ID: 1105723145

View in Genome Browser
Species Human (GRCh38)
Location 13:23135623-23135645
Sequence ATGCTCTTCTTGGGGAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105723128_1105723145 10 Left 1105723128 13:23135590-23135612 CCTCCTGTTCTGCCCATGATCCC 0: 3
1: 3
2: 2
3: 14
4: 233
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
1105723126_1105723145 30 Left 1105723126 13:23135570-23135592 CCAGATGTTCATCCTCATTGCCT 0: 1
1: 3
2: 2
3: 14
4: 200
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
1105723131_1105723145 -3 Left 1105723131 13:23135603-23135625 CCATGATCCCCTCCCCCAAGATG 0: 1
1: 0
2: 2
3: 23
4: 283
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
1105723127_1105723145 18 Left 1105723127 13:23135582-23135604 CCTCATTGCCTCCTGTTCTGCCC 0: 5
1: 2
2: 2
3: 39
4: 487
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
1105723132_1105723145 -10 Left 1105723132 13:23135610-23135632 CCCCTCCCCCAAGATGCTCTTCT 0: 1
1: 0
2: 1
3: 41
4: 354
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
1105723130_1105723145 -2 Left 1105723130 13:23135602-23135624 CCCATGATCCCCTCCCCCAAGAT 0: 1
1: 2
2: 4
3: 21
4: 223
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263
1105723129_1105723145 7 Left 1105723129 13:23135593-23135615 CCTGTTCTGCCCATGATCCCCTC 0: 2
1: 3
2: 4
3: 10
4: 201
Right 1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG 0: 1
1: 0
2: 2
3: 29
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105723145 Original CRISPR ATGCTCTTCTTGGGGAGGAG GGG Intergenic
900216244 1:1483253-1483275 ATGCTGGTCTTGGGGTGCAGTGG - Intronic
901438932 1:9265840-9265862 TTGCTCTGCGTGGGGAGGTGGGG + Exonic
904016897 1:27428609-27428631 AGCCTCTCTTTGGGGAGGAGAGG + Intronic
904296119 1:29520894-29520916 CTGCTCCTCTTCTGGAGGAGGGG + Intergenic
904994247 1:34618579-34618601 ATGCTCTTCCTGAGGGGGCGGGG - Intergenic
905871232 1:41405695-41405717 ATGCTCTACCTGGGGAGGGGTGG + Intergenic
906246849 1:44282321-44282343 ATGCTCTGCTGGGGGAGCAGAGG + Intronic
908181337 1:61609345-61609367 TTGCTCTTATTAGGGAGGAATGG - Intergenic
910866256 1:91790902-91790924 ATACAGTGCTTGGGGAGGAGTGG - Intronic
912447632 1:109750092-109750114 ATGCTTTTATTGAGAAGGAGAGG + Exonic
912985413 1:114423688-114423710 ATGCGCTTCTTGGCTGGGAGTGG - Intronic
913699467 1:121360668-121360690 ATGCTTTTGGTGGGGAGGAGAGG - Intronic
914138078 1:144919368-144919390 ATGCTTTTGGTGGGGAGGAGAGG + Intronic
916011908 1:160713923-160713945 ATTCTCTTTTTTGGGGGGAGGGG + Intergenic
917129896 1:171730532-171730554 ATGCTCATCTTGATGAGGAGTGG + Intronic
917856596 1:179106134-179106156 GAGCTCTCCTTGGGGAGGATGGG + Exonic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
920345604 1:205303994-205304016 ATGCCCTTCTTGGGGAGCAGGGG + Exonic
920486876 1:206379376-206379398 ATGCTTTTGGTGGGGAGGAGAGG - Intronic
920581563 1:207113156-207113178 CTGCTGTTCTTGGTGAGTAGTGG + Exonic
921255729 1:213337646-213337668 ATGCTATTCTTGGTGATGACTGG + Intergenic
924573175 1:245256612-245256634 ATGCCCTTCGCGGAGAGGAGAGG - Intronic
1067773141 10:49141733-49141755 ATGCCATTCTTGTGGAGGAAAGG - Intergenic
1069417128 10:68210416-68210438 ATGCTCTTCTCGGAGTGTAGTGG + Exonic
1070740631 10:78900831-78900853 TCGCTCTTCTGGGGCAGGAGGGG + Intergenic
1070813162 10:79308415-79308437 GCTCTCATCTTGGGGAGGAGGGG + Intronic
1070832160 10:79424754-79424776 AGGCGCTCCTGGGGGAGGAGTGG - Intronic
1072661986 10:97368930-97368952 AGGCTTCTCTTGGGCAGGAGAGG + Intronic
1072736233 10:97881508-97881530 ATGCCCCTCTTGTGGAGGCGCGG + Intronic
1072948241 10:99829914-99829936 ATGCTCATCTTGGCCAGGCGTGG - Intronic
1073392902 10:103193571-103193593 AAGCTTTTCCTTGGGAGGAGAGG + Intergenic
1075754022 10:124796537-124796559 CTGCTCTTCTTGGTCAGGACTGG + Intergenic
1076413209 10:130266115-130266137 TTGCTGTTCTGGGGGAGGGGAGG - Intergenic
1077107342 11:847930-847952 ATGCTCTCCTTGGGGTGGCTCGG + Intronic
1077377036 11:2209931-2209953 AAGATCTGCCTGGGGAGGAGTGG - Intergenic
1077787566 11:5401154-5401176 GTTCTTTTCCTGGGGAGGAGAGG - Intronic
1078096180 11:8298579-8298601 CTCCTCCTCTTGGGGAGGAGTGG + Intergenic
1078152706 11:8772941-8772963 CAGCTCTTCTTTAGGAGGAGGGG - Intronic
1078534045 11:12159210-12159232 TTCTTCTTCTAGGGGAGGAGGGG + Intronic
1079109924 11:17599703-17599725 AGACTCTGCGTGGGGAGGAGGGG - Intronic
1079402619 11:20118118-20118140 ATGTTCATCTAGGGGAAGAGTGG - Exonic
1079528104 11:21414963-21414985 ATGCTTTTTTTGGGAGGGAGGGG - Intronic
1079869592 11:25780971-25780993 ATGCTCAGCTTGGGGTGGGGTGG - Intergenic
1080017888 11:27526519-27526541 ATGCTTTTTCTGGGGAGGGGAGG + Intergenic
1081940269 11:46935810-46935832 TTGCTCTTCTTGAGGGAGAGGGG - Intergenic
1083203607 11:61134294-61134316 TTGCTCACCTTGGGGCGGAGAGG + Intronic
1085524818 11:77158024-77158046 CTGCTCTTCATGGGAAGAAGGGG + Intronic
1087113542 11:94497906-94497928 GATCTCTTTTTGGGGAGGAGAGG - Intronic
1087137379 11:94734648-94734670 ATGCTCCCCTGGGAGAGGAGGGG + Intronic
1088969251 11:114757709-114757731 TTGGTCTTCATGGGGAAGAGTGG + Intergenic
1089279807 11:117365918-117365940 ATGTGCTTCTTTGGGGGGAGTGG + Intronic
1089347149 11:117797595-117797617 ATGCTCCTCCTGGGGAGGGTGGG - Intronic
1091339006 11:134795781-134795803 ATTATCTTCTGGAGGAGGAGAGG + Intergenic
1091545768 12:1500509-1500531 AGGCTGTGCTCGGGGAGGAGCGG - Intergenic
1092202486 12:6594692-6594714 CTGCTCTATTAGGGGAGGAGGGG - Intronic
1092821010 12:12353549-12353571 ATTCTTTTCTTGGGGAGGGCAGG - Intergenic
1093235325 12:16603416-16603438 ATGTTCTTCTGGTGGAAGAGGGG - Intronic
1094218857 12:27972426-27972448 TTTCTCTTTTTGTGGAGGAGAGG - Intronic
1094765359 12:33588392-33588414 ATGCTTTTCTTGGTAAGGAATGG - Intergenic
1095319259 12:40806210-40806232 TTGGCCTTCATGGGGAGGAGGGG - Intronic
1095824451 12:46516730-46516752 AGGAGCTTCTTGGGGAGGAGTGG - Intergenic
1097054142 12:56239953-56239975 ATGTGTTTCTTGGGGTGGAGGGG - Exonic
1099128346 12:78794765-78794787 ATTCTCTTCTGGGGAAGCAGGGG + Intergenic
1100453603 12:94731016-94731038 ATGCTCTTCCTGGGGATGGGTGG - Intergenic
1102679750 12:114683362-114683384 ATGCACTTCAAAGGGAGGAGGGG + Exonic
1103896131 12:124274474-124274496 AGGCCCTTCTGGGGGAGGGGAGG + Intronic
1104295124 12:127505015-127505037 ATTCTCTGCATGGGCAGGAGGGG - Intergenic
1105475587 13:20725738-20725760 ATGCACTTTTCTGGGAGGAGGGG - Intergenic
1105529094 13:21202049-21202071 ATGCTCTTCTTGTGGTAGTGAGG - Intergenic
1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG + Intergenic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1108299826 13:49061923-49061945 AGGCTCTTCTTGGAGAAGAATGG + Intronic
1108557239 13:51605813-51605835 ATGTTCTCCTTGGGGACGAATGG + Intronic
1110002929 13:70228949-70228971 TTTCACTTCATGGGGAGGAGGGG - Intergenic
1112800803 13:103107995-103108017 ATGCTATTCTTTGGAAAGAGGGG - Intergenic
1113950357 13:114068154-114068176 ATGCCCATCTCGGGGAGAAGGGG - Intronic
1114490226 14:23095756-23095778 AGGCTTTTTTTGGGGAGGGGCGG + Intronic
1115731835 14:36277707-36277729 TGGCTTTTCTTGTGGAGGAGTGG + Intergenic
1116506009 14:45682159-45682181 CTTTTCTTCTTTGGGAGGAGAGG - Intergenic
1121462560 14:94093097-94093119 ATGCCCTTCTTGGAGATGTGAGG + Intronic
1122065099 14:99167525-99167547 ATGCTCATCTCGGGGAGATGGGG - Intergenic
1122703867 14:103608145-103608167 ACGATCATCTTTGGGAGGAGAGG - Intronic
1125060211 15:35410971-35410993 CTGCTTTTCTAGGTGAGGAGGGG - Intronic
1126191691 15:45885393-45885415 AGGCTGTGCTGGGGGAGGAGTGG - Intergenic
1126405070 15:48315204-48315226 AGGCTCTCTTTTGGGAGGAGTGG - Intergenic
1126612231 15:50541240-50541262 ATGATCTTCTCCGGGAGTAGTGG + Exonic
1127369011 15:58318848-58318870 ATGTTCTCCTCGGTGAGGAGTGG - Intronic
1127673719 15:61220492-61220514 ATGCCAGTCATGGGGAGGAGTGG - Intronic
1129410422 15:75347815-75347837 ATCCTAGTTTTGGGGAGGAGCGG - Intronic
1129411142 15:75350982-75351004 ATCCTCTTCACGGTGAGGAGGGG + Intronic
1130026992 15:80278547-80278569 AGGCTGTTCATGGGGATGAGGGG + Intergenic
1131048005 15:89328450-89328472 CCGCTCTTCTTGGAGAGGTGAGG - Exonic
1134396162 16:13865625-13865647 ATGCTCATCATGGGGGTGAGTGG + Intergenic
1134438653 16:14284294-14284316 ATCCTTTTTTTGGGGGGGAGGGG - Intergenic
1136632913 16:31499520-31499542 TTGCTCCTGTTGGGGAGGAGAGG + Exonic
1137615427 16:49843658-49843680 TTTCTCTCCTTGGGGAGGGGAGG - Intronic
1139547400 16:67656137-67656159 TTGCTCTCCTTGGGGAGGAAGGG + Intronic
1140685933 16:77434384-77434406 AGGCCCTTCTTGGGGATGGGGGG + Intronic
1141223395 16:82092270-82092292 CTTCTCCTCTTGGGGTGGAGGGG - Intronic
1141438994 16:84017134-84017156 GTGCTCTTCCTGGGGAGGTGAGG - Exonic
1141836306 16:86542042-86542064 ATTCTCTTCTGAGGGAGCAGGGG - Intronic
1142139148 16:88464926-88464948 ATTCTTATCTTCGGGAGGAGTGG - Intronic
1143799948 17:9370500-9370522 GTGATCTTCTTAGGGAGGTGGGG - Intronic
1144642682 17:16946290-16946312 CTGCTCTTCTTGGGGCTGATTGG - Intronic
1146471942 17:33131709-33131731 ATGGTCCTCTTGGAGAGGACAGG - Intronic
1146686204 17:34843131-34843153 CTGCTCTTCCTTGGAAGGAGGGG + Intergenic
1147159124 17:38560417-38560439 ATGCGCTCCCTGGGGAGGAAGGG + Exonic
1147302068 17:39537600-39537622 TTGCTCTTCTTGGAGTGCAGTGG + Intronic
1147731522 17:42606632-42606654 ATGCTGTTCTTTTTGAGGAGGGG - Intronic
1152350403 17:79781046-79781068 AGGCTCTTCTGGGGGCGGGGGGG + Intronic
1154389837 18:13926985-13927007 ATGCTCTTCTTACTGAGGAAAGG + Intergenic
1156197919 18:34796906-34796928 ATGCTATTCTTGGGGAGCTATGG - Intronic
1156394897 18:36690554-36690576 AGGTTCTTCTGGGGCAGGAGGGG + Intronic
1156480449 18:37433164-37433186 AGTCACTTCTTGGGGAAGAGGGG - Intronic
1156803399 18:41146240-41146262 AGGCTTTTCTTGGTGGGGAGGGG - Intergenic
1157827020 18:50821629-50821651 TTTCTGTTCATGGGGAGGAGGGG - Intronic
1159390576 18:67787835-67787857 ATGCTCTTATCTGGGAGGGGAGG + Intergenic
1160041592 18:75350361-75350383 ATGCTCCTCGTGGCGAGGTGGGG + Intergenic
1160510154 18:79448953-79448975 ATGCTGTTCTCCGGCAGGAGTGG - Exonic
1161074554 19:2279005-2279027 AGGATCTTCTTGGGCAGGGGTGG + Exonic
1163739546 19:19002880-19002902 ATGCTCTTCTTGGGGGGAGGTGG - Intronic
1164623666 19:29713045-29713067 AGGCTCTTGTTGGGGAAGAAAGG + Intronic
1166510934 19:43408208-43408230 ATGCGCTTCCGGGGGTGGAGAGG + Intronic
1166804750 19:45479047-45479069 ATTCTCTTTCTGCGGAGGAGTGG + Intergenic
1167091730 19:47349069-47349091 TGGCTATGCTTGGGGAGGAGAGG + Intergenic
1167209080 19:48121922-48121944 ATGCTCTCCCTTTGGAGGAGTGG - Intronic
1167555773 19:50194442-50194464 ATGATCCTCTTGGGGTGGGGGGG + Intronic
1168369479 19:55820172-55820194 AGGCTCCTTTAGGGGAGGAGAGG - Intronic
925827245 2:7861537-7861559 ATGTTTTTGTTGGGGAGAAGAGG + Intergenic
926220776 2:10934310-10934332 ATGCTCTGCTTGGAGAGGGCAGG + Intergenic
927553700 2:24018461-24018483 ATACTCTTTGTGGGGAAGAGGGG + Intronic
928410139 2:31048364-31048386 AGGCTCCTCATGGGGAGAAGTGG - Intronic
930019693 2:46994097-46994119 ATGCTCCTCTTGTCTAGGAGAGG + Intronic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
930536793 2:52653674-52653696 AAGGTCTTCTTGGGGAAGAATGG + Intergenic
931187537 2:59968011-59968033 TGGCTCAACTTGGGGAGGAGAGG + Intergenic
931666173 2:64610805-64610827 CTGGTCTGCTTGGGGAGGATGGG + Intergenic
931701500 2:64912991-64913013 ATGCCCTTCTTGGGGTGGCTAGG + Intergenic
931940888 2:67251063-67251085 AACCTCTCCTTTGGGAGGAGTGG + Intergenic
932067200 2:68577355-68577377 ATGCTGTTCTTGTGGCAGAGGGG + Intronic
932294978 2:70616631-70616653 CTGCCCTGCTTGGGGAGCAGTGG - Intronic
935949875 2:108318977-108318999 ATGCTCTTCCTGGGAAGGACAGG - Intergenic
938804212 2:134791112-134791134 AAGTTCTTCTTGGCCAGGAGTGG - Intergenic
939993265 2:148896345-148896367 CAGCTTTTCCTGGGGAGGAGTGG + Intronic
942457208 2:176146684-176146706 ATGCTCTTAAGGGGGAGGAGAGG - Intergenic
946274792 2:218623022-218623044 CTGCCCTCCTTTGGGAGGAGTGG - Intronic
947208756 2:227686315-227686337 GTGCTCTTTTTTGGGAGGAGGGG + Exonic
947231910 2:227896389-227896411 TTTCTCTTGTTGGGGAGGTGAGG + Intronic
948484592 2:238272368-238272390 AGGGGCTTCCTGGGGAGGAGAGG + Intronic
948816482 2:240512889-240512911 CCGCCCTTCCTGGGGAGGAGGGG - Exonic
1169144551 20:3243858-3243880 TCGCTGTTCCTGGGGAGGAGAGG + Intergenic
1170737041 20:19021601-19021623 ATGCTCATCTGGGTAAGGAGAGG - Intergenic
1171239395 20:23552614-23552636 ATACTCTTGTTGGGGAGCGGGGG - Intergenic
1172159514 20:32856588-32856610 AGGCACTTCTTGGCCAGGAGTGG - Intergenic
1172185448 20:33028451-33028473 ATGAGCTTCTTGGGGAGGCTTGG - Intergenic
1173001385 20:39108415-39108437 ATGCTAGTCTTGGGGCAGAGCGG + Intergenic
1173825254 20:46043952-46043974 ATCCTATTCTGGGGGAGGGGTGG + Intronic
1175407104 20:58742393-58742415 CTGCTCTGCTTGGGGATGGGAGG - Intergenic
1176907681 21:14522964-14522986 ATGCACTTCTTTGGGATGTGGGG + Intronic
1178684114 21:34697836-34697858 AGGCTCTCCTTCAGGAGGAGTGG + Intronic
1179092491 21:38279784-38279806 ATGCTTGTCTTGGGGTTGAGAGG - Intronic
1180166504 21:46033461-46033483 GTGCTTTTATTGTGGAGGAGTGG - Intergenic
1180866773 22:19124274-19124296 ATGCCCTTGGTGGAGAGGAGGGG + Intergenic
1180990647 22:19933744-19933766 ATGCTGTTCTGTGGGAGGAAGGG + Intronic
1181419337 22:22786912-22786934 ATAGTCCTCTTGGGGAGGAGGGG - Intronic
1181575633 22:23792792-23792814 ATGCTCTGCTAGGGGAGGAGGGG - Intronic
1182441528 22:30367273-30367295 TTGCTCTTCTTGGAGTGCAGTGG + Intronic
1182586446 22:31346558-31346580 ATCCTCGTCTTGGTGAGGGGGGG - Intergenic
1183606641 22:38870467-38870489 ATGCTTCTCTTGGGGAGGGATGG - Intronic
1184201780 22:42974465-42974487 GTGCTCTTCCTGGTGAGTAGGGG + Intronic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
1185404853 22:50642019-50642041 AGGCTCTTCTCGGGAAGAAGGGG - Intergenic
949771882 3:7588023-7588045 ATGCTTTACTTGGGGAGGGAGGG - Intronic
950376196 3:12574329-12574351 ATCATTTTCTTGGGGAGAAGTGG + Intronic
950635171 3:14309017-14309039 CTGCTCTTCCTGGGGTGGAAGGG - Intergenic
950863267 3:16169198-16169220 ATGTTCTGCTTGGGTATGAGAGG - Intergenic
951371904 3:21859609-21859631 AGGCTCTTCACAGGGAGGAGAGG - Intronic
951811112 3:26701282-26701304 ATGCTCACCTGGGGGTGGAGTGG - Intronic
952590908 3:34952831-34952853 ATGCTTTTCTTTGGCTGGAGAGG - Intergenic
953272879 3:41462813-41462835 ATGCTCTCCTTGGTCAGGAGTGG + Intronic
953598436 3:44338873-44338895 ATGCTCCTCTAGGGGGGAAGCGG + Intronic
953855658 3:46497606-46497628 GTGCTCATGCTGGGGAGGAGAGG - Exonic
953933027 3:47015976-47015998 ATGCTTTTTTTGGGGGGGGGTGG - Intergenic
957567931 3:81908431-81908453 CTTCTCTTCTTGGGTGGGAGTGG + Intergenic
958263686 3:91412361-91412383 TTTCTCTTTTCGGGGAGGAGAGG + Intergenic
961745467 3:129061406-129061428 ATCCCCTGCTTGGGGATGAGAGG - Intronic
961796248 3:129411132-129411154 ATGCTCTCCTTGGGCTGGCGAGG + Intronic
963030156 3:140962629-140962651 ATTTTCTTCATGGGGAGAAGAGG - Intronic
964277863 3:155026727-155026749 TTGCTTTTCTGGGGGAGGTGGGG - Intronic
966745514 3:183271932-183271954 AAGACCTTGTTGGGGAGGAGTGG - Exonic
969707527 4:8820082-8820104 TTCCTCTTCTTGAGGAGCAGTGG + Intergenic
970550952 4:17180614-17180636 TTGCTAATCTTGGGGAGAAGAGG + Intergenic
970931236 4:21514815-21514837 ATGCTTTCCTTGGGAAGGAGTGG - Intronic
972365790 4:38373170-38373192 GTGCTCTTCTTGGACAGGAGAGG - Intergenic
975329826 4:73100221-73100243 ATACTCTTTGTGGGGAAGAGGGG + Intronic
975389868 4:73803209-73803231 ATTCTCATCTTGGGGACGGGAGG - Intergenic
975428540 4:74259429-74259451 ATGCTGGTGGTGGGGAGGAGTGG - Intronic
975716492 4:77210228-77210250 AGGCTCTTCCTGGAGAGGAAAGG + Intronic
978739646 4:112122157-112122179 ATGCTCCTCATGAGGAGGATTGG + Intergenic
978966661 4:114749519-114749541 GAGCTCTTCTTGGGGAAGAATGG - Intergenic
980767323 4:137323531-137323553 GTGCCATTGTTGGGGAGGAGAGG + Intergenic
982049189 4:151483294-151483316 ATGATCTTCTTGTGGGGGTGGGG + Intronic
984514840 4:180725363-180725385 ATGCTGTTCTTGGGGTGAAGAGG + Intergenic
984687576 4:182688380-182688402 GTGCTCTTCTCTGGGAGGAAGGG - Intronic
986622688 5:9692022-9692044 CTCCTCTTCATGGGGATGAGAGG - Intronic
986705722 5:10453203-10453225 ACGCTCCTCTGAGGGAGGAGAGG - Intronic
990825282 5:59892672-59892694 CTGCTCTGACTGGGGAGGAGGGG - Intronic
990996425 5:61736609-61736631 ATTCACTTCTTTGGGTGGAGAGG - Intronic
992906269 5:81349022-81349044 ATGCTATTGTTGGGAAGGAGGGG + Intronic
993043473 5:82841453-82841475 TTCCTCTTGTTGGGGAAGAGAGG + Intergenic
993230282 5:85226618-85226640 CTGCTCTTCCTGGGGCTGAGGGG + Intergenic
993340054 5:86714324-86714346 ATACTCATCTTGGTGAGGTGGGG + Intergenic
994057249 5:95431847-95431869 ATTGTGTTCTTGGGGAGGAAGGG - Intronic
994570936 5:101513134-101513156 ATGCTTTCCTTGGGGGGGGGGGG + Intergenic
996201468 5:120679995-120680017 CTGCTCTTGTTGGGGAGAAATGG + Intronic
998301784 5:141029010-141029032 ATGCTCTACTGATGGAGGAGTGG - Intergenic
998405284 5:141870768-141870790 ATGATTTTGTTGGAGAGGAGGGG - Intronic
1001543810 5:172557756-172557778 AGGCTCTTCTAGGGCAGGATGGG - Intergenic
1002431120 5:179204585-179204607 TTGGTGGTCTTGGGGAGGAGGGG - Intronic
1005816754 6:29559309-29559331 AAGCTCTCCTTTGAGAGGAGAGG + Intronic
1006474573 6:34245973-34245995 ATACTCTTTGTGGGGAAGAGGGG + Exonic
1006763989 6:36488703-36488725 ATGCTCATCCTGTGTAGGAGAGG + Exonic
1006779280 6:36621123-36621145 ATGATCTTCCTGGAGGGGAGGGG + Intergenic
1006990759 6:38212846-38212868 ATGCGCTGCTGGGGGAGAAGGGG - Intronic
1007905560 6:45457064-45457086 ATGCATTTTTTTGGGAGGAGGGG + Intronic
1008991744 6:57610611-57610633 TTTCTCTTTTCGGGGAGGAGAGG - Intronic
1012537615 6:100318221-100318243 ATGCACTTCTCTGGGAGGTGAGG - Intergenic
1014489224 6:122041916-122041938 ATGCCTGTCTTGGGGAGGTGTGG - Intergenic
1014571664 6:123016329-123016351 GTGCTTTTTTTGGGGGGGAGGGG + Intronic
1014963117 6:127711786-127711808 CTGCTTTTCTTAGGGAGCAGGGG + Intronic
1015232359 6:130930040-130930062 CTGCTCTTTTTGGGAATGAGTGG - Intronic
1015537306 6:134279641-134279663 TTGCTATTTTTGGGGGGGAGGGG - Intronic
1015581524 6:134730336-134730358 ATTCTGTCCTTGAGGAGGAGGGG + Intergenic
1015867199 6:137739504-137739526 AGGCTCTTCTTTGGCAGAAGGGG - Intergenic
1016143497 6:140642929-140642951 ATGCTTATCTTGGGGAGCATTGG - Intergenic
1016964808 6:149709113-149709135 ATGCTCTTGGCTGGGAGGAGGGG - Intronic
1018601931 6:165553214-165553236 TTTCTTTTTTTGGGGAGGAGGGG + Intronic
1019409768 7:901404-901426 TGGCTCTTCCTGGGCAGGAGAGG - Intronic
1021387255 7:20046272-20046294 ATGCTTTTTTTTGGGGGGAGGGG - Intergenic
1021814867 7:24437277-24437299 ATGCTCTTCTTGGTGAGGGTAGG + Intergenic
1023028609 7:36074192-36074214 AAGGTCTACTTGGGGAGGAGGGG - Intergenic
1023673290 7:42602816-42602838 ATACTCTTTTTGGGGAGGGTTGG - Intergenic
1023787167 7:43719256-43719278 AAGCTCTTCTTGGCCAGGTGTGG - Intronic
1025991717 7:66502689-66502711 ATGCTCTTCTATGGGAGCCGGGG + Intergenic
1026210126 7:68296650-68296672 ATGCCCTTGTTGGAGAGCAGGGG + Intergenic
1028457073 7:91050080-91050102 ATGCCCTGAATGGGGAGGAGTGG + Intronic
1029480753 7:100811467-100811489 TTTCTCCTCTTGGGGAGCAGAGG - Intronic
1030084423 7:105804430-105804452 AAGCTCTTGTTGGAGATGAGTGG + Intronic
1030318593 7:108141437-108141459 ATGGACTTGTTGGGGAGGGGTGG + Intergenic
1033813491 7:145045352-145045374 TTGCTCATCTAGGGGAGGACTGG - Intergenic
1034989198 7:155537042-155537064 TTGCTCTTCTTTGAGAGGAAAGG + Intergenic
1037312866 8:17575204-17575226 AGGCTCTTCTTGGGGGGCTGAGG - Intergenic
1037979401 8:23240220-23240242 ATTCTCTTGGTGGGGCGGAGGGG - Intergenic
1038397826 8:27260020-27260042 GTGTTCTTCTTGGTGGGGAGGGG + Intergenic
1040859492 8:51984327-51984349 AGCCTCTGCTTGGCGAGGAGGGG - Intergenic
1045362131 8:101442547-101442569 ATTCTCTTCTGGGGCAGGACAGG - Intergenic
1045797817 8:106066158-106066180 GTGATCTTCTTGAGGAGGAGAGG - Intergenic
1047793949 8:128234726-128234748 CTGCTCTCTTTTGGGAGGAGTGG + Intergenic
1048095703 8:131290853-131290875 ATGGGCTTCTTGGTGAGGGGAGG - Intergenic
1048681115 8:136842817-136842839 GTGCCCTGCTTGGTGAGGAGAGG - Intergenic
1049729159 8:144167159-144167181 AGGGTCTTGTTGGGGTGGAGTGG + Intronic
1051726216 9:20089866-20089888 TTGCGCTTGTTGGGGAGCAGGGG - Intergenic
1052803813 9:32994468-32994490 ATGTGTTTCTTGGGGAAGAGAGG - Intronic
1052830898 9:33214611-33214633 AGGGGCTTTTTGGGGAGGAGAGG - Intergenic
1052896323 9:33750906-33750928 AGGCTCCTCTAGGGGAGGACGGG + Intronic
1053846859 9:42248543-42248565 ATGCCCTTGTTTGAGAGGAGGGG - Intergenic
1054804324 9:69383488-69383510 ATGGTCTCCTTGGCCAGGAGAGG - Intronic
1055956647 9:81780127-81780149 ATTCTTTTCTTGGGGGGGATTGG + Intergenic
1057927747 9:99168137-99168159 AAGCCCTCCTGGGGGAGGAGGGG - Intergenic
1058879055 9:109270985-109271007 AACCTCTTCCTGGGTAGGAGAGG - Intronic
1060102362 9:120851727-120851749 CTGCTTCTCATGGGGAGGAGTGG + Intergenic
1060122266 9:121004157-121004179 ATTCTCTTCTCGGCCAGGAGCGG - Intronic
1061516875 9:131095260-131095282 CTGGTCTTACTGGGGAGGAGGGG + Intergenic
1061517421 9:131097781-131097803 ATGCCCTGCTTGGAGATGAGAGG - Intronic
1062703313 9:137919506-137919528 ATGCCCTTAGTGTGGAGGAGCGG - Intronic
1185750829 X:2608927-2608949 CTGCCCTTCTTGGAGAGGTGTGG - Intergenic
1185865183 X:3617943-3617965 ATGTTCTTTTTGGGGGGGCGGGG + Intronic
1186151104 X:6675686-6675708 ACTCTCTACTTGGGGAGCAGAGG - Intergenic
1186336691 X:8597234-8597256 TAGCTCTTCTTGGGGAAGAGAGG + Exonic
1186439805 X:9576124-9576146 ATGCTACACTTTGGGAGGAGGGG - Intronic
1186716542 X:12258053-12258075 ATTTTCTTGGTGGGGAGGAGTGG - Intronic
1188156673 X:26749440-26749462 ATACTCTTCATGGAGAAGAGGGG + Intergenic
1189324238 X:40103381-40103403 ATCCTCCTTTTGGGGAGGGGGGG - Intronic
1189724384 X:43954031-43954053 ATGCTCTTCTAGGGTGGGACAGG - Intronic
1190741656 X:53292724-53292746 ACACTCTTCTTGGGAAGGCGTGG - Intronic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic
1192670565 X:73136009-73136031 ATGCTTTTACTGGGGAGGAGGGG + Intergenic
1192740956 X:73892440-73892462 AGGCTTTTCTTGGCTAGGAGAGG - Intergenic
1193023781 X:76821846-76821868 TTGCTCTGCTTGGGGATGGGGGG + Intergenic
1194978109 X:100412943-100412965 ATGCTCTCCTTGGAAAAGAGGGG - Intergenic
1197326787 X:125104214-125104236 AAGCTCTTTTTGGAGATGAGAGG - Intergenic
1197767769 X:130070093-130070115 AAGCCCTTCTTGGGGAAGAGGGG + Intronic
1197848876 X:130835181-130835203 ATTCTCATCCTGGGGAGGGGAGG + Intronic
1198021268 X:132660561-132660583 ATCCTATTCATGGGGAGGAGGGG - Intronic
1198479112 X:137024245-137024267 ATTCTCTTCTTGTTGAGGGGAGG + Intergenic