ID: 1105728241

View in Genome Browser
Species Human (GRCh38)
Location 13:23186650-23186672
Sequence CCATCCTCACAGGGGATCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105728230_1105728241 28 Left 1105728230 13:23186599-23186621 CCATAATGGTCATTGATTTTGGA 0: 1
1: 0
2: 0
3: 14
4: 269
Right 1105728241 13:23186650-23186672 CCATCCTCACAGGGGATCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105728241 Original CRISPR CCATCCTCACAGGGGATCGG GGG Intronic
900408947 1:2504264-2504286 CCACCCTCCCAGGGGCTCCGTGG - Exonic
901426327 1:9183868-9183890 CCATTCTCACAGGGGAGGGGCGG + Intergenic
903240935 1:21982159-21982181 CCATCTTCACAGGGCTTCTGGGG + Intronic
903804428 1:25994509-25994531 CCATCCTCACAGGGTTGCTGTGG + Intronic
904602719 1:31682821-31682843 CCAGCAGCACAGGGGATGGGAGG - Intronic
915081776 1:153357541-153357563 TCAACCTCAAAGGGGATGGGGGG + Intergenic
915166070 1:153948447-153948469 TCATCCTCACAGGTGAATGGGGG - Exonic
915950542 1:160187258-160187280 GCATCCGCACAGGGGGTAGGTGG + Intergenic
917022629 1:170606439-170606461 CAATCCTTACAGGGGTTTGGAGG - Intergenic
1063675088 10:8133965-8133987 ACATCCTCACAGGAGATCAGTGG + Intergenic
1063675839 10:8140276-8140298 CAACCCTCACAGGAGAGCGGAGG + Intergenic
1069198383 10:65582702-65582724 CCATCATCACAGTGGACCTGAGG - Intergenic
1070776718 10:79114050-79114072 CTGCCCTCAGAGGGGATCGGGGG - Intronic
1071513561 10:86282455-86282477 CTGTCCTCACAGGGGATCCGTGG + Intronic
1072093266 10:92150553-92150575 CCATCCTCACAAGGGATTACTGG - Intronic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1073599054 10:104829018-104829040 ACATCCTCACAGTGGATGAGAGG - Intronic
1076077255 10:127544251-127544273 CCATCCTCAAAGTGGAAGGGTGG + Intergenic
1076646399 10:131957761-131957783 CCATCTCCACAGGGGCGCGGGGG - Intronic
1076646656 10:131958756-131958778 CCATCTCCACAGGGGGACGGGGG - Intronic
1076646667 10:131958793-131958815 CCATCTCCACAGGGGGACGGGGG - Intronic
1076937739 10:133577036-133577058 CCTTCCTCACCGGTGCTCGGGGG + Intergenic
1082771486 11:57211046-57211068 CCATCATCACAGGGCATTGCAGG - Intergenic
1084944778 11:72632720-72632742 CCCTCCTCTCAGGGGAGGGGAGG - Intronic
1085253829 11:75160883-75160905 CCATCCTCATAGGGTAGAGGTGG - Intronic
1085711672 11:78834750-78834772 CCACCCTGGCAGAGGATCGGAGG - Intronic
1089698022 11:120227684-120227706 CCCTCCACACAGGGGACCTGAGG - Intronic
1096974433 12:55691785-55691807 CCATGCTCCCAGGGGAGCTGAGG + Intronic
1098922504 12:76315463-76315485 CCATCCCCACAGGATATCAGAGG + Intergenic
1102447174 12:113012254-113012276 CCATCCTCACAGGGCTTGGCTGG + Intergenic
1104638051 12:130450156-130450178 CCCCACTCACAGGGGCTCGGTGG + Intronic
1105728241 13:23186650-23186672 CCATCCTCACAGGGGATCGGGGG + Intronic
1117067760 14:52027311-52027333 CCATCCTCACAGGGGTTGGCAGG + Exonic
1124797548 15:32796910-32796932 CCATCCTCACAGAGCATGGCTGG + Intronic
1125417251 15:39466685-39466707 CCATCCTCACAGACGCTCTGAGG + Intergenic
1133305412 16:4805166-4805188 TCTTCCTCACATGGGGTCGGGGG - Exonic
1134487227 16:14668076-14668098 CCTTCCTCACAGGGACTAGGAGG + Exonic
1135205282 16:20478699-20478721 CCATCCTCACTGGGGAACAGAGG - Intronic
1135213622 16:20545113-20545135 CCATCCTCACTGGGGAACAGAGG + Intronic
1136685867 16:31994651-31994673 CCATCCACACAAGAGAACGGGGG + Intergenic
1136786477 16:32938184-32938206 CCATCCACACAAGAGAACGGGGG + Intergenic
1136883293 16:33915611-33915633 CCATCCACACAAGAGAACGGGGG - Intergenic
1141942317 16:87285365-87285387 CCGTCCTCACTGGGGATCTTTGG + Intronic
1142254644 16:89007821-89007843 TCACCCTCACATGGGATCAGAGG + Intergenic
1203088713 16_KI270728v1_random:1199850-1199872 CCATCCACACAAGAGAACGGGGG + Intergenic
1144724659 17:17495885-17495907 CCATCCTCACAGGTGAGCCGGGG - Exonic
1145962770 17:28897235-28897257 CCAACCTCACAGTAGAGCGGCGG + Intronic
1146702163 17:34970685-34970707 CCATCCGCAGAGGGTATCTGAGG + Intronic
1146972141 17:37081971-37081993 CCTTCCTCATAGGGTATTGGTGG - Intergenic
1152641397 17:81450760-81450782 CCCTCCTCACAAGGAATCGAGGG + Intronic
1154205042 18:12329147-12329169 CCATCTGCACAGGGGAACTGAGG + Exonic
1155221446 18:23689633-23689655 CCGTCCGCAGAGGGGCTCGGGGG - Exonic
1160858405 19:1227516-1227538 CCATCCTCCCAGGGGCCCGCGGG + Intronic
1161143012 19:2659936-2659958 TGATACTCACAGGGGCTCGGGGG - Intronic
925281406 2:2687885-2687907 CCACCCTCACAGGGGAGGAGAGG - Intergenic
925487728 2:4354690-4354712 CCATTCTCACAGGGCAGGGGCGG - Intergenic
926643031 2:15258230-15258252 CAATCATCACAGTGGATCTGAGG - Intronic
934904103 2:98184288-98184310 CCATCCTTGCAGGGCAGCGGAGG + Intronic
936461957 2:112720920-112720942 CCTCCCTCAAAGGGGCTCGGGGG + Intergenic
937473979 2:122197965-122197987 CCAGCCTCAGAGGGTATCGCAGG + Intergenic
938881852 2:135598231-135598253 TCATCATCACAGGCGATAGGAGG + Intronic
947713926 2:232330544-232330566 CCCTGCTCAGAGGGGATGGGTGG - Intronic
947999869 2:234558990-234559012 CCTGCCTCACAGGGGTTCTGAGG + Intergenic
949057447 2:241936389-241936411 CCTCCCTCACAGGCCATCGGAGG - Intergenic
1175318445 20:58068744-58068766 CCATCCAGACAGGGGATCCCAGG + Intergenic
1183142959 22:35961558-35961580 CCAACCTCACAGGGGTTCCTGGG + Intronic
1184171810 22:42764481-42764503 CCATCCTCACAGCTGCTCTGTGG - Intergenic
1184779131 22:46637564-46637586 CCAGCCTTACAGGGGCTCTGAGG + Intronic
1184895236 22:47402868-47402890 CCCTCCCCACAGGGCCTCGGGGG + Intergenic
950464956 3:13148263-13148285 CCATCCTCACAGAGGGAGGGAGG + Intergenic
952450712 3:33430075-33430097 CCACCCTCACTGAGGATAGGGGG + Intronic
955202689 3:56865122-56865144 CCATCCCCACAGGGAAGTGGAGG - Intronic
959239114 3:103766027-103766049 CCATTCTCGCAGGGGTTAGGCGG - Intergenic
961318864 3:126058664-126058686 CCATCCTCACAGTGCACCTGTGG - Intronic
961678713 3:128584324-128584346 CCTTCCTCCCAGGGGATCTTTGG + Intergenic
967073617 3:185983065-185983087 CCATCCTCACTGGGGACTGCTGG + Intergenic
968760795 4:2442063-2442085 CCATCCTCACTGGGGTGTGGTGG - Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
983627239 4:169814295-169814317 ACTTCCTCACAGGGGATGGTAGG + Intergenic
987309523 5:16668865-16668887 CCATCCGCAAAGAGGATTGGAGG - Intronic
993288706 5:86036700-86036722 CCAGCCTGTCAGGGGATTGGGGG + Intergenic
998458098 5:142289355-142289377 CCCTCCTCACATGGGATTGCTGG - Intergenic
1001525229 5:172424034-172424056 CCATCCTCACTGGGGGTGGGGGG + Intronic
1002660531 5:180788381-180788403 CCACCCTCACAGGAGACCGCCGG + Intergenic
1004692549 6:18004783-18004805 CCAGCCTCACTGGGGATGTGCGG + Intergenic
1005968156 6:30742092-30742114 CCAGACTCACAGGGGTTCTGGGG + Intronic
1007702833 6:43774424-43774446 CTGTCCTCTCAGGGGATGGGTGG + Intronic
1015203013 6:130603613-130603635 CCATCCCCACAGAGCATCGCAGG + Intergenic
1020360802 7:7324574-7324596 CCTTTCTCACAGGGAATCAGGGG - Intergenic
1023562575 7:41491204-41491226 CCCTCCTCACAGGGAATGGTGGG - Intergenic
1023984314 7:45086060-45086082 CCATCCTGGGAGGGGACCGGCGG - Exonic
1024095030 7:45976383-45976405 CCATCCTCACCAGGGCTGGGAGG + Intergenic
1024398440 7:48895020-48895042 CCATCCTCCCAGAGCATGGGTGG - Intergenic
1038777318 8:30542836-30542858 CCACCCTCAGAGGGGCTGGGAGG - Intronic
1040551374 8:48440024-48440046 CCTTCCTCACAGGGGACCCCAGG - Intergenic
1042176840 8:66045748-66045770 CCATCCTCAAAGGGCACCAGAGG + Intronic
1046848930 8:118951707-118951729 CCAACCTCCCAGCGGACCGGCGG - Intronic
1047032803 8:120901387-120901409 CCATTCTCACAGGGAAAAGGTGG - Intergenic
1047256412 8:123216635-123216657 CCATCCTCACACTGGGTCAGAGG - Intergenic
1049415312 8:142492334-142492356 CCCTCCTCACTGGGGAGAGGAGG - Intronic
1054870924 9:70046503-70046525 CCATCCTGACAGAGGGCCGGAGG - Intronic
1061425923 9:130498354-130498376 CCATCCTCTCAGAGGCTCAGAGG + Intronic
1061909416 9:133714890-133714912 ACAACCTCACAGGGAATCTGCGG + Intronic
1062707436 9:137953281-137953303 CCAGCCTCACTGGGGAGCTGAGG - Intronic
1187378425 X:18778516-18778538 CCATTCTCCCAGGTGATCTGGGG + Intronic
1197047064 X:122010324-122010346 CCAATCTCAGAGGGGATCAGAGG + Intergenic
1199297107 X:146171829-146171851 CCATGCTAACAGGGGATCTTAGG - Intergenic