ID: 1105730545

View in Genome Browser
Species Human (GRCh38)
Location 13:23211241-23211263
Sequence CCGTGGGTAAGTAGATCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105730538_1105730545 -4 Left 1105730538 13:23211222-23211244 CCCACAGCAGACCAGAAATCCGT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1105730545 13:23211241-23211263 CCGTGGGTAAGTAGATCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 131
1105730536_1105730545 15 Left 1105730536 13:23211203-23211225 CCTGGTGGGATTGCCTATACCCA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1105730545 13:23211241-23211263 CCGTGGGTAAGTAGATCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 131
1105730539_1105730545 -5 Left 1105730539 13:23211223-23211245 CCACAGCAGACCAGAAATCCGTG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1105730545 13:23211241-23211263 CCGTGGGTAAGTAGATCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 131
1105730537_1105730545 2 Left 1105730537 13:23211216-23211238 CCTATACCCACAGCAGACCAGAA 0: 1
1: 0
2: 0
3: 10
4: 242
Right 1105730545 13:23211241-23211263 CCGTGGGTAAGTAGATCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105730545 Original CRISPR CCGTGGGTAAGTAGATCCCT GGG Intronic
902483682 1:16727269-16727291 CCGTGGGTGTGTAGAGGCCTTGG + Intergenic
902955476 1:19922055-19922077 CTGTGGGTAGGGAGATACCTGGG + Intronic
908968854 1:69800460-69800482 CCATGGTTAAATAGATCCCAAGG + Intronic
911515596 1:98864953-98864975 CCTTCGGTAAATATATCCCTAGG + Intergenic
914918763 1:151833804-151833826 CCCAGGGCAAGAAGATCCCTTGG + Intergenic
916700864 1:167293400-167293422 CCTTGGTTAAGTATATTCCTAGG - Intronic
917746566 1:178014427-178014449 CCTTGGTTAAGTATATTCCTAGG + Intergenic
919544040 1:198890406-198890428 CTTTGTGTAAGTGGATCCCTTGG + Intergenic
923944971 1:238874585-238874607 CCTTGGTTAAGTATATTCCTAGG + Intergenic
924192916 1:241573985-241574007 CCTTGGTTAAGTATATTCCTAGG + Intronic
1064219274 10:13426086-13426108 TCTTGGTTAAGTATATCCCTAGG - Intergenic
1071880618 10:89893373-89893395 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1075158203 10:119998643-119998665 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1075730381 10:124632069-124632091 CCGTGGGTAAGAACAGACCTTGG + Intronic
1076069083 10:127471692-127471714 CCCTGAGGAAGTAGCTCCCTGGG - Intergenic
1078109118 11:8377877-8377899 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1089431827 11:118431208-118431230 CAGTGGTTAAGGAAATCCCTGGG + Intronic
1092605144 12:10110703-10110725 CCTTGGTTAAGTATATTCCTAGG - Intronic
1093387924 12:18582377-18582399 CCTTGGGTCAGGAGATCCCCTGG + Intronic
1098499972 12:71180442-71180464 CCTTGGTTAAGTATATTCCTAGG - Intronic
1105730545 13:23211241-23211263 CCGTGGGTAAGTAGATCCCTGGG + Intronic
1106325633 13:28685839-28685861 CCTTGGTTAAGTAGAGTCCTAGG + Intergenic
1106572815 13:30943215-30943237 CCTTGGTTAAGTATATTCCTGGG + Intronic
1107563034 13:41574345-41574367 CCTTGGTTAAGTATATTCCTAGG - Intronic
1108182064 13:47850162-47850184 CCTTGGTTAAGTACATTCCTAGG + Intergenic
1108791755 13:53977569-53977591 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1109254104 13:60057321-60057343 CCTTGGTTAAGTATATTCCTTGG - Intronic
1112748961 13:102561170-102561192 CCTTGGGTAAGTGTATTCCTAGG + Intergenic
1114203479 14:20545506-20545528 CCTTGGTTAAGTATATCCCTAGG + Intergenic
1115778587 14:36743942-36743964 CCTTGGTTAAGTATATTCCTAGG - Intronic
1116117865 14:40680278-40680300 CCTTGGATAAGTATATTCCTAGG + Intergenic
1117917954 14:60698192-60698214 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1121749499 14:96337989-96338011 CCTTGGTTAAGTATATGCCTAGG + Intronic
1124234283 15:27973901-27973923 CCTTGGTTAAGTATATCCCTAGG + Intronic
1125225651 15:37392543-37392565 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1133375107 16:5279323-5279345 CCTTGGGTAAGTTTATTCCTAGG + Intergenic
1133845025 16:9445520-9445542 CTGTGGGTAAGTAGACTCCGAGG + Intergenic
1136250239 16:28999694-28999716 CCGTGGGCAACTAGAGCCCAGGG + Intergenic
1144510683 17:15872615-15872637 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1144612225 17:16730705-16730727 CCTTGGTTAAGTATATTCCTAGG + Intronic
1144900506 17:18584588-18584610 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1145131940 17:20361093-20361115 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1155727726 18:29109739-29109761 CCTTGGTTAAGTATATTCCTTGG + Intergenic
1159148345 18:64484017-64484039 CCTTGGTTAAGTAGATTACTAGG + Intergenic
1159679623 18:71331954-71331976 CCGTGGTTAGTTATATCCCTAGG - Intergenic
1161906092 19:7157614-7157636 CCGTGGGTCACAAGAACCCTGGG - Intronic
1163192596 19:15688383-15688405 CCTTGGTTAAGTATATTCCTAGG - Intronic
927052015 2:19339201-19339223 CCAGGGGTAAGTGGACCCCTAGG + Intergenic
942981238 2:182084969-182084991 CCTTGGTTAAGTATATTCCTAGG + Intronic
943478738 2:188391324-188391346 CCTTGGTTAAGTATATTCCTAGG + Intronic
944370552 2:198977788-198977810 CCTTGGTTAAGTATATACCTAGG - Intergenic
944524516 2:200604835-200604857 CTGTGGGTATGTAGAACCCCAGG + Exonic
945521124 2:210828726-210828748 CCTTGGTTAAGTATATCCCTAGG + Intergenic
946636086 2:221728743-221728765 CCTTGGTTAAGTATATTCCTAGG - Intergenic
947449002 2:230188205-230188227 CCTTGGATAAGTATATTCCTAGG + Intronic
948642098 2:239382052-239382074 CCTTGGGGAAGCAGAGCCCTTGG - Intronic
1170865138 20:20148468-20148490 CCTTGGTTAAGTATATTCCTAGG + Intronic
1176426202 21:6549953-6549975 CCATGGGGAAGCAGAACCCTTGG - Intergenic
1179701693 21:43158270-43158292 CCATGGGGAAGCAGAACCCTTGG - Intergenic
1183635162 22:39057524-39057546 CAGTGAGTAAGTCGATGCCTCGG + Intronic
951582845 3:24184309-24184331 CCCTGTGTAAGTATTTCCCTGGG + Intronic
952026996 3:29095099-29095121 CCTTGGTTAAGTATATTCCTAGG + Intergenic
953990459 3:47479216-47479238 CAGTGGGCAAGAAGAACCCTTGG - Intergenic
954478814 3:50777631-50777653 CCTTGGTTAAGTATATTCCTAGG + Intronic
955147762 3:56337120-56337142 CCTTTGGTAAGTACATCACTAGG - Intronic
955579182 3:60400512-60400534 CCTTGGGTTAGTAGAGCACTGGG + Intronic
960468197 3:118025327-118025349 CCTTGGTTAAGTATATTCCTAGG + Intergenic
960917426 3:122710766-122710788 CCTTGGTTAAGTATATTCCTAGG + Intronic
962195191 3:133356245-133356267 CCTTGGTTAAGTATATTCCTAGG - Intronic
963279765 3:143371991-143372013 CCTTGGTTAAGTATATTCCTAGG - Intronic
964565240 3:158043399-158043421 CCTTGGTTAAGTATATTCCTAGG - Intergenic
964635618 3:158855368-158855390 CCTTGGTTAAGTATATTCCTAGG + Intergenic
965573635 3:170196160-170196182 CCTTGGTTAAGTATATTCCTAGG - Intergenic
966369445 3:179232692-179232714 CCTTGGTTAAGTACATTCCTAGG + Intronic
967390129 3:188947375-188947397 CCGTGGATGAGAAGATCCCCAGG - Intronic
972519207 4:39837945-39837967 CAGTGGGTCAGGAGAGCCCTGGG - Exonic
979195042 4:117911037-117911059 CCCTGGTTAAGTATATTCCTAGG + Intergenic
980926857 4:139146299-139146321 CCTTGGTTAAGTATATTCCTAGG - Intronic
981087864 4:140702232-140702254 CCCTGGATAAGTGGATCACTGGG - Intronic
981438813 4:144758702-144758724 CCTTGGTTAAGTATATTCCTAGG - Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
988017953 5:25583952-25583974 CCTTGGATAAGTATATTCCTAGG + Intergenic
990400662 5:55434203-55434225 CCTTGGTTAAATAGATCCCTAGG - Intronic
991137269 5:63196662-63196684 CCTTGGTTAAGTATATTCCTAGG - Intergenic
993540185 5:89139686-89139708 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1001166157 5:169370227-169370249 CCTTGGTTAAGTATATTCCTTGG - Intergenic
1005262365 6:24074977-24074999 CCTTGGCTAAGTATATTCCTAGG + Intergenic
1005919431 6:30386625-30386647 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1005930223 6:30477837-30477859 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1007496283 6:42262046-42262068 CCTTGGGGAAATAGTTCCCTTGG - Intronic
1008670575 6:53764394-53764416 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1009710414 6:67310173-67310195 CCTTGGCTAAGTATATTCCTGGG + Intergenic
1011630833 6:89322384-89322406 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1012830152 6:104194284-104194306 CCTTGGGTAAGTATATTCCTAGG - Intergenic
1014203664 6:118631460-118631482 CTTTGGGTGAGTAGATGCCTAGG - Intronic
1015607614 6:134975186-134975208 CCTTGGCTAAGTACATTCCTAGG - Intronic
1016934382 6:149438497-149438519 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1019673499 7:2296293-2296315 CCTTGGGTAACTATATTCCTAGG + Intronic
1021923648 7:25513300-25513322 GAGTCGGTAAGTAGATGCCTGGG - Intergenic
1024375391 7:48631886-48631908 CCCTGGCTAAGTATATTCCTAGG + Intronic
1027626816 7:80555270-80555292 CCTTGGTTAAGTATATTCCTAGG + Intronic
1028037443 7:86003000-86003022 AAGTGGGTGAGTAGATCCTTGGG + Intergenic
1029030121 7:97458381-97458403 GGGTGGGTAAATAGATCCTTGGG - Intergenic
1031835455 7:126676157-126676179 CCTTGGTTAAGTATATTCCTAGG - Intronic
1034459690 7:151191594-151191616 CTGTGGGTAAGCAGCGCCCTTGG - Intronic
1037923444 8:22825616-22825638 CCGAGGGAAAGTAGATCACCTGG - Intronic
1041563762 8:59251162-59251184 CCTTGGTTAAATTGATCCCTAGG + Intergenic
1042366126 8:67938906-67938928 CAGTGGCTAAGTAGTTCTCTGGG - Intergenic
1042429353 8:68687038-68687060 CCTTGGTTAAGTATATTCCTAGG - Intronic
1044555536 8:93558405-93558427 CCATGGGGAAGTAGTTGCCTAGG + Intergenic
1045613610 8:103878325-103878347 CCTTGGTTAAGTATATTCCTAGG + Intronic
1047368201 8:124232220-124232242 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1047908976 8:129505567-129505589 CCTTGGTTAAGTTAATCCCTAGG - Intergenic
1049692082 8:143965884-143965906 CCCTGGGGAAGGAGTTCCCTGGG - Intronic
1050045803 9:1544000-1544022 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1052711654 9:32064107-32064129 CCTTGGCTAAGTATATTCCTAGG - Intergenic
1055309988 9:74968741-74968763 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1056018174 9:82413945-82413967 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1057340055 9:94192376-94192398 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1058104275 9:100952610-100952632 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1061686020 9:132279226-132279248 CCATCGGAAAGTAGATCCCAAGG - Intronic
1062603564 9:137332012-137332034 CCTTGGTTAAGTACATTCCTAGG - Intronic
1187001514 X:15184515-15184537 CCTTGGCTAAGTATATTCCTAGG + Intergenic
1189564251 X:42223859-42223881 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1192075192 X:67987443-67987465 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1192450400 X:71241163-71241185 CCAAGGCAAAGTAGATCCCTCGG + Intronic
1192960504 X:76125882-76125904 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1193057305 X:77167285-77167307 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1193703057 X:84787211-84787233 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1194228544 X:91293140-91293162 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1194385029 X:93242246-93242268 CCTTGGTTAAGTATATTCCTAGG - Intergenic
1196621089 X:117824717-117824739 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1196966292 X:121059335-121059357 CCTTGGTTAAGTATATTCCTAGG + Intergenic
1200203700 X:154300485-154300507 CCTTGGTTAAGTATATTCCTAGG + Intronic
1200336182 X:155353691-155353713 CCTTGGGTCAGGAGATCCCCTGG + Intergenic
1200350288 X:155487536-155487558 CCTTGGGTCAGGAGATCCCCTGG - Intergenic
1200379887 X:155824521-155824543 CTTTGGTTAAGTATATCCCTAGG - Intergenic