ID: 1105727130

View in Genome Browser
Species Human (GRCh38)
Location 13:23174859-23174881
Sequence ATTCCATTTGAAAACCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105727130_1105727137 29 Left 1105727130 13:23174859-23174881 CCATTATGGTTTTCAAATGGAAT 0: 1
1: 0
2: 1
3: 29
4: 367
Right 1105727137 13:23174911-23174933 GTGCAGGTAAACTGAAAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 198
1105727130_1105727133 13 Left 1105727130 13:23174859-23174881 CCATTATGGTTTTCAAATGGAAT 0: 1
1: 0
2: 1
3: 29
4: 367
Right 1105727133 13:23174895-23174917 CTTTGACCATGTAAAAGTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1105727130_1105727135 25 Left 1105727130 13:23174859-23174881 CCATTATGGTTTTCAAATGGAAT 0: 1
1: 0
2: 1
3: 29
4: 367
Right 1105727135 13:23174907-23174929 AAAAGTGCAGGTAAACTGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 257
1105727130_1105727136 28 Left 1105727130 13:23174859-23174881 CCATTATGGTTTTCAAATGGAAT 0: 1
1: 0
2: 1
3: 29
4: 367
Right 1105727136 13:23174910-23174932 AGTGCAGGTAAACTGAAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105727130 Original CRISPR ATTCCATTTGAAAACCATAA TGG (reversed) Intergenic
902137004 1:14316111-14316133 ATTTCAAATGAAAACCACAAAGG - Intergenic
904111035 1:28126191-28126213 ATCCCATTTTAAAACCAGAAAGG - Intergenic
907106767 1:51889988-51890010 AATGCATTTGGAAACCAAAATGG - Intergenic
908605747 1:65795180-65795202 ATTGCATTTGTAAACCAAAATGG - Intronic
909250421 1:73346301-73346323 ATTCCATTGTGAAACCAAAATGG - Intergenic
909471840 1:76037877-76037899 ATGCCAATTGAAAATCATAAGGG - Intergenic
909808153 1:79897267-79897289 ATTACATAAGAAAAGCATAATGG - Intergenic
909939533 1:81594848-81594870 AATACATTTTAAAACCAGAAAGG - Intronic
910021052 1:82589834-82589856 ATTAAAGTTGAAAAACATAATGG + Intergenic
910130343 1:83897241-83897263 ATTCCATTTAGAGACCATTATGG - Intronic
910567586 1:88662623-88662645 CATCCATTTGAAAATCCTAAAGG - Intergenic
911125311 1:94335955-94335977 ATTCCTTTTGAAAACCTAAATGG - Intergenic
911494793 1:98617611-98617633 ATTCCTCATGAAAACCATAAAGG - Intergenic
911787798 1:101972737-101972759 ATTACATTTAAAAAGCAAAATGG - Intronic
911975237 1:104486366-104486388 ACTGCATTTGAAAATGATAAGGG - Intergenic
912024682 1:105153991-105154013 AATGCATTTTAAAACCACAATGG - Intergenic
912426144 1:109592952-109592974 TTACCATATGGAAACCATAATGG - Exonic
912698805 1:111861128-111861150 TTGCCTTTTGAAAACCAAAAGGG + Intronic
913670423 1:121093116-121093138 ATTCCAGTGGAAAAACTTAAAGG - Exonic
914022190 1:143880557-143880579 ATTCCAGTGGAAAAACTTAAAGG - Intergenic
914439986 1:147696749-147696771 ATTACTTTTGAAAAGCAAAAAGG + Intergenic
914660675 1:149788486-149788508 ATTCCAGTGGAAAAACTTAAAGG - Exonic
914679449 1:149928742-149928764 ATTCCCATAGAAAACTATAAGGG + Exonic
916886873 1:169078105-169078127 GTTCCAGTTGAAAACAATTAAGG + Intergenic
917994866 1:180425978-180426000 TTTCCATTTTTAAACAATAATGG - Intronic
918435311 1:184504985-184505007 ATTTCATTGGAAAAACATATTGG + Intronic
919460964 1:197876304-197876326 ATTCCATTTGAATTTCAGAATGG + Intergenic
923839068 1:237647949-237647971 ATTTCATATGAAAGCCATACTGG + Intronic
924093660 1:240528389-240528411 AGTCCATTTGAAACCCCAAATGG + Intronic
924752457 1:246907372-246907394 AATCAATGTGAATACCATAAAGG - Intronic
1063423146 10:5929911-5929933 CTTCCATGAGAAAACCATACTGG - Intronic
1063862560 10:10327530-10327552 TTTCCTTTTGAAAACAAGAAAGG + Intergenic
1064521389 10:16206359-16206381 CTTCAAATTGAAAAACATAATGG - Intergenic
1065346263 10:24750507-24750529 ATTCCATTTATAAAACATTATGG - Intergenic
1066600690 10:37103238-37103260 ATTCCATATGGAAACATTAAAGG - Intergenic
1066601510 10:37112996-37113018 ATTCCATATGGAAACATTAAAGG + Intergenic
1066670915 10:37837856-37837878 ATCCCATTTGGCCACCATAAAGG - Intronic
1066760865 10:38751149-38751171 GTTAAATTTGAAAACCATGATGG - Intergenic
1067497171 10:46771992-46772014 ATTCCATTTGAAAAGCAATGGGG + Intergenic
1067553006 10:47248204-47248226 ATTCCATTAGAAAAAAATACAGG + Intergenic
1067597481 10:47568417-47568439 ATTCCATTTGAAAAGCAATGGGG - Intergenic
1067907936 10:50313514-50313536 ATGCAATTTGAAAACTAAAATGG - Intronic
1068020102 10:51570855-51570877 ATTCAATTTCAAAACTATATTGG - Intronic
1070140823 10:73736035-73736057 ATTCCATTTGAAAAGCAATGGGG - Intergenic
1071615846 10:87075526-87075548 ATTCCATTTGAAAAGCAATGGGG + Intronic
1072075017 10:91962024-91962046 ATCCCATTTGAAAAAGACAAGGG - Intronic
1074122949 10:110506808-110506830 ACTCCACTTGGAAACCAGAAAGG + Intronic
1074259008 10:111833352-111833374 TTTCCATCTCAAAACTATAAGGG - Intergenic
1074338914 10:112606799-112606821 ATTTCATTTTAATAGCATAAAGG - Intronic
1074813832 10:117130254-117130276 ATGCTATTTGTAAACTATAAAGG + Intronic
1076277550 10:129216366-129216388 ATTCCATTTGTACCCCAAAAGGG + Intergenic
1079169917 11:18083582-18083604 TTTCCACTTGAAAATCTTAAAGG - Exonic
1079518146 11:21291996-21292018 ATTCCCTTTGAAAACCACACAGG + Intronic
1080144203 11:28960302-28960324 ATTCCATTTGAGAACTTTGATGG + Intergenic
1080452812 11:32392772-32392794 ATTCTATTTGAAAATGATACTGG + Intronic
1080957154 11:37111467-37111489 TTTTCATTTGCAAACCATAGAGG + Intergenic
1081116268 11:39205194-39205216 ATTGAATTTGAAAACTAGAAAGG + Intergenic
1081791471 11:45789814-45789836 ATTCCATTTGTAAGACATTATGG + Intergenic
1085826441 11:79852838-79852860 ATTCCATTTGCAAAATCTAAGGG - Intergenic
1087564283 11:99834626-99834648 ATTTCATTTGACAATCACAAAGG + Intronic
1088669843 11:112130335-112130357 ATTCCATTTGTAAAACATTCTGG + Intronic
1089717045 11:120370632-120370654 ATTACTATTGAAGACCATAAGGG - Intronic
1090541010 11:127705320-127705342 AATACATTTGTAAATCATAATGG - Intergenic
1090680820 11:129055817-129055839 ATTCAGTATGAAAACTATAATGG + Intronic
1091627860 12:2136690-2136712 ATGCCATTTGGAAAGCATAAGGG + Intronic
1092302616 12:7266628-7266650 TTTCCCTTTGAAATCCATACTGG + Intergenic
1093513618 12:19958488-19958510 ATTCCATTTAAATAAAATAATGG - Intergenic
1093623378 12:21318467-21318489 ATATCATTTGATAACCCTAAGGG - Intronic
1093797990 12:23336820-23336842 ATTCCATATGAACACAAAAAAGG + Intergenic
1094688555 12:32745804-32745826 ATTTCTTTTGAAAACCTTACAGG - Intronic
1095483779 12:42663117-42663139 ATTCCATTTGAAAGACAGCAGGG - Intergenic
1095649128 12:44585991-44586013 ATTTCATTTGAACAGCATATGGG - Intronic
1095690099 12:45078421-45078443 AGTCCATTTTAAATTCATAAGGG - Intergenic
1095993137 12:48052491-48052513 ATTTAATTTGAAAATCAGAATGG - Intronic
1097933605 12:65219390-65219412 GTGGCATTTGAAAACCATACAGG + Intronic
1097947998 12:65393958-65393980 AATGTATTTTAAAACCATAAAGG - Intronic
1098856435 12:75657769-75657791 TTTCCTTTTGAAAACCAGAGGGG - Intergenic
1099484574 12:83212596-83212618 ATTCCACTTGAAAACTATAGTGG + Intergenic
1099553152 12:84073362-84073384 AATGCATTGGAAAACAATAAAGG - Intergenic
1100231231 12:92610263-92610285 ATTTTATTTCAAAACCAGAAAGG - Intergenic
1100749736 12:97685363-97685385 CTTACATTTGAAAACCATAAAGG + Intergenic
1101086079 12:101238311-101238333 ATTGCAAATTAAAACCATAATGG + Intergenic
1101643955 12:106611034-106611056 ATTGCAAATGAAAACCACAATGG - Intronic
1104545346 12:129707680-129707702 ATTACATTTGGAGACCATGAAGG + Intronic
1105326203 13:19372526-19372548 ATTGCATTGAACAACCATAAAGG + Intergenic
1105722797 13:23134121-23134143 TTTCCAGTTGAAAACCAGAAAGG + Intergenic
1105727130 13:23174859-23174881 ATTCCATTTGAAAACCATAATGG - Intergenic
1105867304 13:24472543-24472565 ATTGCATTGAACAACCATAAAGG - Intronic
1106306968 13:28521100-28521122 ATTACAAATGAAAACCACAATGG - Intergenic
1106386586 13:29291385-29291407 ATGCCTTTTGAAAACAAAAATGG - Intronic
1106865941 13:33964207-33964229 ATTTCCTCTGAAAACAATAACGG - Intronic
1106882864 13:34150776-34150798 GTTTCTGTTGAAAACCATAATGG + Intergenic
1107013578 13:35691456-35691478 ATTGGAAATGAAAACCATAATGG - Intergenic
1107180376 13:37451620-37451642 ATTATATTTGAAAATCAGAATGG - Intergenic
1108894415 13:55306405-55306427 ATTCCAATGGAAAAAGATAATGG + Intergenic
1108946518 13:56032645-56032667 ATTCTAATTGACAAGCATAATGG - Intergenic
1109065943 13:57690928-57690950 ACTGCATTTAAAAACCACAAGGG - Intronic
1109451932 13:62527116-62527138 TTTCCATGTGAAAAGAATAAAGG - Intergenic
1109705401 13:66084656-66084678 ATGCTATTTGAAACCCATAAAGG - Intergenic
1109811893 13:67524332-67524354 ATTCCATTTTTTAACCTTAAGGG + Intergenic
1110444163 13:75558858-75558880 ATTCTATCTAAAAACCAAAAAGG - Intronic
1111678062 13:91411374-91411396 CTTCCATGTGAAAAGCACAAGGG + Intronic
1111801402 13:92985879-92985901 CTTCTATATGAAAACCATTATGG + Intergenic
1112965054 13:105179555-105179577 ATTCCATTTGAAATCAGAAAAGG + Intergenic
1113131138 13:107038274-107038296 ATTCCAGTTGGAGACCAAAATGG - Intergenic
1114171406 14:20275973-20275995 AATGCAATTTAAAACCATAATGG + Intronic
1114965506 14:27954679-27954701 ATTCCATTGGATCACCATCATGG - Intergenic
1116276286 14:42837360-42837382 ATTCCATTTGGAAAAAAGAATGG - Intergenic
1116395159 14:44439268-44439290 ATTCCCTCTGAAAATAATAAAGG + Intergenic
1117508195 14:56423501-56423523 ATTACATTTGAAAATCAGCAAGG + Intergenic
1117757019 14:58985715-58985737 ATTCCATGTGAAAAAAATGAAGG - Intergenic
1118304557 14:64644961-64644983 ATGGCATTTGTAAACCATCATGG - Intergenic
1118409414 14:65462318-65462340 ATTCAAGTTGAAAAACAAAATGG - Intronic
1118606381 14:67506973-67506995 ATTCCATCTAAAAACAAAAAAGG + Intronic
1120117592 14:80637940-80637962 ACTCCCTCTGAAAACCCTAAGGG - Intronic
1120157304 14:81107597-81107619 ATTCCATTTTAAAAACACACTGG - Intronic
1120328477 14:83057648-83057670 ATTCCATGTAAAAACAATAGTGG + Intergenic
1120962493 14:90138351-90138373 ATCCCATTAGGAAACCAAAATGG - Intronic
1121747742 14:96313539-96313561 ATTTAATTGGAAAATCATAACGG + Intronic
1122377669 14:101276559-101276581 ATTCCATGAGAAACCCACAAGGG - Intergenic
1127238216 15:57080259-57080281 ACTCCCTTTGAAAAACAGAAAGG - Intronic
1127745386 15:61965088-61965110 ACTCCATTTCCAAAGCATAATGG + Intronic
1129347772 15:74934961-74934983 ACTCCATTTAAAAACAAAAAAGG + Intronic
1131439327 15:92447196-92447218 ATTCTATTTAAGGACCATAATGG + Intronic
1132177552 15:99727431-99727453 ATTCCATTTGAGAAAAGTAAAGG + Exonic
1133533549 16:6677510-6677532 ATTCCATATCAAAAACATCAGGG + Intronic
1134024531 16:10944005-10944027 ATTCCCTTTATAAACCAAAACGG - Intergenic
1137793798 16:51197723-51197745 ATTTCATTTGATAACCAAGAGGG - Intergenic
1138083905 16:54116528-54116550 AATCAATTTGACAACCATAAAGG + Exonic
1138917315 16:61482141-61482163 ATTGCATTTGAAAAATGTAAAGG - Intergenic
1138967805 16:62107032-62107054 ATTTCATTTGAAAGAAATAAGGG - Intergenic
1139554903 16:67701520-67701542 ATCCCATTTAAATGCCATAATGG + Intronic
1140286662 16:73609374-73609396 CTTCCATTTCAAAAAAATAAAGG + Intergenic
1140661937 16:77196766-77196788 ACTCCATTTCAAAAACAAAAAGG + Intronic
1140865941 16:79062222-79062244 CTTACAGTTTAAAACCATAATGG + Intronic
1141501868 16:84450167-84450189 AGTCCATTTGTAAACAAAAAAGG - Intronic
1147520293 17:41165280-41165302 ATTCCATTTCAGAACTATGAAGG + Intergenic
1148134365 17:45282830-45282852 CTTCCAGCTGAAAACCCTAAAGG + Intronic
1149428868 17:56580891-56580913 ATTCCATATGAAACCAAAAAAGG + Intergenic
1149436324 17:56636575-56636597 ATTGCATTGTAAAAGCATAAAGG + Intergenic
1149654019 17:58300837-58300859 GTTCCATTTGAAAGCAAGAAAGG - Intergenic
1152058058 17:78047401-78047423 ATTCCAGGTGAAAACTACAAAGG - Intronic
1152416021 17:80162575-80162597 ATGGCATTTGTAAACCATCATGG - Intergenic
1153142004 18:1983651-1983673 ATTTCACTTGAAAACAACAAAGG + Intergenic
1156950148 18:42886033-42886055 ATTCCTTTTGAAGAAAATAAAGG - Intronic
1157376254 18:47168441-47168463 ATTAGATTTCAAAACCATGAAGG + Intronic
1158234491 18:55298324-55298346 TTCCCATTTCAAAACCAGAATGG + Intronic
1159631821 18:70757849-70757871 GTTCTATTTGAAAACAAAAAAGG + Intergenic
1159782310 18:72674547-72674569 ATTCATTTTGGAAAGCATAAAGG - Intergenic
1159914631 18:74177437-74177459 TTTCCTCCTGAAAACCATAAAGG + Intergenic
1160022814 18:75193526-75193548 ATTCGACTAGAAAAGCATAAGGG + Intergenic
1162739997 19:12768428-12768450 ATTGCAATTGAAAAACAGAATGG - Intronic
1164884501 19:31766833-31766855 ATTCCATGTGAAAAAAATCAAGG + Intergenic
1164897321 19:31888249-31888271 AATACATTTAAAAACCAAAATGG + Intergenic
1167461760 19:49628621-49628643 GTAGCATTTGAGAACCATAATGG + Intergenic
925664198 2:6236087-6236109 ATTTTTTTTGAAAAGCATAAAGG - Intergenic
927437358 2:23078712-23078734 ATTCCTTTTTAAAAAAATAATGG + Intergenic
928379432 2:30804853-30804875 CTCCCATGAGAAAACCATAAAGG - Intronic
928584444 2:32744570-32744592 CTTCCATTAGAAAACCAGACTGG - Intronic
929152689 2:38761475-38761497 ACTCCATTTCAAAAAAATAAAGG + Intronic
929176715 2:38985573-38985595 ATTGCACCTGAAAATCATAAAGG - Exonic
929694906 2:44106223-44106245 ATGGCATTTGTAAACCGTAATGG + Intergenic
930273436 2:49283242-49283264 ATTGTATTTGAACACCAGAAAGG + Intergenic
930445845 2:51471221-51471243 ATTCCAGCTGTATACCATAAAGG + Intergenic
930594590 2:53371452-53371474 AATAAATTTGAAAAGCATAATGG - Intergenic
930887765 2:56347599-56347621 ATAGTACTTGAAAACCATAAAGG + Intronic
931795296 2:65702575-65702597 TTCCCAATTGAATACCATAAGGG + Intergenic
931958619 2:67456866-67456888 ATTTCATTAGAGAACCAAAAAGG - Intergenic
932507239 2:72246884-72246906 TTTCCATTTTAAATCTATAAAGG + Intronic
934218987 2:90064406-90064428 ATTCTATTTGATAACCTTGAAGG + Intergenic
934603789 2:95679116-95679138 ATTGCATTTGAAACCCCTAGAGG - Intergenic
935966780 2:108485691-108485713 ATTGCTTGTGAAAACCAAAAAGG + Exonic
936508651 2:113128285-113128307 ATTCCATTTTCAAATCATAATGG - Intronic
936552805 2:113463175-113463197 ATTCCTTTTGAAAACAAAGATGG + Intronic
936887357 2:117328685-117328707 ATTCAATTTAAAAATCAGAATGG - Intergenic
939102217 2:137907957-137907979 ATTCCATTGCAAAATCAAAAAGG - Intergenic
939839654 2:147171766-147171788 ATTGCTTTTGAATCCCATAATGG - Intergenic
940377645 2:152973738-152973760 ATCCCATTGGAAAACCAGATAGG + Intergenic
940433189 2:153618845-153618867 ATGCCAATTGAAACCCAAAAAGG - Intergenic
940629849 2:156224318-156224340 AATTCATTTGAAAACAAAAAAGG + Intergenic
940765153 2:157782288-157782310 AGTTCCTTTGAAAACCACAAGGG + Intronic
940820395 2:158348123-158348145 AATCCATCTGAAAACTATATTGG + Intronic
941242743 2:163061077-163061099 ATTCCATAAGAAAACAAAAAGGG + Intergenic
941268005 2:163387814-163387836 ATGCTATTTGAAAATCATTAGGG + Intergenic
942520022 2:176793814-176793836 AAACCATTTGAAAATCCTAAAGG + Intergenic
942635075 2:177994830-177994852 AATTCATTTCAAAAGCATAAGGG + Intronic
942932719 2:181514932-181514954 ATGCCATTTAAAAATCATAATGG - Intronic
942958161 2:181798528-181798550 ATACAATTTGAAAATCAGAAAGG - Intergenic
943355877 2:186854716-186854738 CTGCCTTTTGAAAATCATAATGG - Intergenic
943402161 2:187427392-187427414 GTTGCATTTGAGAACCATTATGG + Intronic
943406005 2:187486391-187486413 ATTGCATATAAAAAACATAAAGG + Intronic
943580339 2:189676316-189676338 TTTTAATTTGAAAACTATAATGG + Intronic
943756402 2:191561486-191561508 TTTCCATTGGACAAGCATAATGG + Intergenic
943989102 2:194663219-194663241 ATTACATCTGAAAAACATAGAGG + Intergenic
944356497 2:198795330-198795352 GTTACCTTTGAAAACCATCAAGG + Intergenic
946053540 2:216882821-216882843 AGACCATTTGAAACCCACAAAGG + Intergenic
947297461 2:228647810-228647832 ATTCCATTTTGAAATCAAAATGG - Intergenic
947941073 2:234055529-234055551 ATTCCATTTGACAATTGTAATGG - Intronic
1169298978 20:4425726-4425748 ATTCCATTTGACAACCAGTCGGG - Intergenic
1169419920 20:5451790-5451812 ACTCCATTTGAAAACCAGGAAGG - Intergenic
1169963054 20:11183747-11183769 ATTCCAGTTGAAAAACATTCTGG - Intergenic
1170998387 20:21388631-21388653 GTTCCATTTCAAAACCCTAGAGG + Intronic
1172541583 20:35721517-35721539 ATGCCATGTGAAATGCATAATGG - Intronic
1173456019 20:43201936-43201958 ATTTCATTTTAAAACATTAACGG - Intergenic
1175091539 20:56508452-56508474 ACTGCCTTTGAAAAACATAAAGG - Intronic
1179032826 21:37735376-37735398 ATTCCATTTGCAAACCCATAGGG - Intronic
1180846442 22:18985147-18985169 ATTCCATTTAAAATACTTAAGGG - Intergenic
1184601542 22:45546774-45546796 TTTCCATTTGAGAACTAGAATGG + Intronic
949455271 3:4231336-4231358 GTTGCATTTAAAAACCAAAATGG - Intronic
949741959 3:7245676-7245698 ATGGAATTTGAAAAACATAAGGG + Intronic
951114341 3:18842325-18842347 TTTCCCTTTGAAAAACATCAAGG + Intergenic
951415332 3:22416288-22416310 ATTCCATTCTAAAGCCATAGTGG + Intergenic
951869259 3:27342181-27342203 ATTCAATTTGATAAACAAAATGG - Intronic
952000069 3:28774878-28774900 AATCCATTTCAAAACAATATGGG + Intergenic
952241759 3:31537619-31537641 TTACGATATGAAAACCATAAAGG - Intronic
953690263 3:45111964-45111986 ACTCAATATAAAAACCATAAAGG - Intronic
955819415 3:62880447-62880469 ATTGCATATAAAAATCATAATGG + Intergenic
957184433 3:76923571-76923593 ATTCTGATTGAAAACCAAAAAGG - Intronic
957334626 3:78811148-78811170 TTTCCATTTGAATCCCATTAAGG - Intronic
957507119 3:81136198-81136220 ATTCCATGTTAAAACCATTCTGG + Intergenic
957513292 3:81217707-81217729 CTTCCATTTGAATAAAATAATGG + Intergenic
957757011 3:84503209-84503231 ATCAAATTTGAAAAACATAAAGG + Intergenic
957965164 3:87312797-87312819 AATCCAATTGAAAACAAGAAAGG - Intergenic
958966836 3:100568193-100568215 AATCCATTAGAAAACTATTAGGG - Intronic
958990070 3:100832778-100832800 ATACAATTTGAAAAACAGAAAGG + Intronic
959555698 3:107714763-107714785 ATTGCATTTGAAATACTTAACGG + Intronic
959561953 3:107792269-107792291 ACTTCATTTGAAAACTAGAAGGG + Intronic
961042075 3:123684552-123684574 ATTCCATTTCAAAAAAAAAAAGG - Intronic
961061691 3:123833983-123834005 TTTCCTTTTGAAAACCCTATTGG - Intronic
961438814 3:126938596-126938618 ATTTCATTTTAAAACCTTATTGG - Intronic
962680712 3:137796980-137797002 AATACATGTTAAAACCATAATGG + Intergenic
962967435 3:140367796-140367818 TCTTCATTTGTAAACCATAATGG + Intronic
962971017 3:140402095-140402117 ATTCTTTTTGAAAAGCATAAAGG + Intronic
963111054 3:141688411-141688433 ATTCCATTTGATACACTTAAGGG + Intergenic
963281359 3:143387551-143387573 TTTCCATTTGAATACCATAGAGG - Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
963962863 3:151329052-151329074 ATAGCATTTGAAAATCATGAAGG - Intronic
964241648 3:154601435-154601457 ATACCATGTGAAAACCAGCAGGG + Intergenic
965990677 3:174813821-174813843 TTTACATTTCAAAAACATAAGGG - Intronic
966061145 3:175757530-175757552 ATTTGAGTTTAAAACCATAAAGG - Intronic
966609181 3:181851307-181851329 ATTTCACTTGACAAGCATAAAGG - Intergenic
967717781 3:192783062-192783084 ATTCAAATTGAAAACCAGTATGG + Intergenic
967788322 3:193521250-193521272 ATGCCATATGAAAAGCACAAGGG + Intronic
967996874 3:195173583-195173605 TGGCCATTTGAAAACCAGAAAGG - Intronic
970073224 4:12186950-12186972 ATGGCATTTGGAAACCATCATGG + Intergenic
970319543 4:14861994-14862016 GTTCCTTCTGAAAGCCATAAGGG + Intergenic
970768937 4:19586290-19586312 ATACCATTAGAAAATCATATTGG - Intergenic
971093944 4:23376625-23376647 AATGCATTTGAAAACCAGAGGGG - Intergenic
971595328 4:28519980-28520002 ATGCCATTGAAAAAGCATAAGGG + Intergenic
971723485 4:30277595-30277617 ATTCCAGTAGAAAATCATAATGG + Intergenic
971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG + Intronic
972076683 4:35098967-35098989 ATCCCATCTGAAAAGCATAAAGG - Intergenic
973887315 4:55336438-55336460 ATTACATTTGAGAAGCAAAATGG + Intergenic
973970817 4:56212222-56212244 ATTGCATTTGTAAACTATAATGG - Intronic
974145416 4:57941566-57941588 AATATATTTGAAAACTATAATGG - Intergenic
974463936 4:62229083-62229105 ATTTAATATGCAAACCATAATGG - Intergenic
974500875 4:62700670-62700692 ATTCCATTTGTAATCAAGAAGGG - Intergenic
974619858 4:64340859-64340881 CTTCCATCTGAAGCCCATAAAGG + Intronic
976481201 4:85547909-85547931 ATTCAATTTGAAAGGAATAATGG - Intronic
976578342 4:86703475-86703497 TTTCTATTTCAAAACTATAATGG - Intronic
976701771 4:87977766-87977788 ATTCCAGTTGAACAGAATAAAGG + Intronic
977627459 4:99202998-99203020 ATATCATGTGAAAACCATGATGG + Exonic
977734623 4:100398808-100398830 ATTCCACTGGAAAAAGATAAAGG - Intronic
978918778 4:114156362-114156384 CTTACTTTTGAAAACAATAATGG + Intergenic
979464795 4:121023547-121023569 ATTTCTTTTGAATAGCATAACGG - Intergenic
979976995 4:127209198-127209220 ATTCCCTTTGAAAACCGGCAAGG - Intergenic
980168724 4:129260821-129260843 ATTGCATTTCAAATCCTTAATGG + Intergenic
980601042 4:135025222-135025244 AAGCCATATGCAAACCATAAGGG + Intergenic
981610873 4:146592249-146592271 ATTCCATTTGCATCCCCTAATGG - Intergenic
982942699 4:161578542-161578564 AATCTATTTGAAAAAAATAATGG + Intronic
983531735 4:168816711-168816733 GTACCTTTTGGAAACCATAAAGG - Intronic
984416535 4:179467319-179467341 ATAGCATTTGCAAAGCATAAGGG + Intergenic
985294235 4:188417738-188417760 ACTCCATCTGAAAACCAAAACGG - Intergenic
985701420 5:1375377-1375399 ATGGCATTTGCAAACCATCATGG - Intergenic
987528939 5:19090960-19090982 AATGCATTTCACAACCATAATGG - Intergenic
988706317 5:33729251-33729273 GTTCCATTGGAGAAACATAAAGG + Intronic
989247915 5:39274505-39274527 ATACAATTAGAGAACCATAAAGG - Intronic
989819527 5:45778743-45778765 ATTACATTTAAAAATCAAAATGG + Intergenic
990947644 5:61265729-61265751 ATCCATTTTGAAATCCATAAGGG + Intergenic
991212693 5:64124215-64124237 ATAACATTTAATAACCATAAAGG - Intergenic
992937837 5:81728273-81728295 CTTCCATTTCAAAACAAAAACGG + Intronic
993786212 5:92140746-92140768 TTTGCATTTCAAAACCATAAAGG + Intergenic
994268161 5:97742579-97742601 ATTCTACCTGAAAAACATAAGGG - Intergenic
994534888 5:101017458-101017480 ATACAATTTGAAAACCCTGAAGG + Intergenic
995088418 5:108142619-108142641 ATTGCATTTGAAAACCAATTGGG + Intronic
995775625 5:115722303-115722325 GTTACATTTGAAAACATTAAAGG - Intergenic
996171017 5:120291720-120291742 ATTCCATTTGAAAAACAAATAGG + Intergenic
998417434 5:141955985-141956007 ATTCCTTTTGACAACCATTGTGG - Exonic
999065083 5:148676797-148676819 ATTTCAATTCAAAAGCATAAAGG - Intronic
1000555923 5:162725746-162725768 ATTTCATATGAAAACAAAAAAGG - Intergenic
1002452401 5:179326383-179326405 ATTCCATTTCAGAACAGTAACGG + Intronic
1002787623 6:416172-416194 CTTCAATTTGACAACCACAAAGG - Intergenic
1002972924 6:2042734-2042756 ATTTCTTTTGAAAATGATAAAGG - Intronic
1004661487 6:17714161-17714183 GTTCAATTTGATAACAATAATGG + Intergenic
1005521655 6:26606575-26606597 CTCCCATTTGAAAACCCTGAAGG + Intergenic
1005683551 6:28230320-28230342 ATTAAATCTGAAATCCATAAGGG - Exonic
1006199647 6:32276728-32276750 ATGGCATTTGAAAACCGTCATGG + Intergenic
1007071627 6:39042302-39042324 GTTCCATCTGAGAACCATGAGGG - Intergenic
1009588495 6:65637156-65637178 ATTTAATTTAAAAACGATAAAGG + Intronic
1009853556 6:69230093-69230115 GTTACATTTGAAAACCATTTGGG + Intronic
1010660435 6:78564291-78564313 GTTCCATTTAAAAACAAGAAAGG - Intergenic
1011825271 6:91298774-91298796 AATCCTTTTGAAAACCAGATAGG - Intergenic
1012798390 6:103793340-103793362 AATACATATCAAAACCATAATGG + Intergenic
1012942754 6:105433172-105433194 TTTCCATTTGAAAGCCATAGTGG - Intergenic
1014158882 6:118143933-118143955 CTTCCATCAGAAAACCATCATGG - Intronic
1014406510 6:121058444-121058466 TTTTCATTTGAAAAGCATACTGG + Intergenic
1014602124 6:123426349-123426371 ATTCTATTTCTAAAACATAATGG + Intronic
1014788971 6:125649901-125649923 ATTCTATTTGAAAAACACATTGG - Intergenic
1014855142 6:126391187-126391209 AATGCATTTGAAAACTACAAAGG - Intergenic
1015078094 6:129187785-129187807 ATTCCATTTGAGCATCATATAGG + Intronic
1015703599 6:136063323-136063345 ATACCATTTTAAAACCACAATGG + Intronic
1015975733 6:138788741-138788763 ATTCCATTTGGAACCCAAAGGGG - Intronic
1016207864 6:141491410-141491432 ATGGCATTTGTAAACCATCATGG - Intergenic
1016886686 6:148965585-148965607 ATCTCATTTTAAAAACATAATGG + Intronic
1018328934 6:162706778-162706800 CTTCTATTTGCAAAACATAAAGG + Intronic
1018578230 6:165282932-165282954 ATTGCATTTTAAAACAGTAATGG - Intronic
1018597389 6:165496452-165496474 ATCTCATTTTAAAAACATAAGGG - Intronic
1019810414 7:3161273-3161295 ACTCCATTTCAAAAAAATAAAGG - Intronic
1024154737 7:46609921-46609943 ATTCACTTTGAAAACCATCCCGG - Intergenic
1024855378 7:53772505-53772527 ATTCCCTGAGAAAATCATAATGG - Intergenic
1025241691 7:57281978-57282000 ATGGCATTTGTAAACCATCATGG - Intergenic
1026345672 7:69472116-69472138 ATTCCATTATATAACTATAATGG + Intergenic
1027907474 7:84204352-84204374 ATCCCATTTGACAGCCATGATGG - Intronic
1028003294 7:85529271-85529293 ATTCCATCTGAAAGCCAGAAAGG + Intergenic
1028322043 7:89472381-89472403 ATTCCATTTAAAAACTGTTATGG + Intergenic
1029226420 7:99031931-99031953 ATTGTATTTGTAAACCATACAGG + Intronic
1030328523 7:108247946-108247968 GTTCCATTTAAAAACAAAAATGG + Intronic
1030480250 7:110094392-110094414 AGTCCCTCTGATAACCATAAAGG - Intergenic
1030996456 7:116364846-116364868 TTTACATTTTAAAATCATAATGG + Intronic
1031382162 7:121100173-121100195 ATGGGATTTGATAACCATAAAGG - Intronic
1031517187 7:122715904-122715926 ATTCAATATGAAAACTCTAAAGG + Intronic
1037866255 8:22445411-22445433 ATACAATTTGAAAATCAGAAAGG + Intronic
1038065387 8:23958349-23958371 ATCAGATGTGAAAACCATAATGG + Intergenic
1040721191 8:50325762-50325784 ATTCCTTTTAAAAATCATACAGG - Intronic
1041960324 8:63607678-63607700 ATTCCATGTGAAAAAAATTAAGG - Intergenic
1042974841 8:74456922-74456944 TTTCCATTTGAAAATAATTATGG + Intronic
1043550851 8:81371124-81371146 GGTCCATTTGAGAACAATAAAGG + Intergenic
1044111226 8:88277610-88277632 AGTGCCTTTGTAAACCATAAGGG + Intronic
1044586535 8:93873934-93873956 ATGGCATTTGTAAACCATCATGG + Intronic
1044788945 8:95825811-95825833 ATTCCTTTTGCAAAAGATAACGG + Intergenic
1044984782 8:97747889-97747911 ATGGCATTTGTAAACCATCATGG + Intergenic
1045600738 8:103712784-103712806 ATTCCATTTAAAAGGGATAAAGG - Intronic
1046526365 8:115386565-115386587 ATGACATTTGTAAACCATTACGG + Intergenic
1046685174 8:117217088-117217110 ATTCCATTTGACATATATAATGG + Intergenic
1047573339 8:126126405-126126427 AAGCCATGTCAAAACCATAAAGG + Intergenic
1048059905 8:130908217-130908239 ATTCCTTTTGCAAACCTTAGAGG - Intronic
1048523145 8:135176093-135176115 TTTCCATCTGAAAACTAAAATGG - Intergenic
1049456590 8:142694802-142694824 ATTCCATTTTAAAACAAGCAAGG - Intergenic
1049900194 9:154010-154032 ATTCCTTTTGAAAACAAAGATGG - Intronic
1050505081 9:6339920-6339942 ATTCCCTTTGAAAACAAAACTGG + Intergenic
1051894371 9:21972524-21972546 ATTCCTTTTGGAAACTCTAAGGG - Intronic
1053743243 9:41164307-41164329 ATTCCTTTTGAAAACAAAGATGG - Intronic
1054348523 9:63994120-63994142 ATTCCTTTTGAAAACAAAGATGG - Intergenic
1054446252 9:65320493-65320515 ATTCCTTTTGAAAACAAAGATGG - Intergenic
1054484022 9:65701014-65701036 ATTCCTTTTGAAAACAAAGATGG + Intronic
1054685099 9:68266982-68267004 ATTCCTTTTGAAAACAAAGATGG + Intronic
1055421087 9:76143362-76143384 ATTTCATTTGAAAAACATTTTGG + Intronic
1056059504 9:82869796-82869818 ATTCCATTTGAAAAACATTCTGG - Intergenic
1056234871 9:84584829-84584851 ATTCTACTTGAAAATCATACTGG - Intergenic
1057290702 9:93805127-93805149 ATTCCATATGAAATTCAAAACGG - Intergenic
1057943124 9:99302208-99302230 ATGGCATTTGTAAACCATCATGG - Intergenic
1058051171 9:100408614-100408636 ATTCCATTTTATAAATATAAAGG + Intergenic
1058249738 9:102677689-102677711 ATTCATGTTGAAAACCATGAAGG + Intergenic
1058355328 9:104077537-104077559 ATGGCATTTGTAAACCATAATGG + Intergenic
1059052188 9:110938443-110938465 ATTGCATTTGTAAACCGTCATGG - Intronic
1060121294 9:120992889-120992911 ATTCCTTTTCAAACCCATGAAGG + Intronic
1062440775 9:136568378-136568400 ACTCAATTTGAAAAACAGAAGGG + Intergenic
1185799693 X:2998904-2998926 ATTACATTTGAGAGCCATATTGG + Intergenic
1185977574 X:4738691-4738713 ATTCCAGTTGCAAGGCATAAGGG - Intergenic
1186147218 X:6636964-6636986 ATGATATGTGAAAACCATAAGGG - Intergenic
1187264883 X:17722140-17722162 ATTCTATTTTAAAACCAGCAAGG + Intronic
1188126234 X:26373054-26373076 ATGGCATTTGTAAACCATTATGG + Intergenic
1188716682 X:33467056-33467078 AGTCCATTTGCAAACATTAAGGG - Intergenic
1188796220 X:34468834-34468856 ACTGCATCTCAAAACCATAAAGG + Intergenic
1189261752 X:39684087-39684109 ATTCAATTTCAAAACCACTAGGG - Intergenic
1189779559 X:44501112-44501134 AATCCATTTCAGAACTATAAGGG + Intergenic
1189900851 X:45704614-45704636 ATTTAACTTGAAAACCAAAAAGG - Intergenic
1193319159 X:80099399-80099421 ATAAAATTTAAAAACCATAAAGG + Intergenic
1193428308 X:81368183-81368205 AGGCCAGTTGAAAACCAAAAAGG + Intergenic
1194204091 X:90989736-90989758 ATCCCATTTGAAAGCCATTTGGG - Intergenic
1194223117 X:91222004-91222026 ATTCCGTTTGAAAAGCATTTGGG + Intergenic
1194828023 X:98586505-98586527 ATTCCATTTAAAAAAAAAAAAGG - Intergenic
1194855127 X:98918732-98918754 ATGCCATGTGGAAACCATTAAGG - Intergenic
1195071477 X:101285186-101285208 ATACCATTTAAAAAAAATAATGG + Intronic
1196019716 X:110978154-110978176 ATACCACTTCAATACCATAAAGG - Intronic
1196297946 X:114020565-114020587 ATTAAATTTGTAAACCAAAAAGG - Intergenic
1196583700 X:117405182-117405204 ATTCCATTTTTAAAGCATAATGG - Intergenic
1198316892 X:135477084-135477106 ATTCCCTCTGAAACCCCTAAGGG + Intergenic
1198759947 X:140021325-140021347 ATTACATTTGGAAACCATCCTGG - Intergenic
1198944747 X:141998091-141998113 ATTCCATTTGCAAAAGTTAAAGG + Intergenic
1199211563 X:145217552-145217574 ATTCCATTTGAAATCTGGAATGG - Intergenic
1199233098 X:145462040-145462062 CTTCCATTAGAAAACAAAAATGG + Intergenic
1199483168 X:148320832-148320854 AATACATTTTAAAACAATAAAGG - Intergenic
1199545331 X:149002743-149002765 ATTGCATTTGTAAACTATCATGG - Intergenic
1199825649 X:151497024-151497046 ATTAAATTTGAAATCAATAAGGG - Intergenic
1200559599 Y:4685423-4685445 ATTCCATTTGAAAAGCATTTGGG + Intergenic
1201332789 Y:12845464-12845486 ATTGCATTTTAAAAACATATGGG + Intronic
1201370923 Y:13263649-13263671 ATTCAATTTAAAAAATATAAAGG + Intronic