG + Intergenic
1176148337 20:63575285-63575307 TGGTCTGCGGAGAGGCTCCCTGG - Intergenic
1177849859 21:26333363-26333385 AGCCCTGAGGAGAGAGTCCCAGG + Intergenic
1178352622 21:31883708-31883730 ATTTCTGAGGAGAGGGTCCATGG + Intronic
1179423994 21:41258398-41258420 AGGTCTGAGTTGAGGCTTCCAGG - Intronic
1179654637 21:42837672-42837694 CGCTGTGAGCAGAGGGGCCCGGG - Intergenic
1179780186 21:43694633-43694655 AGGCCTGAGCAGAGCGTGGCTGG - Exonic
1180183936 21:46130304-46130326 AGGACTGAGCAGAGAATCCCAGG + Intronic
1180245749 21:46546167-46546189 AGGCCTGAGTCGGGGGTCCCCGG + Intronic
1180673980 22:17574432-17574454 TGGTGTGAGCAGAGGGTTCAGGG - Intronic
1180714009 22:17859226-17859248 AGATCAGAGCAGCAGGTCCCTGG - Intronic
1180800641 22:18630362-18630384 TGGTCTGAGCAGAGGGCCAGGGG + Intergenic
1180840818 22:18958089-18958111 AGATCGGCCCAGAGGGTCCCTGG - Intergenic
1180851873 22:19025919-19025941 TGGTCTGAGCAGAGGGCCAGGGG + Intergenic
1180980284 22:19875217-19875239 AGACCTAGGCAGAGGGTCCCAGG + Intergenic
1181060669 22:20280685-20280707 AGATCGGCCCAGAGGGTCCCTGG + Intronic
1181221078 22:21364900-21364922 TGGTCTGAGCAGAGGGCCAGGGG - Intergenic
1181963330 22:26638757-26638779 AGGACTGAACACAGGGTCCAGGG + Intergenic
1182014052 22:27024197-27024219 AGGTCTTTCCAAAGGGTCCCAGG + Intergenic
1182425424 22:30269048-30269070 AGATCTGAGCAGAGGGGTCTAGG + Intergenic
1183173310 22:36203974-36203996 AGGTCTGAACAGAGGGACAGAGG + Intronic
1183178052 22:36238785-36238807 AGGTCTGAACAGAGGGACAGAGG + Intronic
1183488570 22:38104399-38104421 AAGTCAGAGCAGATGGTCCCAGG + Intronic
1183727070 22:39596106-39596128 AGGTCAGAGCAGAGTGAGCCAGG + Intronic
1183730301 22:39614734-39614756 AGGTCGGAGTAGAGGGTGCTGGG + Intronic
1183748836 22:39707635-39707657 AAGCCTGAGCAGGGGGTGCCTGG - Intergenic
1183929470 22:41227757-41227779 AGAGATGAGAAGAGGGTCCCTGG - Intronic
1184561795 22:45268207-45268229 AGGTCTGAGCGGAGGGGCAGGGG - Intergenic
1184954298 22:47873442-47873464 AGGTCTGGGGAGAGGTGCCCAGG - Intergenic
1185210264 22:49566750-49566772 AGCCCTGAGCACAGGGTCGCTGG + Intronic
950426615 3:12927901-12927923 AGGGTTGAGCACAGGGACCCTGG + Intronic
950451954 3:13070492-13070514 AGGTCTGAGCAGCAGGTGCTGGG + Intronic
950536967 3:13584395-13584417 AGGTCTGGGCAGAGAGAGCCTGG - Intronic
953462249 3:43090766-43090788 AGATCTGAGCTGAGGATCTCAGG - Intronic
953553615 3:43924341-43924363 ATGCCTGAGGAGAGGGTCACTGG - Intergenic
954364002 3:50136818-50136840 AGCTCTGAGCAGAGGTTCTGGGG + Intergenic
954644792 3:52124548-52124570 ATGACAGAGCAGAGGCTCCCAGG + Intronic
956787652 3:72655859-72655881 AGGCCTGGGCAGAGAGCCCCAGG - Intergenic
956836371 3:73099505-73099527 GGTTCTCAGCAGATGGTCCCTGG + Intergenic
956894847 3:73649012-73649034 AGCCCTGGGCAGAGGGCCCCTGG + Intergenic
960543126 3:118882505-118882527 AGTGCTGAGCAGAGGAACCCAGG - Intergenic
962316270 3:134361394-134361416 AGATCTAAGCAGGGGCTCCCGGG + Intronic
963870494 3:150409591-150409613 AGGTTTGGGGAGACGGTCCCGGG - Exonic
964135116 3:153337056-153337078 AAGTATGAGGAGAGGGTCACAGG + Intergenic
967405336 3:189109444-189109466 AGGTGGGAGCAGAGGTTGCCAGG - Intronic
967478969 3:189952747-189952769 AGGTCTGATGAGAGAGGCCCAGG + Intergenic
967830303 3:193912875-193912897 AAGTCTGAGCAGAGGCTCAAAGG - Intergenic
967990509 3:195126804-195126826 AGGTCAGAGCAGAGGGCCCCTGG - Intronic
968091466 3:195900836-195900858 AGGGCTGGGCAGAGGCTGCCCGG + Intronic
968492624 4:898361-898383 AGGCCTAGGCAGAGGGGCCCTGG + Intronic
968569780 4:1333586-1333608 AGGTCTGAGCACAGGGTGCCTGG - Intronic
968909687 4:3471348-3471370 AGGTCAGAGCAGGGATTCCCAGG + Intronic
968970542 4:3791377-3791399 ACGTCTGGCCAGAGGGTACCAGG - Intergenic
969390713 4:6889731-6889753 AGGCCTGAGCAGAGAGCCCGGGG - Intergenic
970154021 4:13123168-13123190 AGTTCTGGGCGGAGGCTCCCGGG - Intergenic
970254016 4:14148031-14148053 AGGTCTGGGCAGAGGTCCCAAGG + Intergenic
971089725 4:23327317-23327339 AGGTATGTGCACAGGGTTCCTGG - Intergenic
972209777 4:36823328-36823350 AGTTCTGAGCACAGGCTGCCTGG + Intergenic
972699903 4:41483651-41483673 AGACCTGAGCACAGGGTTCCCGG - Intronic
973943860 4:55937756-55937778 AGGCCTGAGGTCAGGGTCCCTGG - Intergenic
974282023 4:59807482-59807504 AGTTCTGAGCACAGGCTGCCTGG + Intergenic
978429589 4:108619787-108619809 TTTTCTGAGAAGAGGGTCCCTGG - Intergenic
981065628 4:140481765-140481787 AGATCTGAGCAGTGGTTGCCAGG + Intronic
985160927 4:187043855-187043877 AGGGGTGAGCAGGGGGTCACAGG + Intergenic
985241501 4:187935536-187935558 AGTTCTGAGAAGAGTGTCCAGGG + Intergenic
985682768 5:1265201-1265223 AGGCCAGAGCAGAGGCTACCGGG - Intronic
987864688 5:23524184-23524206 AGGAATGAGCAGAAGGTTCCCGG + Intronic
994273526 5:97809192-97809214 AGGCCTGGGCAGAGTGTCACTGG - Intergenic
995538058 5:113157234-113157256 AGGTCAGAGGAGATGGTGCCTGG - Intronic
998138540 5:139687279-139687301 AGCTCAGAGCAGAGGGTCAAAGG - Intergenic
998761143 5:145433616-145433638 ACCTCTGAGGAGAGGGTACCTGG - Intergenic
1001093745 5:168760596-168760618 TGGGGTGAGCAGAGGGTCCAGGG + Intronic
1002100190 5:176853769-176853791 AGGTCTGAGCCCAGAGTCCCAGG - Intronic
1002691703 5:181054442-181054464 GGGTCTGTGCAGAGGGTCTCGGG - Intronic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1004965645 6:20847906-20847928 AGGTCTGAGCAGTGGCTCAAGGG + Intronic
1005349637 6:24921514-24921536 AGGTCTGGGGAGAGTGTTCCAGG - Intronic
1006367240 6:33622716-33622738 AGTCCTGAGCTGAGGGTGCCAGG - Intronic
1007496062 6:42260964-42260986 AGGAGGGGGCAGAGGGTCCCAGG + Intronic
1007649990 6:43413299-43413321 AGTTCTTAGCAGAGAGGCCCTGG - Intergenic
1009624917 6:66126813-66126835 AGCTCTGAGCACAGGCTGCCTGG - Intergenic
1010988304 6:82450966-82450988 AGGTCTGGGAAGAGGAGCCCTGG - Intergenic
1013639409 6:112058654-112058676 GGGTCTGGGCAGAATGTCCCAGG + Intronic
1015309172 6:131746482-131746504 AGTTCTGAACAGAGGAGCCCTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019053391 6:169201763-169201785 AGGGCCTAGCAGAGGGGCCCTGG + Intergenic
1020259742 7:6524397-6524419 AGTTCTGAGCAGATGGTTACAGG + Intronic
1022200056 7:28108014-28108036 AGGTCTGATCAGTGGGCCTCTGG - Intronic
1023402202 7:39798398-39798420 TGGTCTGGGCAGGGGGTTCCTGG + Intergenic
1023845374 7:44117266-44117288 AGGCCTGAGCAGGGAGCCCCAGG + Intronic
1024533205 7:50409927-50409949 TGGGCTGAGCAGATGGGCCCTGG + Intergenic
1024647418 7:51382262-51382284 TGGTCTGGGCAGGGGGTTCCTGG - Intergenic
1025051252 7:55736757-55736779 TGGTCTGGGCAGGGGGTTCCTGG - Intergenic
1025128214 7:56362433-56362455 TGGTCTGGGCAGGGGGTTCCTGG - Intergenic
1025695197 7:63771072-63771094 TGGTCTGGGCAGGGGGTTCCTGG + Intergenic
1026989461 7:74575447-74575469 AGTTCTGAGCAGAGGGTAACAGG + Intronic
1028907874 7:96175191-96175213 AAGGGTGAGCAGAGGTTCCCCGG + Intronic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1032052716 7:128658791-128658813 TGGTCTGGGCAGGGGGTTCCTGG + Intergenic
1032190429 7:129762464-129762486 ACGGCCGAGCTGAGGGTCCCTGG + Intergenic
1033407842 7:141088034-141088056 AGGCCTGGGCTGAAGGTCCCAGG + Intronic
1035167957 7:157002819-157002841 AGGTCTACGCAGGGGGACCCCGG - Intronic
1035969700 8:4234146-4234168 AGGACTGAGCACAGATTCCCAGG + Intronic
1036548879 8:9799579-9799601 AGATTTGGGGAGAGGGTCCCAGG + Intergenic
1037924144 8:22831608-22831630 ATGTGTGTGCAGAGGGTCCAAGG + Intronic
1038670578 8:29579884-29579906 TGGTCTGAGCACAGGCGCCCTGG + Intergenic
1039434904 8:37553372-37553394 AGGTCTCAGCAGTGGGGCCTTGG - Intergenic
1040105098 8:43537264-43537286 AGGTCTCAGCCCAGGCTCCCTGG + Intergenic
1040105250 8:43537920-43537942 AGGTCTCAGCCCAGGCTCCCTGG - Intergenic
1040947662 8:52901048-52901070 AGGTCTGAGCAGTGCTTCCCAGG - Intergenic
1045254303 8:100506834-100506856 AGGTCTGAGCAGACTGATCCAGG + Intergenic
1045864541 8:106850224-106850246 AGGTCTGAACACAGGATGCCTGG + Intergenic
1047342383 8:123994545-123994567 AGTTCTGAGCAGAGACTGCCTGG - Intronic
1048554682 8:135463208-135463230 ACGTCTGAGCACAGGGCCCTTGG + Intronic
1048930503 8:139311574-139311596 AGGGCTCAGGTGAGGGTCCCTGG + Intergenic
1049023595 8:139973810-139973832 GGGTCTGTGGAGAAGGTCCCTGG - Intronic
1049272346 8:141702643-141702665 AGGTCTGGGCAGAGTGCCTCAGG - Intergenic
1049292308 8:141810902-141810924 GGGGCTGAGCAGAGAGCCCCGGG + Intergenic
1049379552 8:142305229-142305251 AGCTGTGGGCAGAGGGTGCCAGG + Intronic
1049386740 8:142346734-142346756 AGGTCGGCACAGTGGGTCCCAGG + Intronic
1049494258 8:142922388-142922410 GGGTCTAGGCTGAGGGTCCCTGG - Intergenic
1049731691 8:144181479-144181501 AGGGCTGAGGAGAGGGTGGCAGG - Intronic
1049748855 8:144274221-144274243 AGGGCTGTGGAGAGGGCCCCTGG - Intronic
1049805433 8:144536669-144536691 AGGTCTGTGCCAGGGGTCCCTGG - Intronic
1049861767 8:144903321-144903343 AGGTCTGAGGTGAAGGTCCTAGG - Intergenic
1050097426 9:2081360-2081382 TGGTCCCAGCAGAGTGTCCCTGG + Intronic
1051619938 9:19040380-19040402 AGGGCTGAGCACAGTGTCTCTGG + Intronic
1051683409 9:19631813-19631835 GTGTCTGGGCACAGGGTCCCAGG - Intronic
1052880554 9:33598940-33598962 AGGTCTCAGCCCAGGCTCCCTGG + Intergenic
1053005819 9:34603780-34603802 GGGTCTGTGCAGAGGGCCTCAGG - Intergenic
1053456616 9:38238046-38238068 AGGTGGGAGCAGAGGGTCACTGG - Intergenic
1054955773 9:70908182-70908204 TCGTATGAGCAGAGGCTCCCAGG + Intronic
1055985961 9:82056690-82056712 AGGTCTGAGGCCAGGCTCCCTGG - Intergenic
1056163476 9:83921067-83921089 AGCCCTGAGGAGCGGGTCCCGGG - Intronic
1056909163 9:90682496-90682518 AGGTGTGCACAGAGGATCCCAGG + Intergenic
1057444395 9:95103702-95103724 AGGTCAGAGAAGAGGATTCCGGG + Intronic
1059471832 9:114510896-114510918 AGGTGTGAGGTAAGGGTCCCAGG + Intergenic
1060666827 9:125436724-125436746 AGGCCTGGGTAGTGGGTCCCGGG - Intergenic
1060820307 9:126658060-126658082 AGGTCTTAGAAGAGGGGCCAAGG + Intronic
1061226860 9:129285405-129285427 ACCTGTGAGCAGAGGGTACCTGG - Intergenic
1061866462 9:133494028-133494050 AGGTCAGGGCAGAGGGGCACAGG + Intergenic
1062023147 9:134328552-134328574 AGGGCTGAGCAGAGAGCCCTGGG + Intronic
1062213967 9:135379072-135379094 ACTTCTGAGCAGGGGCTCCCGGG - Intergenic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062290440 9:135791980-135792002 AGGGCTGAGCAGGGGCTGCCCGG + Intronic
1062456935 9:136644419-136644441 GGGTCGGAGCACAGGGTCCCAGG + Intergenic
1186514173 X:10153933-10153955 AGTGCTGTCCAGAGGGTCCCAGG + Intergenic
1186595139 X:10972953-10972975 AGGTCAGAGCTGAGGATACCAGG - Intergenic
1187063811 X:15813357-15813379 AGGTCTGATCAGATGGTCTAGGG + Intronic
1189269360 X:39740119-39740141 AGGTCTGGGCCCAGGGCCCCGGG + Intergenic
1193964001 X:87961261-87961283 AGTTCTGAGCACAGGCTACCTGG + Intergenic
1195000856 X:100641948-100641970 ACGTCTGTGCAGAGGCTCCAGGG + Intergenic
1195699116 X:107689110-107689132 AGGTCTGAGGACAGAGTCCTGGG + Intergenic
1197653730 X:129093408-129093430 CCTTCTGAGCAGAGGTTCCCAGG - Intergenic
1197722857 X:129756580-129756602 AGGTCTGAGCAGAGACATCCAGG - Intronic
1197863008 X:130990044-130990066 AAGTGTGAGTAGAGGGTGCCGGG - Intergenic
1199817452 X:151411406-151411428 AGATCTGGGAAGAGGGTACCAGG - Intergenic
1202381966 Y:24281158-24281180 TGGTCTGGGCACAGGGTTCCTGG + Intergenic
1202488818 Y:25388967-25388989 TGGTCTGGGCACAGGGTTCCTGG - Intergenic