ID: 1105728153

View in Genome Browser
Species Human (GRCh38)
Location 13:23186139-23186161
Sequence AAGGCTACTCAGACCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105728153_1105728161 7 Left 1105728153 13:23186139-23186161 CCCTGGCTGGTCTGAGTAGCCTT 0: 1
1: 0
2: 2
3: 22
4: 192
Right 1105728161 13:23186169-23186191 CCCTGACATTCAACTCTGAAGGG 0: 1
1: 0
2: 3
3: 15
4: 138
1105728153_1105728159 6 Left 1105728153 13:23186139-23186161 CCCTGGCTGGTCTGAGTAGCCTT 0: 1
1: 0
2: 2
3: 22
4: 192
Right 1105728159 13:23186168-23186190 ACCCTGACATTCAACTCTGAAGG 0: 1
1: 1
2: 1
3: 17
4: 156
1105728153_1105728163 19 Left 1105728153 13:23186139-23186161 CCCTGGCTGGTCTGAGTAGCCTT 0: 1
1: 0
2: 2
3: 22
4: 192
Right 1105728163 13:23186181-23186203 ACTCTGAAGGGTCTTAGCCTTGG 0: 1
1: 0
2: 1
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105728153 Original CRISPR AAGGCTACTCAGACCAGCCA GGG (reversed) Intronic
900279494 1:1857173-1857195 AAGTCTACCCAGTCTAGCCAAGG + Intronic
900725629 1:4214635-4214657 AAGGCTACCCAGACACGCCAAGG + Intergenic
900864284 1:5256082-5256104 AAGGCTACTAAGACAATGCAAGG + Intergenic
901532130 1:9860196-9860218 CAGGCTCCACAGACCAGGCAGGG + Intronic
902742485 1:18448583-18448605 CAGGCTGCTTAGGCCAGCCAGGG + Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904715838 1:32466942-32466964 AAGACCATTGAGACCAGCCAGGG + Intronic
905043420 1:34977982-34978004 AAAGCTTTTCAGCCCAGCCAAGG - Intergenic
905285568 1:36877806-36877828 AAGTCAGCTCAGACCAGCCAAGG + Intronic
907123906 1:52032799-52032821 AAGGCGACTCAGTTCTGCCATGG + Exonic
907332402 1:53679692-53679714 AAGCATGCTCAGAGCAGCCAAGG - Intronic
912540464 1:110411089-110411111 AAGGATTCTCAGGCCAGGCATGG + Intergenic
912548087 1:110465661-110465683 AAGGCTAATGAGACCAGGCATGG - Intergenic
913683186 1:121206529-121206551 CAGGCAACTCAGAGCAACCAGGG - Intronic
914035027 1:143994154-143994176 CAGGCAACTCAGAGCAACCAGGG - Intergenic
914154426 1:145073817-145073839 CAGGCAACTCAGAGCAACCAGGG + Intronic
916400452 1:164442259-164442281 AAGGCATTTCAGACCAGCAAGGG - Intergenic
916651559 1:166839295-166839317 ACGGCTACCCAGGCCCGCCAGGG + Intergenic
919652083 1:200159941-200159963 AAATCTTCTCAGACCAGGCATGG - Intronic
919906413 1:202081486-202081508 AAGGTTACACAGAGAAGCCAAGG + Intergenic
920470496 1:206225039-206225061 CAGGCAACTCAGAGCAACCAGGG - Intronic
920560621 1:206935868-206935890 AAGGCTTCTCAGGCCACGCAAGG - Intronic
920724890 1:208425472-208425494 AAGGCTTCTCAGAAGATCCAGGG + Intergenic
920948780 1:210553753-210553775 AGAGCTGCTCAGACCACCCAGGG + Intronic
923115095 1:230928954-230928976 AAGACTACGAAGAGCAGCCAGGG - Exonic
1063246398 10:4224176-4224198 AAAGCTACTCAGAACAACCACGG - Intergenic
1063534912 10:6874145-6874167 CATGCTACTCAGTCCAGCCTAGG - Intergenic
1064099798 10:12453565-12453587 AAGGTTACTCAGACAGTCCATGG - Intronic
1064157342 10:12914736-12914758 AAGACAACTCAGGCCAGGCATGG - Intronic
1069616464 10:69809657-69809679 GAGGCCAGTCAAACCAGCCAGGG + Intronic
1069633102 10:69909498-69909520 AAGGGTGCCCAGACCAGCCATGG - Intronic
1070492819 10:76993568-76993590 AAGGCTTCTCAGAACAGCTGGGG + Intronic
1070576273 10:77681413-77681435 AAAGATACTGAGACCAGCCTTGG + Intergenic
1071991160 10:91101999-91102021 TAGGCTACCCAGACCAGAAAAGG + Intergenic
1072297756 10:94027870-94027892 AAGGCTTCTCCTAGCAGCCATGG + Intronic
1072913986 10:99526181-99526203 CTGGCTTCTCACACCAGCCAAGG - Intergenic
1074687618 10:115974811-115974833 GAGGCCACTTAGACCAGGCAGGG - Intergenic
1078761827 11:14257904-14257926 GAGACAACCCAGACCAGCCAGGG + Intronic
1078897750 11:15612623-15612645 GAGGCTTCTCAGCCCAGCAAGGG + Intergenic
1081913969 11:46719276-46719298 AAGGCTACACAGGGCAGCCAGGG - Exonic
1084938031 11:72597556-72597578 TGGGCTTCTCAGACCTGCCAGGG - Exonic
1084939249 11:72603537-72603559 AAGGCTCCTCGGAGCAGCCTGGG - Intronic
1089716856 11:120368431-120368453 AAGGCTACTCAGGTCAGGCATGG - Intronic
1091590210 12:1838275-1838297 ACGGGCACTCAGCCCAGCCACGG - Intronic
1091669257 12:2440695-2440717 AAGGAATGTCAGACCAGCCATGG + Intronic
1093084039 12:14847040-14847062 AATGCTTCTCAAACCTGCCAAGG - Intronic
1094775333 12:33719957-33719979 AATGCTACACAGACAGGCCAAGG + Intergenic
1097168710 12:57099962-57099984 ATGGCTGCTCAGACTACCCAGGG + Intronic
1102725541 12:115061142-115061164 AAGGCCCCTCTGACCTGCCAGGG - Intergenic
1104992446 12:132633767-132633789 TAGGCCTCACAGACCAGCCAGGG + Intronic
1105706296 13:22969516-22969538 GAGGCTAGTCAGAGCAGCCCTGG + Intergenic
1105728153 13:23186139-23186161 AAGGCTACTCAGACCAGCCAGGG - Intronic
1105858947 13:24392974-24392996 GAGGCTAGTCAGAGCAGCCCTGG + Intergenic
1111783949 13:92764095-92764117 ATGGCTACTCAGCTCAGCCAAGG + Intronic
1117788721 14:59315341-59315363 AAGTCTACTTACAGCAGCCATGG - Exonic
1121342475 14:93113961-93113983 ATGCCAGCTCAGACCAGCCACGG + Intronic
1121556816 14:94844353-94844375 ATTGCTTCTCAGAGCAGCCAAGG + Intergenic
1122863743 14:104594329-104594351 AAGCGTCCTCAGGCCAGCCACGG + Intronic
1123582731 15:21731017-21731039 AGGGGTACTCAGAACTGCCAGGG - Intergenic
1123619381 15:22173613-22173635 AGGGGTACTCAGAACTGCCAGGG - Intergenic
1123685855 15:22796765-22796787 ATGGCCTCTCAGACCAGCCCTGG - Intronic
1125709989 15:41777050-41777072 AAGGCTTCACAGGCCAGGCATGG + Intronic
1125832950 15:42729236-42729258 CAGCCTTCCCAGACCAGCCAGGG - Exonic
1126081841 15:44971178-44971200 CAGGCTACTTAGAGCCGCCACGG + Intronic
1127802239 15:62487261-62487283 CAGGCTAGTCAGACCTGCCCTGG + Intronic
1128761179 15:70216989-70217011 AAGGCCACCCAGCCCAGCCCTGG - Intergenic
1129978397 15:79843827-79843849 AAGGCCACTCAGACAAGGGAAGG + Intronic
1133025036 16:2985450-2985472 AAGGCAACTCACACCAGCAAAGG - Intergenic
1133663804 16:7945452-7945474 GAGGCAACTTAGACAAGCCATGG - Intergenic
1136301674 16:29339049-29339071 CCGGGCACTCAGACCAGCCAGGG + Intergenic
1138656538 16:58494905-58494927 CGGGCTCCCCAGACCAGCCAGGG + Intronic
1141413185 16:83850377-83850399 AATGCTACTAAAACCAGGCATGG + Intergenic
1142242576 16:88954327-88954349 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242715 16:88954802-88954824 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242755 16:88954935-88954957 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242761 16:88954954-88954976 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242817 16:88955144-88955166 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242857 16:88955277-88955299 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242863 16:88955296-88955318 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242920 16:88955486-88955508 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142242940 16:88955543-88955565 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243057 16:88955904-88955926 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243070 16:88955942-88955964 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142243083 16:88955980-88956002 AAGGCTCCTGACCCCAGCCAAGG + Intronic
1142876474 17:2854264-2854286 CAGGCTCCTCGCACCAGCCAGGG - Intronic
1142896124 17:2980319-2980341 AAGCTTGCTCAGTCCAGCCAAGG - Exonic
1142961008 17:3552640-3552662 AAGCCTCCTCCGCCCAGCCAAGG - Intronic
1144142004 17:12358748-12358770 CACGCTACTCAGAGCAGCCCAGG + Intergenic
1146445120 17:32927426-32927448 AACGATACTCAGGCCAGGCAGGG - Intergenic
1146734785 17:35229264-35229286 AAGGATTTTGAGACCAGCCATGG - Intergenic
1147228570 17:39000678-39000700 AAGCCTTCTCTGACCAGCCTGGG + Intergenic
1148272924 17:46277930-46277952 AAATCTACCCAGACCAGGCATGG - Intronic
1150335752 17:64329548-64329570 AAGGCTAGTCAGAGAAGCCCAGG + Intronic
1151456888 17:74231845-74231867 AAGGCTACTCTGCCAAGCCAGGG + Intronic
1151693817 17:75703822-75703844 AGGAGTCCTCAGACCAGCCATGG - Exonic
1151946634 17:77323279-77323301 AAGGCCACTCCTTCCAGCCAAGG + Intronic
1154299402 18:13180077-13180099 AGGGCTTCGCAGAGCAGCCATGG - Intergenic
1157491675 18:48127942-48127964 GAGGCTGCCCAGCCCAGCCAAGG + Intronic
1157566158 18:48680517-48680539 AGGGCCACTCAGGCCAGCCTGGG - Intronic
1158041019 18:53093759-53093781 CAGGCTACTCCCAGCAGCCAAGG - Intronic
1162790885 19:13062370-13062392 ATGGCTACACTGACCACCCAGGG - Intronic
1163545932 19:17941610-17941632 AAGGCTCCTCAGCACAGCAATGG + Intronic
1163704218 19:18803053-18803075 AAAGCTACTCAGGCCAGGCACGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1164578497 19:29419698-29419720 AAAGCCACTGAGACCACCCAAGG - Intergenic
1165073129 19:33267138-33267160 CATGCTTCTCAGACCAGCCGAGG - Intergenic
926797546 2:16631047-16631069 AAGGTCACACAGCCCAGCCAAGG - Intronic
927857782 2:26538035-26538057 ACGGCCACTCTGACCAGCCTGGG - Intronic
930110109 2:47671668-47671690 AAGGCTACGAAGCCAAGCCAAGG + Intergenic
932671163 2:73738979-73739001 GAGACTAACCAGACCAGCCAGGG - Intergenic
932695707 2:73954377-73954399 AAGGCAACTCAGGCCGGGCACGG + Intronic
936934860 2:117829452-117829474 AAGGATACTCAGATCAACGAAGG - Exonic
938751451 2:134334686-134334708 AATGCTACTGAGACCAGCTTAGG + Intronic
939268210 2:139903329-139903351 AGTGATACTCAGGCCAGCCATGG + Intergenic
940360005 2:152786931-152786953 AAGGCTGCACAGAACAGCAAGGG + Intergenic
941060205 2:160838342-160838364 AAGGCTTCCCAGAGCAGCCTAGG + Intergenic
941663270 2:168217028-168217050 AAGACTGCTCAGACCTGCCAGGG + Intronic
947238463 2:227969127-227969149 AAAGCAATTCAGACCAGGCATGG + Intergenic
948601532 2:239110349-239110371 AAGTCTCCTGGGACCAGCCAGGG + Intronic
1169108070 20:3014345-3014367 GTGGCTCCTCAGACCAGGCACGG + Intronic
1170921417 20:20683209-20683231 ATGGCCACACAGACCAGGCAGGG - Intronic
1172266722 20:33621850-33621872 CAGGCTGCTCAGAGCAGCCGAGG - Intronic
1173437510 20:43046279-43046301 AAGGCTACTGAGGCCAGGCGCGG + Intronic
1175522884 20:59613491-59613513 AAGGCTACTCCCAGCTGCCAGGG + Intronic
1175875554 20:62227721-62227743 AAGGCTAGGCAGGCCAGCCAGGG + Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1179593717 21:42428309-42428331 AAGGCTGCAAAGACCTGCCAAGG - Intronic
1182076387 22:27498272-27498294 GAGGCCACTCAGAGAAGCCAGGG - Intergenic
1183375417 22:37462016-37462038 GAGGCTTCTCTCACCAGCCAGGG + Intergenic
1183770610 22:39922492-39922514 AAAGCTACCCAGGTCAGCCAAGG + Intronic
1184158384 22:42683795-42683817 CAGGCCTCTCAGAGCAGCCAGGG + Intergenic
1184795604 22:46730892-46730914 AAGCCAACTCAGTCTAGCCAGGG + Intronic
1184840633 22:47050660-47050682 ACAGCTACTAAGAGCAGCCAGGG + Intronic
1184954696 22:47878115-47878137 AAGGCTTCTGAGACCACTCAGGG - Intergenic
949652097 3:6171491-6171513 AAGGCCAATCAGAAAAGCCAAGG - Intergenic
949897325 3:8777988-8778010 AAGCCTCCACAGACCAGCCTGGG + Intronic
950236483 3:11325917-11325939 AAGGGTATTCAAACCAGCAAAGG - Intronic
951170481 3:19536203-19536225 AGGGGTACTTAGAGCAGCCATGG - Intergenic
952288216 3:31988690-31988712 AAGGATACTCAGGCCACCAATGG + Exonic
952541610 3:34373171-34373193 GAGGCTAGTCACACCAGCCAGGG + Intergenic
952962100 3:38598769-38598791 AAGGCTACACAGAACAGAGAAGG + Intronic
953184941 3:40629206-40629228 AAGGCTGCACAGAGCAGCCCTGG - Intergenic
953753194 3:45625018-45625040 AAGGCTGCCCAGGCCAGGCAGGG + Intronic
956319852 3:67984674-67984696 AAGGATACAGAGACAAGCCAAGG - Intergenic
959079879 3:101788904-101788926 AATGCTACTGAGGCCAGGCATGG - Intronic
961151161 3:124639254-124639276 AGGGCTTCTCTGACCAGCCCAGG + Intronic
962579890 3:136788769-136788791 AAGGATACTCAGGCCAGGCATGG - Intergenic
965925471 3:173973789-173973811 TTGGCTACACAGACGAGCCATGG + Intronic
969159951 4:5247973-5247995 AAGTCTGCTCAGGGCAGCCATGG + Intronic
969580659 4:8062732-8062754 AGTGCTACTCAGACCAGGCCGGG - Intronic
970212327 4:13722494-13722516 AAGGCTGCTCAGCTCTGCCAAGG + Intergenic
970417801 4:15876257-15876279 AGGGTTAATGAGACCAGCCAGGG + Intergenic
971022006 4:22546409-22546431 AAGGCTGCACAGAGCAGCAATGG + Intergenic
971356629 4:25901028-25901050 AAGGCTTCTCAGCCCAAGCAGGG - Intronic
972719605 4:41682965-41682987 AAGGCTATTTAGGCCAGGCATGG - Intronic
976730240 4:88254155-88254177 AAATCTTCTCAAACCAGCCAGGG + Intergenic
980225263 4:129975263-129975285 AATGTTACTCAGACCAGAAAAGG - Intergenic
981404901 4:144356636-144356658 AAGTCGGCTCAGACCACCCAAGG + Intergenic
982965638 4:161903019-161903041 AAGGCTACTCATACTAGAAACGG + Intronic
988133077 5:27131556-27131578 AAGTCTATTCAGGCCAGGCACGG - Intergenic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
990032690 5:51281101-51281123 AATGCTACACAGAGAAGCCAAGG + Intergenic
990295200 5:54394762-54394784 AAAGCCAGTCAGGCCAGCCAGGG - Intergenic
993460209 5:88173217-88173239 AAGGCCACCCAGGCCACCCAGGG + Intergenic
997672224 5:135684584-135684606 AAGGCTACTCTCTTCAGCCATGG + Intergenic
999461585 5:151761361-151761383 AAGGGCCCTCAGAGCAGCCAAGG + Intronic
1000842599 5:166239785-166239807 AAGGGTACTAAGACCATTCAAGG + Intergenic
1000886004 5:166747969-166747991 AAGGCTACTCATACCACCCATGG + Intergenic
1001459160 5:171894112-171894134 AAGACTACACAGAGGAGCCAGGG + Intronic
1002478152 5:179481762-179481784 AAAGCTTATCAGAACAGCCAAGG + Intergenic
1002914595 6:1518842-1518864 ACGGCTACTCAGGCCAGCACAGG - Intergenic
1010767600 6:79794066-79794088 CAGGCTGCTCTGTCCAGCCATGG - Intergenic
1012278720 6:97303363-97303385 CAGGCTTCTCAGAACTGCCAAGG - Intergenic
1015567868 6:134592171-134592193 AATGCTCCTCAAAACAGCCAAGG + Intergenic
1016524561 6:144986840-144986862 AAGGGTTCTGAGACCAGACAGGG + Intergenic
1017490674 6:154942058-154942080 AATGCTAATCAGTCCAGGCATGG + Intronic
1018444416 6:163842089-163842111 CAGGGTCATCAGACCAGCCAGGG - Intergenic
1022878571 7:34562603-34562625 AAGACAACTCAGACCAGCAATGG + Intergenic
1023972980 7:45005364-45005386 AAGGATGCTCAGAGCAGCCCTGG - Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1029292742 7:99515108-99515130 AAAGCTGCTCAGAAAAGCCAGGG + Intronic
1032140988 7:129329647-129329669 AAGGCTACTCAGCCTAGCAAAGG - Intronic
1035203480 7:157280523-157280545 AAGGCTGCCCAGGCCAGGCAGGG + Intergenic
1037580223 8:20240875-20240897 AAGGTTACTTAGACCAGCCATGG - Intergenic
1037757465 8:21720454-21720476 AGGGCTCCTCATAACAGCCAAGG - Intronic
1039651262 8:39341341-39341363 AAGGCAACTGTGACCAGGCATGG - Intergenic
1042480234 8:69294641-69294663 CAGGCTTCTCAGGCCAGCCTTGG + Intergenic
1042844333 8:73155286-73155308 AAGTCTTCTCAGACCAGACCTGG - Intergenic
1042930935 8:74013628-74013650 AAGGCTTGTCTGACCAGCCTGGG - Intronic
1043421590 8:80103988-80104010 AAGGCCACTGCGCCCAGCCAAGG + Intronic
1045219558 8:100185134-100185156 CACTGTACTCAGACCAGCCATGG - Intronic
1047734599 8:127754306-127754328 AGGTCTACTCAGGCCAGACAGGG + Intergenic
1050162709 9:2734671-2734693 AAGGCTACTCAACTGAGCCACGG - Intronic
1050917575 9:11157607-11157629 AGGGCTACACAGCCCAGCTATGG - Intergenic
1053352607 9:37423461-37423483 AAGGGTCCTCAGGCCAGTCATGG - Intronic
1053466341 9:38311436-38311458 AAGGCTGCTCACAGGAGCCAGGG - Intergenic
1053538842 9:38952609-38952631 AATGCTACTCAGAAAGGCCAAGG - Intergenic
1054627298 9:67411310-67411332 AATGCTACTCAGAAAGGCCAAGG + Intergenic
1059560554 9:115330571-115330593 AAGGTTACTCAAACCGGGCACGG - Intronic
1060157010 9:121327006-121327028 TAGGCTGCTCAGACCATCCTGGG - Intronic
1061727206 9:132588507-132588529 GAGGCTAGGCGGACCAGCCAGGG - Intronic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1188663731 X:32792118-32792140 AAGGATACTCTACCCAGCCAAGG + Intronic
1189486256 X:41434872-41434894 AAGGCTTTTGAGACCAGCCTGGG - Intergenic
1190865825 X:54383646-54383668 CAGGATCCTGAGACCAGCCAGGG + Intergenic
1191742364 X:64449305-64449327 TAGGCTGCACAGAGCAGCCATGG + Intergenic
1192038725 X:67594200-67594222 TAGGATTCTGAGACCAGCCAGGG - Intronic
1198303358 X:135353373-135353395 AAGGCTATTAAGTCCAGGCATGG - Intronic
1199847803 X:151703597-151703619 CAGGCTACTCAGCCCTGCGAGGG - Exonic
1200979390 Y:9248143-9248165 AAGCATACTCAGACCATGCATGG - Intergenic
1201260124 Y:12150615-12150637 AAGGAAACTCAAACCAGCCTGGG - Intergenic
1202111628 Y:21427379-21427401 AAGCATACTCAGACCATGCATGG + Intergenic
1202116816 Y:21476758-21476780 AAGCATACTCAGACCATGCATGG - Intergenic