ID: 1105722962

View in Genome Browser
Species Human (GRCh38)
Location 13:23134852-23134874
Sequence GTCCCCACCACCAAGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105722962_1105722966 -3 Left 1105722962 13:23134852-23134874 CCCACTCTCTTGGTGGTGGGGAC 0: 1
1: 1
2: 4
3: 11
4: 122
Right 1105722966 13:23134872-23134894 GACATTGCTCTCTGGGCTTTTGG 0: 5
1: 0
2: 2
3: 21
4: 209
1105722962_1105722970 5 Left 1105722962 13:23134852-23134874 CCCACTCTCTTGGTGGTGGGGAC 0: 1
1: 1
2: 4
3: 11
4: 122
Right 1105722970 13:23134880-23134902 TCTCTGGGCTTTTGGTTTGGGGG 0: 3
1: 0
2: 5
3: 25
4: 295
1105722962_1105722969 4 Left 1105722962 13:23134852-23134874 CCCACTCTCTTGGTGGTGGGGAC 0: 1
1: 1
2: 4
3: 11
4: 122
Right 1105722969 13:23134879-23134901 CTCTCTGGGCTTTTGGTTTGGGG 0: 4
1: 0
2: 4
3: 23
4: 310
1105722962_1105722965 -10 Left 1105722962 13:23134852-23134874 CCCACTCTCTTGGTGGTGGGGAC 0: 1
1: 1
2: 4
3: 11
4: 122
Right 1105722965 13:23134865-23134887 TGGTGGGGACATTGCTCTCTGGG 0: 3
1: 1
2: 4
3: 22
4: 182
1105722962_1105722967 2 Left 1105722962 13:23134852-23134874 CCCACTCTCTTGGTGGTGGGGAC 0: 1
1: 1
2: 4
3: 11
4: 122
Right 1105722967 13:23134877-23134899 TGCTCTCTGGGCTTTTGGTTTGG 0: 5
1: 0
2: 2
3: 18
4: 269
1105722962_1105722968 3 Left 1105722962 13:23134852-23134874 CCCACTCTCTTGGTGGTGGGGAC 0: 1
1: 1
2: 4
3: 11
4: 122
Right 1105722968 13:23134878-23134900 GCTCTCTGGGCTTTTGGTTTGGG 0: 5
1: 1
2: 1
3: 21
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105722962 Original CRISPR GTCCCCACCACCAAGAGAGT GGG (reversed) Intergenic
902999430 1:20254501-20254523 TTCCCGAACACCAAGAGAGCAGG - Intergenic
906859378 1:49342520-49342542 GTCCCCACCATCCAGAGGGCAGG + Intronic
907288919 1:53400240-53400262 ATCACCACCATCAAGAGCGTGGG + Intergenic
909683736 1:78322076-78322098 GTCACCACCATCAAGAATGTAGG - Intronic
910179307 1:84463863-84463885 GACCCCAACACCAAGAGGCTAGG + Intergenic
911072193 1:93841073-93841095 CTCCCCACCACCAGCAGACTAGG + Intronic
915742295 1:158128120-158128142 GCCCACACCACCAAGAGAATTGG + Intergenic
917627296 1:176859329-176859351 GTCCCCATCACCAATGAAGTGGG - Intronic
1063429743 10:5977852-5977874 GTCCCCACTGCGAAGAGAGTGGG + Intronic
1065078560 10:22105025-22105047 ATCCCCACCACCCATAAAGTTGG - Intergenic
1067748047 10:48951328-48951350 GTTCACACCTCCAAGAAAGTGGG - Intronic
1069712304 10:70497459-70497481 GGCACCACCACCCAGAGAGTTGG - Intronic
1071393184 10:85195769-85195791 GTCCTGGTCACCAAGAGAGTAGG + Intergenic
1072771764 10:98146227-98146249 GTCCCCCCCACCAAAAAAATGGG - Intronic
1084455090 11:69263812-69263834 GCCCCCACCATGAAGAGACTGGG + Intergenic
1085833502 11:79928537-79928559 GTCCCCTCCATCAATACAGTCGG + Intergenic
1086752347 11:90512735-90512757 GTCCCTAACACTAAGAGAGAAGG + Intergenic
1091324040 11:134670856-134670878 CTCCCCTCCATCAAGAGCGTAGG - Intergenic
1095790512 12:46162022-46162044 TTCCCCACCCCCAACAAAGTTGG + Intergenic
1097681925 12:62657175-62657197 TTCCCCACCCCCATGAGAGAGGG + Intronic
1101505111 12:105338861-105338883 GACCCCACCCCCATGAGATTTGG + Intronic
1101687862 12:107043671-107043693 GACCCCACCATCAAGGGAGATGG - Intronic
1101740309 12:107495147-107495169 TTCCCCACTACCAAGGGAGAGGG - Intronic
1102088099 12:110160549-110160571 GTGCCCACCACATTGAGAGTGGG + Intronic
1102119540 12:110429618-110429640 GTCCCCACCACCAACGGAGTGGG + Intergenic
1104623146 12:130333294-130333316 GGCTCCACCACCAAGAGATCCGG + Intergenic
1105722962 13:23134852-23134874 GTCCCCACCACCAAGAGAGTGGG - Intergenic
1106620894 13:31369550-31369572 TTCCCCTTCACCAAGTGAGTTGG - Intergenic
1108949104 13:56064811-56064833 GCCCCCACCCCCAAAAAAGTAGG - Intergenic
1110588178 13:77220143-77220165 AGCACCACGACCAAGAGAGTGGG + Intronic
1113588623 13:111482904-111482926 GCCCCCACCATCATGAGAGTTGG + Intergenic
1117995226 14:61471712-61471734 GCCCCCACCCCCAACAAAGTAGG - Intronic
1118170745 14:63386314-63386336 TTCCTCACAACCAACAGAGTTGG + Intronic
1121314778 14:92954396-92954418 GTGGCCAGCTCCAAGAGAGTCGG + Intronic
1124187587 15:27543551-27543573 TTCCCCCCCACCAAAAAAGTGGG - Intergenic
1124515190 15:30361962-30361984 CTCCTCACCACCGAGACAGTTGG - Exonic
1124632740 15:31346760-31346782 GGCCCCACCACCAAGTGCCTGGG - Intronic
1124727732 15:32168767-32168789 CTCCTCACCACCGAGACAGTTGG + Exonic
1127367111 15:58301350-58301372 GTCCCGCACACCAACAGAGTAGG - Intronic
1127855049 15:62947257-62947279 GTCCCCTCCACCAAGTAAGTAGG - Intergenic
1128932457 15:71717754-71717776 CCCCCCACCACCATGAGAGGGGG + Intronic
1130024354 15:80258654-80258676 GTCCTTACCACAAAGAAAGTAGG - Intergenic
1130048782 15:80466242-80466264 GTCCCCATCAGGAACAGAGTTGG + Intronic
1136236061 16:28914401-28914423 GACCCCACCGCCAAGGGAGAAGG + Exonic
1136872524 16:33820516-33820538 GTGCCAATCACCAAGAAAGTGGG - Intergenic
1139338389 16:66249930-66249952 CTCTCCACCACCAAGAAAGGTGG - Intergenic
1140343065 16:74184454-74184476 GTCCCCACCACCTGGGGAGGAGG + Intergenic
1141939886 16:87268417-87268439 GTCACCACTATCAGGAGAGTTGG + Intronic
1203099648 16_KI270728v1_random:1295552-1295574 GTGCCAATCACCAAGAAAGTGGG + Intergenic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1147323683 17:39660353-39660375 GTGCCCCCCACCAAGAGGGAAGG + Intronic
1148757396 17:49980781-49980803 CTCTCCACCCCAAAGAGAGTGGG - Intergenic
1150158150 17:62871342-62871364 GCCCCCACCAGCAAAAGTGTTGG + Intergenic
1150230035 17:63544744-63544766 TTCCCTACCAGCAAGAGTGTGGG + Intronic
1152134820 17:78497638-78497660 GGCCCCATGACCAAGAGAATGGG - Intronic
1160512221 18:79459034-79459056 GGCCCCACCTCCAAGAGGGAAGG + Intronic
1161938865 19:7389800-7389822 ATTCCCACCACCCTGAGAGTGGG - Intronic
1163607602 19:18283590-18283612 GTCCTCATCACCAAGAGAGGTGG + Intergenic
1166811244 19:45515878-45515900 GTCCCCACCTCCAGGGCAGTGGG - Intronic
1167987454 19:53330806-53330828 GTCACCACTACCTGGAGAGTTGG + Intergenic
925079950 2:1056118-1056140 GTCCACACCACCAAGAGCACGGG + Intronic
925169187 2:1740585-1740607 GTCCAGACCACCAAGAGTGCAGG + Intronic
926305524 2:11635188-11635210 GCCCCCAGCACCTAGAGTGTGGG - Intronic
927972446 2:27314400-27314422 GTCCCCACAACAAAGAGTCTTGG + Intronic
935820426 2:106887424-106887446 GTCCCCAACCCCAAGAGGGACGG + Intergenic
937155817 2:119718032-119718054 GTCTTCAGCACCAAGGGAGTGGG + Intergenic
937657647 2:124394741-124394763 GTCTCCACCACAATGAGACTTGG - Intronic
941178506 2:162230753-162230775 GACCCCACCCCCCAGAGATTTGG - Intronic
941488277 2:166109855-166109877 CTCCCCACCACCCACATAGTAGG - Intronic
944699306 2:202231923-202231945 GTCACCACTATCTAGAGAGTTGG + Intronic
945011049 2:205464114-205464136 GTTTCCACCACCAAGAGGGCTGG - Intronic
946872201 2:224094246-224094268 GTCCCCATCACCATGGGAATGGG - Intergenic
947339895 2:229127216-229127238 GTCCCAGCCAGCAAGAGAGAGGG - Intronic
1168895235 20:1319581-1319603 TTCCCCACCACCAGGTGAGTGGG - Exonic
1169505086 20:6201456-6201478 GTCCTCTCCACAAAGAGATTGGG + Intergenic
1172024426 20:31938275-31938297 GTGCCCACCTCCTAGGGAGTGGG + Intronic
1172305598 20:33878073-33878095 TTCCCCACCTCAAATAGAGTCGG - Intergenic
1175784396 20:61703501-61703523 GTCCCCACCAACAAATTAGTGGG + Intronic
1178632736 21:34276888-34276910 GACCCCACCACAACGAGAATCGG - Intergenic
1179713537 21:43276154-43276176 GTCCCCACCACAGAGACAGCAGG + Intergenic
1179713544 21:43276186-43276208 GTCCCCACCACAGAGACAGCAGG + Intergenic
1179713567 21:43276281-43276303 GTCCCCACCACAGAGACAGCAGG + Intergenic
1180895601 22:19329766-19329788 GTCACCACCACCCAGTGTGTGGG - Intergenic
1181774689 22:25150704-25150726 CTCCCCACCGCCATGAGAGCTGG - Intronic
1181968212 22:26671336-26671358 GCCCCCACCAGCCAGGGAGTGGG - Intergenic
1184530111 22:45050011-45050033 GTCCCCACTAGAAAGAGAGAGGG - Intergenic
1184659797 22:45960505-45960527 GTCCCTGCCACCCAGAGAGCTGG - Intronic
957013476 3:75035310-75035332 GTGACAAGCACCAAGAGAGTGGG + Intergenic
957314080 3:78555187-78555209 CTCCCCACCACCCAGGAAGTTGG - Intergenic
961262676 3:125615274-125615296 GTGCCCACCACATTGAGAGTGGG - Intergenic
963380188 3:144520395-144520417 ACACCCACCACCAAGAGAGAAGG + Intergenic
967851540 3:194086367-194086389 GTCTCCTCCACCAAGCGACTGGG - Intergenic
973585403 4:52385215-52385237 GATCCCATCACCAAGATAGTGGG + Intergenic
974345499 4:60676261-60676283 CTCCCCTCCACTAAGAGACTTGG + Intergenic
975189014 4:71437881-71437903 CTGCCCACCAGCAAGAGAATAGG - Intronic
982350726 4:154412401-154412423 ATCCCCACCATCAAGACATTTGG + Intronic
985425136 4:189822620-189822642 GTCCCTACCACAAAAATAGTTGG + Intergenic
985538092 5:475553-475575 GTCCCCACCTGCAGGGGAGTCGG + Exonic
985894317 5:2739805-2739827 GTCCCGACCACCACGGGAGCAGG + Intergenic
987032145 5:13986075-13986097 GTGCCCACCAGCAAGAGACCTGG + Intergenic
988275819 5:29080026-29080048 GTCCCCACCCCCACGAGAGCTGG - Intergenic
990980788 5:61600942-61600964 CTCCACACCACCAGGAGATTGGG - Intergenic
991510018 5:67365843-67365865 GTCCCCTCCACCAGGACAATGGG + Intergenic
999046373 5:148474119-148474141 GTCCCAGCCAGCTAGAGAGTGGG - Intronic
1001350822 5:170962284-170962306 ATCCCCACCAGCAAGAGAGTAGG - Intronic
1002097130 5:176838053-176838075 GTCCCCACCACAAAGAATGGAGG - Intronic
1002188630 5:177467706-177467728 GTCCCCACCCCCAAGAGCGCTGG + Intronic
1002199951 5:177522148-177522170 GTCCCCATCACTAAGAGACCAGG + Intronic
1004278552 6:14259236-14259258 GTCCCCAGCAGCCAGAGACTGGG - Intergenic
1004974771 6:20952428-20952450 ATCCCCACCACCAATAGGGATGG + Intronic
1005607848 6:27493242-27493264 GTTCCCACAATCAAGAAAGTAGG - Intergenic
1006055411 6:31380231-31380253 GCCCCCATGACCAAGAGAGACGG + Intergenic
1006474378 6:34245203-34245225 GTCCCCACCACCAAGGGAGTGGG - Exonic
1012700730 6:102453332-102453354 GTCCTCTCCACAAAGAGACTGGG + Intergenic
1013985799 6:116191860-116191882 GTCCCCACCAACAAGGGAACAGG + Intronic
1015079434 6:129205773-129205795 GTCTCAACCACCAAAAGTGTTGG - Intronic
1015334294 6:132019689-132019711 GTCCCCACCACTGAGGGAGCAGG - Intergenic
1015519311 6:134114977-134114999 GTCCCCACCAACAAGGGAGTGGG + Intergenic
1018822221 6:167382614-167382636 CTCCCATCCACCAAGAGAGAAGG + Intronic
1019280444 7:197161-197183 CTCCCCACCACCCAGAAAGGGGG - Intronic
1022178853 7:27898842-27898864 GTTCACAACACCAAGAGAGGAGG - Intronic
1022503950 7:30899011-30899033 ATCCCCAAAACCAAGAGAGAGGG - Intergenic
1032182238 7:129690328-129690350 GTGCCAAGCAACAAGAGAGTGGG - Intronic
1039366583 8:36934402-36934424 GTACCCACCACCAAGACAATGGG + Intronic
1040683890 8:49847170-49847192 CTTCCCACCACCTGGAGAGTCGG - Intergenic
1041600757 8:59714755-59714777 GTCTCCACCATCAAGTGGGTGGG - Intergenic
1042648227 8:71010704-71010726 GTCTCCACTAGAAAGAGAGTGGG + Intergenic
1048589087 8:135804419-135804441 GTCTCCACCAACACCAGAGTAGG - Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056928213 9:90852952-90852974 GTCCCCTCCACCACGACACTGGG + Intronic
1057212066 9:93205810-93205832 GTCCCCAGCAGCAAGACATTCGG - Intronic
1057574880 9:96234316-96234338 GTCCCCAGCACCCCAAGAGTTGG + Intergenic
1062273585 9:135720623-135720645 GCCCCCAGCCCCAAGAGAGGCGG - Intronic
1187146145 X:16639062-16639084 GTCTCCACCACCCAGAGTGCTGG + Intronic
1187257668 X:17656737-17656759 GACCCCTCCACCCAGAGGGTAGG - Intronic
1188156489 X:26748674-26748696 GTCCCCACCACCAAAGGAGTGGG - Intergenic
1192634443 X:72804407-72804429 GTCCCCATCACCAAGAGCATGGG + Intronic
1192647267 X:72916394-72916416 GTCTCCATCACCAAGAGCATGGG - Intronic
1202594636 Y:26523796-26523818 GACCCCATTACAAAGAGAGTTGG + Intergenic