ID: 1105731193

View in Genome Browser
Species Human (GRCh38)
Location 13:23218745-23218767
Sequence GTATTAATACAAATAGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105731192_1105731193 5 Left 1105731192 13:23218717-23218739 CCATGACAGGTATTGTGCTGCTT 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG 0: 1
1: 0
2: 0
3: 14
4: 216
1105731191_1105731193 9 Left 1105731191 13:23218713-23218735 CCTTCCATGACAGGTATTGTGCT 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG 0: 1
1: 0
2: 0
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105731193 Original CRISPR GTATTAATACAAATAGACCA AGG Intronic
903576703 1:24343804-24343826 ATATTTATACAAATGGACCTTGG + Intronic
906024739 1:42663970-42663992 GTAATAAAACAATTTGACCAAGG - Intronic
910480355 1:87652123-87652145 GTATTAAAACAAATATTTCAAGG - Intergenic
910924667 1:92386128-92386150 TTATTAATACAAAAAGACTGTGG - Intronic
911091387 1:94019916-94019938 GTCTTAATCCATATGGACCAAGG + Intronic
912303223 1:108537888-108537910 GTATTAATGCTTATATACCATGG - Intergenic
912340914 1:108914302-108914324 AAATTAATTCAAATAAACCAGGG - Intronic
913364958 1:118027253-118027275 GAATTATTAAAAATAGCCCATGG - Intronic
914964522 1:152242734-152242756 GAATCAGTACAAATGGACCAAGG - Intergenic
915790229 1:158661586-158661608 TTATTAATAAAAAGAGGCCAGGG - Intronic
917279362 1:173366263-173366285 GTATTAATACATATCCACAATGG + Intergenic
919290639 1:195625094-195625116 ATATTAAGAAAAACAGACCATGG + Intergenic
924253861 1:242162574-242162596 GTATTAAAAAAAATTGCCCAGGG + Intronic
1063172355 10:3520296-3520318 GAATTAATACAAATACATGAAGG - Intergenic
1064275361 10:13900599-13900621 GTATTAATAAAAATAGGGCCGGG + Intronic
1066552230 10:36571759-36571781 GTATCAGCACAAATAGACTAAGG + Intergenic
1067424648 10:46197091-46197113 GTATTACTACAATAAGACCACGG + Intergenic
1068564391 10:58556215-58556237 GTATGCATACAAATAGAGAAAGG + Intronic
1069164979 10:65143604-65143626 GTTCTAATACAAATAGACAAAGG - Intergenic
1069233114 10:66036724-66036746 GTTTTAATAAAAGTAAACCAAGG - Intronic
1070507677 10:77128751-77128773 TTATTCATATAAATAGGCCATGG + Intronic
1071204428 10:83257017-83257039 ATATTATTATAAATAGACCGTGG - Intergenic
1071486757 10:86107436-86107458 GTATCAATATAACTAGGCCAAGG - Intronic
1072747818 10:97953831-97953853 ATATTATTTCAACTAGACCAGGG + Intronic
1073151940 10:101317664-101317686 GAATAAATACAAAAAGACCACGG + Intergenic
1075199983 10:120394605-120394627 GTATAAAGACAAATAGGACATGG + Intergenic
1079229602 11:18638310-18638332 GTATTTCTATAAATAAACCAAGG - Intergenic
1079653016 11:22954060-22954082 TTTTAAATACAAATAGACCTGGG + Intergenic
1079892667 11:26076873-26076895 GTGTTTATACAAATACCCCAGGG + Intergenic
1079993126 11:27267271-27267293 GTATTAATACATTTAGAAAATGG + Intergenic
1080086102 11:28284708-28284730 CTATTAATATAACTAGAACAAGG + Intronic
1082752025 11:57029719-57029741 GTATTAATACATGTAGACTGAGG + Intergenic
1084976912 11:72805899-72805921 GTAATAATAAAAATAAAACAAGG - Intergenic
1086892654 11:92276183-92276205 ATATTAATACAAATAAAAAAGGG - Intergenic
1087460500 11:98439636-98439658 GTATTAATATAAATAAAATATGG - Intergenic
1087607808 11:100397899-100397921 GAAATAATACAAATAAACAAGGG + Intergenic
1088125233 11:106416322-106416344 GACTTACTGCAAATAGACCAAGG + Intergenic
1088523222 11:110722300-110722322 GTATTAACACATATACACCATGG - Intergenic
1090506905 11:127324978-127325000 ATATTTATAAAAATAGATCATGG + Intergenic
1093496593 12:19764449-19764471 GCATTAATAACAATAGACCGAGG + Intergenic
1094216169 12:27945005-27945027 GAATTAATAGAAGTAGACCCTGG + Intergenic
1095881987 12:47147631-47147653 ATATCAATAGAAATAGAACATGG - Intronic
1097162101 12:57054389-57054411 GTCTTAAAAAAAATAGACAATGG + Intergenic
1097626050 12:62001913-62001935 GTTTTAATACAAATAAAACTTGG + Intronic
1098146642 12:67504282-67504304 CCATTAAAACCAATAGACCAGGG - Intergenic
1099948560 12:89273908-89273930 GTATTAATAGAACCAAACCAAGG + Intergenic
1100733304 12:97498043-97498065 GTAATAATACAAATAGAGGAGGG + Intergenic
1103141839 12:118555338-118555360 TTATTAATACCAATAGCGCAAGG - Intergenic
1104117402 12:125762889-125762911 GTATGAATACAAATAAAACTGGG + Intergenic
1105731193 13:23218745-23218767 GTATTAATACAAATAGACCAAGG + Intronic
1107630653 13:42339381-42339403 GTATTTAAACAAATAGATCCTGG + Intergenic
1108801763 13:54105234-54105256 ATATTAATAAAATTAGCCCAAGG - Intergenic
1108802194 13:54112555-54112577 GTATTAATAGAAACATAACAAGG - Intergenic
1108864589 13:54907337-54907359 GTAGTAATAAAAAGAGAGCATGG + Intergenic
1109005034 13:56863110-56863132 GTAAAAATGCAAATAGTCCATGG - Intergenic
1109108333 13:58284073-58284095 CTATAACTTCAAATAGACCATGG + Intergenic
1109925883 13:69138069-69138091 GTATTAGTGGAAATAGAACATGG + Intergenic
1110006981 13:70284974-70284996 ATAGTAATAAATATAGACCAAGG + Intergenic
1110577902 13:77081200-77081222 GTCTGATTACAAATATACCATGG - Intronic
1111218166 13:85171713-85171735 GTATTAATACATATACACAATGG - Intergenic
1111439819 13:88266453-88266475 GCATACATACAAATACACCATGG - Intergenic
1116940036 14:50782540-50782562 ATATTTATACAATTAGACAAAGG + Intronic
1118886141 14:69867463-69867485 GTATTAACACAATTAGTCTAAGG - Intronic
1120327057 14:83043479-83043501 GTATTATAACAAATAGATAAAGG + Intergenic
1121146458 14:91587332-91587354 GTATTAATAAAAATATACCCTGG + Intronic
1121240368 14:92425576-92425598 GAATTAATACGAACAGACAATGG - Intronic
1127104747 15:55601004-55601026 GTACTAATACATATAGAACGTGG - Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127147660 15:56041468-56041490 ATATTTATATAAATAGACCAAGG + Intergenic
1128959097 15:71981747-71981769 GTGTGAAAACAAATATACCATGG - Intronic
1130378761 15:83354269-83354291 GTCATAATACATATACACCATGG - Intergenic
1131910763 15:97198038-97198060 GTAATAATCCAAATAAAACATGG - Intergenic
1132328303 15:100990580-100990602 GTATTATTACTAATATAACATGG - Intronic
1133590286 16:7236017-7236039 CTATTTATACAAAATGACCATGG - Intronic
1138853036 16:60653405-60653427 GTAATAATATAAGTAGACAAAGG + Intergenic
1139432662 16:66919394-66919416 GTATTAATAGAGATAGCACATGG - Intergenic
1140792390 16:78404506-78404528 TTATTCATACAAATAGAAGAAGG - Intronic
1141146654 16:81535607-81535629 GTATTATTACTAATAGATTAAGG - Intronic
1148225742 17:45896713-45896735 ATATTAATAAAAATACACCCAGG - Intronic
1149181081 17:53937510-53937532 GTATTATTACAAATAAACAAAGG + Intergenic
1149382702 17:56109724-56109746 GTATTAATACAAATTGGGAAGGG + Intergenic
1149947976 17:60952093-60952115 GAATTAATTCAAATAGAACTTGG - Intronic
1153705820 18:7744677-7744699 TTTTTCAGACAAATAGACCAAGG - Intronic
1155460498 18:26076313-26076335 GAATTCATAAAAACAGACCAAGG + Intronic
1155654720 18:28178652-28178674 GTAGTAATAGAAATAGAAAACGG - Intergenic
1159008226 18:63032882-63032904 GTGTTAATATAAATACACAATGG + Intergenic
1159291667 18:66431090-66431112 GTATTCTTACAAAAAAACCATGG + Intergenic
1159894701 18:73985337-73985359 TGATTAAAATAAATAGACCAAGG + Intergenic
1162681027 19:12341538-12341560 ATAGTAATCCAAATAGAACAGGG + Intergenic
1166088179 19:40490629-40490651 GTATAGAGACAAATAGACAAAGG + Intronic
1166929366 19:46292505-46292527 GTATTGATACACATATATCATGG - Intergenic
1167781883 19:51603745-51603767 AAATAAATACAAATAGATCATGG + Intergenic
928350848 2:30552753-30552775 GTAGTTATACAAATAAATCAGGG - Intronic
930294452 2:49536849-49536871 GGATGAATACAAATAGGCCCAGG + Intergenic
930850014 2:55950582-55950604 GGATTAAGACAAAGAGAGCAGGG + Intergenic
931508267 2:62957146-62957168 GAATAAATCCAAATTGACCATGG - Intronic
932062371 2:68516795-68516817 ATATATATACAAATACACCATGG - Intronic
932535235 2:72585829-72585851 GTATGAATACATCTAGTCCAGGG - Intronic
938223127 2:129588896-129588918 ACATTGATACCAATAGACCATGG + Intergenic
938554037 2:132407909-132407931 GTATTAAGATAAGGAGACCAAGG + Intergenic
939648308 2:144729626-144729648 GTAGTAGTACACATACACCATGG - Intergenic
940814772 2:158286092-158286114 GTATTAATATTAGTATACCAAGG + Intronic
943803616 2:192093257-192093279 GTAGTAAGACAAATAAAACAAGG + Intronic
944184233 2:196929451-196929473 GTATTATGACAAATAAACCCAGG + Intergenic
944969735 2:204978420-204978442 GTCTGAATACAAATAGAAAAGGG - Intronic
945528179 2:210915186-210915208 GTACAAAAACACATAGACCAAGG + Intergenic
946967482 2:225053123-225053145 TTATTAATACAACTAGATTAGGG + Intergenic
947060483 2:226159124-226159146 GTACTAATACAAAAACAGCATGG + Intergenic
1169690926 20:8331114-8331136 TTAATAAAACAAATAGACAAAGG + Intronic
1170913489 20:20599160-20599182 GGACAAATACAAAAAGACCATGG + Intronic
1171089987 20:22275910-22275932 ACACTAATACAAATAGATCATGG + Intergenic
1174972521 20:55292367-55292389 GTATTAAGACAAATAAAGCGAGG - Intergenic
1176669448 21:9718748-9718770 GTATAAAAACATATAAACCATGG - Intergenic
1177723753 21:24940852-24940874 CTAATAATAAAAACAGACCATGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
953275385 3:41491093-41491115 GTATTTATTCACATAGACCTTGG - Intronic
955172115 3:56576788-56576810 GGATTAATACACATACACCATGG - Intronic
955446299 3:59014781-59014803 GTAGTACTACATATGGACCATGG + Intronic
955560017 3:60178804-60178826 GTATTCCTAGAAATATACCATGG + Intronic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
956916567 3:73878192-73878214 TTATTAATAAGAATAGATCAAGG + Intergenic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
963237493 3:142970218-142970240 ATATTAATGCATTTAGACCACGG - Intronic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964390139 3:156188101-156188123 ATATTAATAGAAATTCACCAAGG - Intronic
964447930 3:156779982-156780004 GTATGAATGAAAATAGACCAGGG + Intergenic
965080733 3:164028009-164028031 GAATTGATGTAAATAGACCAAGG - Intergenic
965978692 3:174659246-174659268 ATAGTAATACAAATAAACGAGGG - Intronic
966022697 3:175235514-175235536 ATATTAATAAAAATAGAGGAAGG + Intronic
967470859 3:189860421-189860443 TTGTTTATACACATAGACCAGGG + Intronic
967839223 3:193991201-193991223 TTATTCATAAAAATAGATCATGG - Intergenic
967872487 3:194243652-194243674 GTATTAATACATCTGGACAATGG + Intergenic
970843616 4:20508550-20508572 GTATTACTACAAATAGAATTGGG - Intronic
971288962 4:25318104-25318126 GAAATAATACAAAATGACCAAGG - Intronic
971651970 4:29288580-29288602 GTATTATTATAAAAAGACGAGGG + Intergenic
971891307 4:32527056-32527078 ATATTAATAAAAATAGATAATGG - Intergenic
972760085 4:42094743-42094765 GTATCAATACAAATAGCTCTTGG + Intergenic
974571091 4:63649736-63649758 GTAGTAATGCTAAAAGACCATGG + Intergenic
975809698 4:78154386-78154408 GGTTTTAAACAAATAGACCAAGG - Intronic
975921658 4:79398124-79398146 GTCTTAAGATAAAAAGACCAGGG + Intergenic
976132878 4:81903691-81903713 ATATTAATAGAAATAGCCTAAGG - Intronic
979968975 4:127111465-127111487 GTATTAATATATATACACCATGG + Intergenic
980759202 4:137206584-137206606 ATATTAATATAAATAGCACATGG - Intergenic
980814551 4:137926916-137926938 GTATGAATATAAGTAGGCCATGG + Intergenic
980973872 4:139592140-139592162 GTATTATTAAAAATAAATCATGG + Intronic
981292264 4:143090022-143090044 TTATTTATAAAAATAGACAATGG + Intergenic
983813541 4:172094664-172094686 GAATCTATACAAATAAACCATGG - Intronic
985405324 4:189632722-189632744 GTATAAAAACATATAAACCATGG + Intergenic
986179608 5:5381621-5381643 GTTTTAACAACAATAGACCAAGG - Intergenic
987535527 5:19182974-19182996 GCAATAAGTCAAATAGACCATGG - Intergenic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
990111190 5:52327391-52327413 AGAGTAATACAAAGAGACCAGGG - Intergenic
994416152 5:99474399-99474421 GTTTTAATACTTATAGACCCTGG + Intergenic
994463816 5:100100773-100100795 GTTTTAATACTTATAGACCCTGG - Intergenic
996407926 5:123125115-123125137 GTAATTATACAAATTGAGCAAGG - Intronic
996585110 5:125078977-125078999 GTTTTAATACAAAGAGAATAAGG - Intergenic
997462496 5:134063170-134063192 TTATTTAGACAAATATACCATGG - Intergenic
997719070 5:136063781-136063803 TTATTATTACAAACACACCATGG - Exonic
998790204 5:145758288-145758310 TTTTTATTAGAAATAGACCAAGG - Intronic
999447007 5:151648149-151648171 GAATGAATACAAAGAGCCCAGGG + Intergenic
1004028600 6:11843697-11843719 GTATAAATGCAAAAAGACCCGGG + Intergenic
1004756078 6:18611824-18611846 ATATTTATACAAATAGGCTAGGG - Intergenic
1006548130 6:34796486-34796508 GTATTCATTTAAATAGACCTTGG + Intronic
1008759143 6:54833098-54833120 TTATTAAAAAAAATAGGCCATGG - Intergenic
1011372736 6:86655735-86655757 AAATTAATACAAATAGATCATGG + Intergenic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013861687 6:114643296-114643318 GTATTAATTTGAATGGACCAAGG - Intergenic
1014119310 6:117704860-117704882 GTATCCATCCAAATAGACTATGG - Intronic
1014143368 6:117969466-117969488 GTATAAAAACAAATAAACCCAGG + Intronic
1014533491 6:122588638-122588660 ATATTTATACAAATACACGAAGG - Intronic
1014726450 6:124977376-124977398 GTATTAAAATAAATTGAACATGG + Intronic
1014936242 6:127388346-127388368 GTATTAAACCCAATAGACCCTGG + Intergenic
1015017580 6:128432976-128432998 GTATTGATACAAATAGTTAAAGG - Intronic
1015572898 6:134640235-134640257 GTATTTATACACATAGTCAATGG + Intergenic
1016139402 6:140589217-140589239 TTATTATGACAAATACACCATGG + Intergenic
1016259311 6:142148668-142148690 TTATGAAGACAAATAGAGCAAGG + Intronic
1016974499 6:149793989-149794011 GTATTTATATATATAGACAAAGG - Intronic
1018072360 6:160176114-160176136 GTATTAATACATGTTTACCATGG + Intronic
1021550288 7:21863633-21863655 TCATTAATAGAAAAAGACCAGGG + Intronic
1022223209 7:28335049-28335071 GCATAAAGACACATAGACCAAGG - Intronic
1022694959 7:32695870-32695892 ATATTGGTACAAATATACCAAGG - Intergenic
1030498525 7:110329945-110329967 GAAGTAAGACAAATAGACAATGG + Intergenic
1030765798 7:113408268-113408290 GGATTATAAAAAATAGACCATGG - Intergenic
1030992605 7:116318457-116318479 GTATCTATACAAATAAAACATGG - Intronic
1031465298 7:122102594-122102616 GTATTAAAATAAATAGAAAATGG + Intronic
1032674999 7:134121715-134121737 TTATTAATACAGAAATACCAAGG + Intergenic
1033552578 7:142461145-142461167 GTATTAATACAAAAACATCCTGG + Intergenic
1033864722 7:145674718-145674740 GAACAAATACAAATAGAGCAAGG + Intergenic
1034319554 7:150167406-150167428 TTATTAATACAATTTTACCATGG - Intergenic
1035144159 7:156796439-156796461 GCATCAATACAAATAAACAAAGG + Exonic
1037028223 8:14066609-14066631 GTATTAACATGAATAGAGCAGGG + Intergenic
1038985222 8:32801631-32801653 GCATTAATGTAAAAAGACCAGGG - Intergenic
1039316436 8:36377794-36377816 ATATTAATACAAATTGCTCAAGG + Intergenic
1039428649 8:37507379-37507401 GAATAAGTACAAACAGACCAGGG - Intergenic
1039577458 8:38634809-38634831 GTATTAATTCACTTAGGCCAAGG + Intergenic
1042235341 8:66606738-66606760 TTATTGTTACAAATAGACAATGG - Intronic
1044303156 8:90608529-90608551 GAATAAACACAAATAGTCCAAGG - Intergenic
1046707725 8:117474916-117474938 TTAAAAATTCAAATAGACCATGG - Intergenic
1047378878 8:124336105-124336127 GTATTACCAGAAATAAACCAGGG + Intronic
1047541434 8:125770311-125770333 TTATTAATACCCATAAACCAAGG - Intergenic
1048829084 8:138458610-138458632 TTATTTACACAAATAGACCGTGG - Intronic
1051352755 9:16213873-16213895 GTCTGAATACAAACAGGCCAAGG - Intronic
1054994670 9:71372186-71372208 GTATTAATACATATATATAATGG - Intronic
1055812740 9:80168873-80168895 ATAGCAATACAAATAGACTAGGG - Intergenic
1058521138 9:105815097-105815119 ATATTACTACCAATAGAGCAGGG - Intergenic
1059288985 9:113204642-113204664 GAAATAATAGAAAGAGACCAGGG - Intronic
1060039060 9:120284067-120284089 GTTTATATACAAATACACCAAGG + Intergenic
1203656419 Un_KI270753v1:2188-2210 GTATAAAAACATATAAACCATGG + Intergenic
1186731551 X:12415876-12415898 CAAATAATACAAATATACCATGG - Intronic
1186957352 X:14698175-14698197 TTATTAATACAAAAAATCCATGG - Intronic
1189146075 X:38656238-38656260 GTATTAATACAATTAATACAGGG + Intronic
1189942087 X:46135042-46135064 GTATTATTAAAAATAGAGGATGG + Intergenic
1190629108 X:52367989-52368011 GTATGAATAAAAATTGGCCAAGG + Intergenic
1191801981 X:65091860-65091882 TTATTAATTCAAATAAAACAGGG + Intergenic
1192765601 X:74136918-74136940 GTCTTATTACAAATGGGCCATGG - Intergenic
1193335399 X:80282302-80282324 GTATGAAAAGAAATAGACAAAGG - Intergenic
1194869844 X:99116003-99116025 CTATTAAGACAAATAAACCTGGG - Intergenic
1195895258 X:109739702-109739724 GGATTAATACAAAAAGCCAATGG - Intergenic
1196240190 X:113334792-113334814 TTATGAATACAATTAAACCATGG + Intergenic
1196576145 X:117321402-117321424 GTATTAATACATATACACAATGG - Intergenic
1197456720 X:126685123-126685145 ATATTAATAAAGATAGTCCACGG + Intergenic
1198325424 X:135566526-135566548 GTATTAATAAAAAGAAAACAAGG - Intronic
1199233074 X:145461852-145461874 GTATTAATGCATATTGACCTTGG - Intergenic
1199932580 X:152539023-152539045 TGATTAATAAAAATAGAGCAGGG - Intergenic
1200815682 Y:7529761-7529783 ATATTAATACATATTGACCTTGG + Intergenic
1202120197 Y:21512828-21512850 GTATTTTTAAAAATAGACAAGGG - Intronic
1202122648 Y:21536369-21536391 GTATTTTTAAAAATAGACAAGGG - Intronic
1202156357 Y:21893014-21893036 GTATTTTTAAAAATAGACAAGGG + Intronic
1202158805 Y:21916555-21916577 GTATTTTTAAAAATAGACAAGGG + Intronic
1202185256 Y:22181470-22181492 GTATTTTTAAAAATAGACAAGGG + Intronic
1202206104 Y:22404925-22404947 GTATTTTTAAAAATAGACAAGGG - Intronic