ID: 1105734519

View in Genome Browser
Species Human (GRCh38)
Location 13:23254236-23254258
Sequence CAAAATGCTGTTAGAAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 10, 3: 59, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105734519 Original CRISPR CAAAATGCTGTTAGAAATGT GGG Intronic
904125957 1:28238705-28238727 CAAAATGCTGTTTTAACTGATGG - Intronic
904271124 1:29350698-29350720 CATAATGGTGTTGGAAATGATGG - Intergenic
904777935 1:32923152-32923174 CATAATGCTGCTATAAATATTGG - Intergenic
905208906 1:36359784-36359806 GAACATCCTGTTAGAAAGGTGGG - Intronic
906887358 1:49664707-49664729 CAGAAAGCTGTCAGAAATGTGGG - Intronic
907138426 1:52161150-52161172 TAATTTGCTGTTAGAAATTTTGG - Intronic
907528384 1:55068632-55068654 CAAGCTGCTTTTAGATATGTGGG - Exonic
907539898 1:55205315-55205337 CAAAATGCTGTGAGATATGGGGG + Intronic
909119065 1:71577405-71577427 CAAAAAGCTGTCAACAATGTTGG + Intronic
910740872 1:90514740-90514762 AAAAATGCTCTGAGAACTGTGGG + Intergenic
911377467 1:97068714-97068736 CAACATTTTGTTAGAAATGTAGG + Intergenic
911989187 1:104670623-104670645 CAAAAGGCTGGTAGGAATGGTGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913201369 1:116497443-116497465 CAAAATGCTGTTAGGTAAGTGGG - Intergenic
914402409 1:147335087-147335109 TAAAATGCTTTCAGCAATGTCGG + Intergenic
914433921 1:147643318-147643340 CAATAGGCTCTTGGAAATGTCGG - Exonic
917450543 1:175144144-175144166 GAAAATGCTATGAGAACTGTTGG + Intronic
918794147 1:188871350-188871372 CAAAATGCCATTAGCAATGCTGG + Intergenic
919342611 1:196332460-196332482 AAAAATACTGTAAGAAAGGTTGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919675189 1:200375247-200375269 CCAACTGCTCTTAGAAATATTGG + Intergenic
922638705 1:227204636-227204658 TGAAATGCTGTTAGAGATATTGG - Intronic
923851488 1:237800956-237800978 CAAAATGCTATGAGAACTGAGGG + Intronic
924310678 1:242739844-242739866 TAAAATGCTGTTTTAAATTTTGG - Intergenic
1063296221 10:4809549-4809571 CAAAAGGCTCATAGAACTGTTGG + Intronic
1063355166 10:5392265-5392287 CAAGAAACTGTTAGAAATGGAGG + Intergenic
1064267830 10:13839310-13839332 CAAAATGCCTTTAGAAATGGTGG - Intronic
1064760281 10:18611871-18611893 CTAAATGCTGTTAGAACTGAGGG - Intronic
1065217504 10:23463589-23463611 AAAAATTATGTTAAAAATGTTGG + Intergenic
1065780404 10:29161569-29161591 AAAAATTATTTTAGAAATGTGGG - Intergenic
1066165442 10:32783693-32783715 AATAATGCTGTTATAAATGCTGG - Intronic
1067493145 10:46733462-46733484 AAAAGTGCTGTGAAAAATGTTGG + Intergenic
1067589121 10:47494436-47494458 CAAATTGCTATTGGAAACGTTGG - Intergenic
1067601516 10:47606944-47606966 AAAAGTGCTGTGAAAAATGTTGG - Intergenic
1067636246 10:48002527-48002549 CAAATTGCTATTGGAAACGTTGG - Intergenic
1071246140 10:83766247-83766269 CTAGATACTGTTAGATATGTTGG + Intergenic
1071608872 10:87017542-87017564 CAAATTGCTATTGGAAACGTTGG + Intergenic
1071803161 10:89087208-89087230 CTAAGTGCTTTTGGAAATGTGGG + Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074599853 10:114902517-114902539 CAAAATGCAGTTACAATTGTGGG - Intergenic
1076786611 10:132752779-132752801 CAAAATGCTGAGAGAAAAGGAGG - Intronic
1077379148 11:2220400-2220422 TAAAATGCTGATAGACATGCAGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078236480 11:9489738-9489760 CATAGTGCTGTTAGAAAGGAGGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079137506 11:17784208-17784230 CAAAAAGCCGTTAGGAATATGGG + Intergenic
1079434387 11:20432501-20432523 AATAGTGCTGTTATAAATGTGGG + Intronic
1079740810 11:24057904-24057926 CAAAATTCAGGTAGCAATGTGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1081127258 11:39336865-39336887 AAGAATGCTGCTATAAATGTGGG + Intergenic
1082678619 11:56141527-56141549 CAAAATGTTATTATAGATGTTGG - Intergenic
1082708086 11:56518321-56518343 CAAAGTGCTGGTAGAAATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082832735 11:57631211-57631233 CAACCTTCTGTTAGAAATCTGGG + Intergenic
1084626046 11:70308004-70308026 CAAAATGTATTTAGAAATATGGG + Intronic
1085959715 11:81446745-81446767 AAAAATGGTGGGAGAAATGTTGG - Intergenic
1087777179 11:102267250-102267272 TAAAATGCTTTGAGAAATGATGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088006092 11:104942396-104942418 AACAATGCTGCTATAAATGTGGG + Intergenic
1088838931 11:113606185-113606207 CAAAAAACAGGTAGAAATGTGGG - Intergenic
1091129212 11:133130374-133130396 AAAAATGTTTTTAGAAATATTGG + Intronic
1091852236 12:3708810-3708832 CAAAATGTTGTCATTAATGTTGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093944447 12:25091536-25091558 AATAGTGCTGTTAGAAACGTAGG + Intronic
1094071535 12:26420040-26420062 CAAAAGGCAGTATGAAATGTGGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095955937 12:47806069-47806091 CAAGAAGCTGTTAGAAAGGGCGG - Intronic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097801126 12:63915733-63915755 ATAAATGCTGTTTGAAAGGTTGG - Intronic
1098003349 12:65968930-65968952 CAAGATTTTGTTAGAAATATTGG - Intergenic
1098232713 12:68389396-68389418 ATCTATGCTGTTAGAAATGTAGG - Intergenic
1098996578 12:77127757-77127779 AACAATGCTGTTATAAATATGGG - Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099599563 12:84716230-84716252 CAAAATGCTGGCAAGAATGTGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100102587 12:91126902-91126924 CAAAGTGATATTAGAAATTTGGG - Intergenic
1100128735 12:91463150-91463172 GAAAATGCTGTCAAAAATATTGG - Intergenic
1101479921 12:105086425-105086447 CAAAATGCAGTCAGGAAAGTGGG - Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102398238 12:112605993-112606015 AAAAATTCTGTTAAAAAAGTGGG + Intronic
1102411465 12:112723563-112723585 CAAAATGCCATTAGTGATGTTGG - Intronic
1102417593 12:112777917-112777939 CAAAATGCTTTTTGTCATGTAGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1106039459 13:26075788-26075810 CAAATAGCTTTGAGAAATGTAGG + Intergenic
1107234338 13:38150902-38150924 CCAAATGCTGGTAAAGATGTGGG + Intergenic
1107316906 13:39142406-39142428 TAAAATGTTATCAGAAATGTTGG + Intergenic
1108325336 13:49325350-49325372 CAATATGCTGTTACAATTTTAGG + Intronic
1108633947 13:52314230-52314252 AAAAATGCTGTTATAAATTGAGG - Intergenic
1109050977 13:57480999-57481021 CAAAAAGCTGTAAGAAAGGTAGG + Intergenic
1109119621 13:58438295-58438317 CCAAATTCTGTTAGAAATTTAGG - Intergenic
1109274770 13:60291168-60291190 CAACATGCAGTAAGAAATGATGG + Intergenic
1109348040 13:61141114-61141136 TAAAATATGGTTAGAAATGTGGG + Intergenic
1109508287 13:63336056-63336078 CAAAATGCTCTGAAAAATCTCGG - Intergenic
1110465353 13:75793852-75793874 AAAAATGCTGTTAGAAGTCAGGG - Intronic
1111537765 13:89626535-89626557 TAAACTGCTTCTAGAAATGTAGG + Intergenic
1111985623 13:95063740-95063762 TAAAATGCTGGTAAAAAGGTGGG + Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114471313 14:22964846-22964868 GAAATTTCTGTTATAAATGTTGG + Intronic
1114728867 14:24969171-24969193 CAAAATGGTTTTAGATTTGTAGG - Intronic
1114772358 14:25442606-25442628 CAAAATGCTTTTAGAATTGGTGG + Intergenic
1114887765 14:26875693-26875715 TAAAATGTTGTTAGTAATGGTGG + Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1115940982 14:38609371-38609393 CCTAATGTTGGTAGAAATGTGGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116339954 14:43709703-43709725 CAGAATGCGGTCAGAAATGATGG - Intergenic
1116459480 14:45155908-45155930 TAAAAAGCTGTGAGAAATTTTGG + Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117553996 14:56866054-56866076 CAAAGTGTTTTTAAAAATGTGGG - Intergenic
1118241525 14:64063998-64064020 CAATATGCTGTAATAAAAGTTGG + Intronic
1119234458 14:73007682-73007704 TAAAATCCTGTTTGAAATTTAGG - Intronic
1119373544 14:74168690-74168712 CTAAATGCTGTTTGAAAAGCTGG - Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124059322 15:26274693-26274715 AAGACTGCTGTTAGAAATCTGGG + Intergenic
1125173141 15:36789971-36789993 CTAAAGGGTGTTATAAATGTTGG + Intronic
1125334317 15:38612913-38612935 CAAAATGTAGTAAAAAATGTAGG + Intergenic
1125452461 15:39823638-39823660 CTAACTGCTGTTAAAATTGTTGG - Intronic
1126132979 15:45361759-45361781 CAAAAGGCAGCTTGAAATGTTGG - Exonic
1126314899 15:47359716-47359738 CACATTTCTGGTAGAAATGTTGG - Intronic
1126617205 15:50596579-50596601 AAAGATGTTGTGAGAAATGTGGG + Intronic
1126656143 15:50980110-50980132 CAGAAAGTTGTTAGAAATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126862115 15:52895368-52895390 CAAAATGCCCTTAGATATGTGGG - Intergenic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1132296610 15:100739555-100739577 AACAATACTGTTAGCAATGTTGG - Intergenic
1135461168 16:22644323-22644345 CTAAATTGTGTCAGAAATGTGGG + Intergenic
1135894927 16:26390976-26390998 AAGAATTCTGATAGAAATGTTGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137264171 16:46855126-46855148 CAAAGTGCTGAAAGAAATGCAGG + Intergenic
1137880411 16:52040025-52040047 AATAATGCTGTTATAAATATTGG + Intronic
1138972163 16:62158908-62158930 CAAAATGTTTTTAAAAATCTTGG - Intergenic
1139003816 16:62546728-62546750 TAACAAGCTGTTAGAAAGGTTGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1140676756 16:77339730-77339752 GAAAATGTTAATAGAAATGTTGG - Intronic
1140690249 16:77476768-77476790 TAAAATGCTAATAGAAATGGTGG - Intergenic
1141613217 16:85195578-85195600 CCAAATGGTGTCAGAAATATAGG - Intergenic
1142010952 16:87713876-87713898 CTAAAAGCTTTTAGAAATCTAGG + Intronic
1142868564 17:2806209-2806231 GAAAATCCTGCTAGAAATGAAGG + Intronic
1143112700 17:4561121-4561143 CAGAATGAATTTAGAAATGTTGG - Intergenic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1147295562 17:39479451-39479473 CAGAATGCAATTAGTAATGTTGG + Intronic
1147302757 17:39542933-39542955 CAAAATGCTCTTTGAAGTTTGGG - Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149104571 17:52946491-52946513 CAACCTGGTGTCAGAAATGTTGG - Intergenic
1150206379 17:63411831-63411853 CAAAATGCTGTTAAAGATCAAGG + Intronic
1150330295 17:64288727-64288749 CAAAGTGCTGTTGGAAATTGAGG + Intergenic
1153266141 18:3271564-3271586 GAAACTGCTGTCAGAAATGATGG - Intronic
1155444671 18:25898816-25898838 CTAAATGATGTTAGAAATGGAGG + Intergenic
1155671937 18:28382208-28382230 CAAAAAGCTGTAAGGCATGTAGG + Intergenic
1155713391 18:28910169-28910191 TCAAATGCTGTTATAAATTTAGG + Intergenic
1155981471 18:32184622-32184644 CAAAATGCTGTTGCTAAAGTGGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156284295 18:35675989-35676011 CAAAACTCTGTTATAAATGGTGG - Intronic
1156764538 18:40635763-40635785 CTAAAAGGTGTTAGAAATCTTGG - Intergenic
1157011002 18:43648652-43648674 CACTATGAAGTTAGAAATGTTGG + Intergenic
1157762437 18:50274647-50274669 CAAAATGTTGCTGGAAATGGGGG - Intronic
1157900425 18:51509952-51509974 TCAAATGCTGTGAGAAGTGTTGG + Intergenic
1158576168 18:58640345-58640367 CACCATGCTGTTTCAAATGTAGG + Intergenic
1159767531 18:72508539-72508561 TAAAATACTGATAGAAATGAAGG + Intergenic
1160302947 18:77703067-77703089 CAAAATCCTGTTATAAATCAGGG + Intergenic
1161218645 19:3107609-3107631 CAAAATGCTATTACAAAAGATGG - Intronic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
925436778 2:3845242-3845264 CAAAAGGCACTAAGAAATGTTGG + Intronic
929181149 2:39040785-39040807 AATAATGCTGCTATAAATGTTGG + Intronic
929231712 2:39567132-39567154 CAAAATGCTCTTCTAAAAGTAGG - Intergenic
929312866 2:40445804-40445826 CAAAATGATCTTTCAAATGTTGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931060230 2:58520518-58520540 TAAAATGCTTTTTCAAATGTTGG - Intergenic
931107065 2:59067787-59067809 CATACTGCTGCTAGAAATCTGGG + Intergenic
931616713 2:64166706-64166728 CAAAAAAGTGCTAGAAATGTAGG - Intergenic
931724869 2:65100099-65100121 GAAAATGTTTTTAGAAATATGGG + Intronic
932557515 2:72838222-72838244 TAAAATTCTTTTGGAAATGTAGG - Intergenic
933234935 2:79854259-79854281 CAAAATGCAGTAAGAAGAGTTGG - Intronic
934095001 2:88593293-88593315 CAAAAAACTGTTAGAGCTGTCGG - Exonic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
936756252 2:115716207-115716229 GAAAATGCAGTTAGAACTGAAGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
939290300 2:140185574-140185596 CGAAATCCCGTTAGATATGTAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940355381 2:152736387-152736409 CAAAATGCTTTCTGAAATCTGGG - Intronic
940383083 2:153038402-153038424 CAAAATGTTGTGAGAGGTGTTGG - Intergenic
940838530 2:158552529-158552551 CAAAACGTTGGTAGAAATGTGGG + Intronic
943224586 2:185154109-185154131 CAAAATGTTGTACGAAATGATGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946562863 2:220932245-220932267 CCAAAGGCTGTTAGGTATGTAGG + Intergenic
946813026 2:223546785-223546807 AAAAATGCTGTCAGAAAAGTAGG + Intergenic
946974515 2:225133357-225133379 CAAGATGCTTGTAGCAATGTGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947498638 2:230656904-230656926 CAAGAGGCTTTTAGAAATGCAGG - Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1170132386 20:13034796-13034818 AAAAATGCTGTTATAGATGATGG + Intronic
1171083860 20:22217800-22217822 CCAAATACTGTAAGAAAAGTAGG + Intergenic
1173159845 20:40644283-40644305 CCCAAGGCTGCTAGAAATGTTGG - Intergenic
1173566749 20:44044826-44044848 AATAATGCTGCTAGGAATGTGGG - Intronic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177858234 21:26423340-26423362 CCAAAGGCTGAGAGAAATGTAGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178158169 21:29879236-29879258 AAAAATGCTGTTGGAATTGGTGG + Intronic
1181296778 22:21846657-21846679 TCAAATGCTGTTAGACCTGTGGG + Intronic
1181843176 22:25682862-25682884 AAATATGCTGTTAGAAATCTGGG - Intronic
1182458284 22:30466709-30466731 CAAAATGGGGATAGCAATGTAGG - Intronic
1183843713 22:40522473-40522495 CAAGATGCTGTGAGATGTGTTGG + Intronic
949322655 3:2828452-2828474 CAAAATGATGTTTAAAATGTTGG + Intronic
949587959 3:5461474-5461496 GAAAATGCTTTTAGAGATGGGGG - Intergenic
950912406 3:16607891-16607913 CAAAATGTTGTTACATATGTGGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951309097 3:21102015-21102037 CAAAATCCTGTGAAAAATGTTGG + Intergenic
951953974 3:28233462-28233484 CCAAGTCCTGTGAGAAATGTAGG + Intergenic
952643627 3:35628771-35628793 CAAAAAGCTTTTTGATATGTAGG + Intergenic
952665042 3:35894321-35894343 GAAAATGCTTTTAGAAATGAAGG - Intergenic
954714370 3:52519762-52519784 CACACTGCTGTCAGGAATGTGGG - Intronic
955181943 3:56681026-56681048 CAAAATTTAGTTTGAAATGTGGG - Intronic
955957009 3:64301143-64301165 AAAAAAGCTGGTAGAAATGAGGG + Intronic
956191134 3:66609749-66609771 AAATATGCTTTGAGAAATGTTGG + Intergenic
956632478 3:71330270-71330292 AGAAATGCTCTTAAAAATGTGGG - Intronic
956810549 3:72860016-72860038 TAAAATGCAGTTAGCAATTTTGG + Intronic
957282231 3:78168625-78168647 GAAAATGCAGTTACAAATATAGG + Intergenic
957602313 3:82353593-82353615 CAAAATGCTATTAAAAACATGGG + Intergenic
957722613 3:84023662-84023684 CTAAAAGCTTTTAGAAATTTAGG + Intergenic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959604449 3:108226908-108226930 CAAAATGCTATTAAAACTATGGG + Intergenic
960544790 3:118901955-118901977 CAAAATTCAGTAAGAAATGGGGG - Exonic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
964107393 3:153054095-153054117 CATAAAGCTCTTAGAAATCTTGG - Intergenic
964656684 3:159074695-159074717 CTAAATTTTGTTAGAATTGTTGG - Intronic
964696895 3:159518690-159518712 CTAAAAGCAGATAGAAATGTAGG + Intronic
964730666 3:159861184-159861206 CACAATGCTGCTAGTAAGGTGGG + Intronic
964734555 3:159903261-159903283 CAAAATGCATTTAGAGGTGTTGG - Intergenic
964857881 3:161166711-161166733 CAAAATCATATTATAAATGTGGG + Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965446067 3:168776139-168776161 GCAAAAGCTGTTAGAAATGGAGG - Intergenic
965579392 3:170251251-170251273 TAAAATCCTGTTGGAAATTTGGG - Intronic
965627534 3:170696613-170696635 CAGAACACTGTTTGAAATGTGGG - Intronic
965757151 3:172039216-172039238 TAAAATGCTGTGGGAAATGTGGG + Intergenic
965957208 3:174385543-174385565 AAAAATGGTGTTAGAAAAGTTGG - Intergenic
966003623 3:174981343-174981365 TAAAATACTTTTAAAAATGTTGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967054619 3:185820332-185820354 TAAAATGCTGTTAAAAGTTTTGG - Intronic
967192182 3:186994200-186994222 CAAGAGGCTGTCAGAACTGTGGG - Intronic
968032423 3:195511746-195511768 CAAAAGCCTGGTACAAATGTTGG - Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969218900 4:5746566-5746588 CAGAATGTTCTTAGAACTGTGGG + Intronic
969392347 4:6900340-6900362 AAAAATGCTGTGAGAAAGGGTGG + Intergenic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970136621 4:12932306-12932328 CAAAATGAGGTTAGAGATGCTGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970784383 4:19778643-19778665 CAAAAAACTCTTAGAAATGATGG - Intergenic
970915095 4:21322903-21322925 CAAATTGCTGTTAGATATAATGG - Intronic
970928497 4:21481827-21481849 AAAAATAATGTGAGAAATGTAGG + Intronic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
971966715 4:33568129-33568151 CAATATTTTCTTAGAAATGTTGG + Intergenic
972043486 4:34634575-34634597 AACACTGCTTTTAGAAATGTTGG - Intergenic
972133653 4:35865008-35865030 CAAAATGATGTTAGATCTGCAGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974226917 4:59058409-59058431 CAAAATGCGGTTAATAATGCTGG + Intergenic
974483866 4:62480774-62480796 CAACATGGTGTTAGAAATTATGG - Intergenic
974922237 4:68256111-68256133 CATTTTGCTGTTAGAAATGAGGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
975586647 4:75956583-75956605 GAAAATGATGTTGGAAATGTAGG + Intronic
976098854 4:81539058-81539080 GAAAATGACGTTAGAAATGATGG + Intronic
976585510 4:86792330-86792352 ACAAATGCTCTTAGAAATATGGG + Intronic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977802262 4:101249211-101249233 TAAAATGCTTTTCTAAATGTAGG + Intronic
977900863 4:102420938-102420960 AAAAATGCTATTAGCAATGAGGG + Intronic
978684599 4:111424252-111424274 CAAAATGCAGTTAGAAATTGAGG - Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979342185 4:119538535-119538557 TAAAATGCTGTTTGAAATTGGGG - Intronic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
980518034 4:133890116-133890138 TAAAATGTTGTTAGAACTGAAGG - Intergenic
980553159 4:134366834-134366856 CAAAATGCAGTGAGACCTGTAGG - Intergenic
980668179 4:135967612-135967634 CCAAATGCTGGCAAAAATGTGGG - Intergenic
980805004 4:137801139-137801161 TAAAATGCTATTTGAAATTTGGG - Intergenic
980972941 4:139583874-139583896 CAAAATGCTGTTAGGAAGGCAGG - Intronic
981249838 4:142586507-142586529 CAAAATGCTGTTGGGAATAATGG - Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981856568 4:149300885-149300907 CAAAAGGCTTTAAGAAAAGTAGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982883184 4:160745447-160745469 CAAAAAGCAGTTAGAAGAGTGGG - Intergenic
983167028 4:164490452-164490474 CAATTTCCTGCTAGAAATGTAGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984168756 4:176335463-176335485 CAAAGGGCAGTTAGAACTGTTGG + Intergenic
984268027 4:177517279-177517301 GAAAATCCTTTTAGAATTGTAGG - Intergenic
986062545 5:4205297-4205319 TAAAATGCTGTTTCGAATGTAGG - Intergenic
986117366 5:4790325-4790347 ACAAATGCTGGTAGAAAAGTTGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987647851 5:20698879-20698901 AAAAATGATGCTATAAATGTGGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988050141 5:26017163-26017185 AATAATGCTGCTATAAATGTTGG - Intergenic
988213896 5:28246435-28246457 AATAATGCTGTTATAAATATTGG - Intergenic
989014643 5:36916450-36916472 CAAAATGCTGTAAAAATTGAGGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
992181592 5:74203094-74203116 CAAAACGCTATTAAAAATATTGG - Intergenic
992848808 5:80782908-80782930 CAAAATGTTGTCAGAAATTAAGG + Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993248268 5:85480404-85480426 AAAAATGCTGTTAAAAGTGGAGG - Intergenic
993460885 5:88179620-88179642 AAACATGCTGTTGGAAATCTGGG - Intergenic
994205087 5:97025687-97025709 TAAAATGCAGTTAAATATGTAGG - Intronic
994251218 5:97539861-97539883 TAAAATTGTGTAAGAAATGTGGG + Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994969876 5:106722198-106722220 CAATATGCCATGAGAAATGTGGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
996075882 5:119193253-119193275 AAAAATGCTGGGAGAAAGGTTGG - Intronic
997777318 5:136622535-136622557 GAAAATCATGTTAGAATTGTAGG - Intergenic
998977781 5:147667449-147667471 AAAAGTGATCTTAGAAATGTAGG + Intronic
1001908176 5:175490586-175490608 AAAACTGGTATTAGAAATGTAGG + Intronic
1003219660 6:4147916-4147938 AAAAATGCTGCTATGAATGTAGG + Intergenic
1003509783 6:6769893-6769915 CAAAATGCAGCTAGAATTGTGGG + Intergenic
1004930424 6:20457959-20457981 CAAATTGCTATGAAAAATGTGGG - Intronic
1005318389 6:24627216-24627238 CAGAATGCTGTAAGAATTATGGG + Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007544449 6:42681797-42681819 AATAATGCTGCTATAAATGTGGG - Intronic
1008170861 6:48203691-48203713 CAAAATGAAGATGGAAATGTTGG + Intergenic
1008749244 6:54711924-54711946 CAAAATGCTTTTCTAAATTTTGG + Intergenic
1009016770 6:57913870-57913892 AAAAATGATGCTATAAATGTGGG - Intergenic
1010103586 6:72141069-72141091 CAAAATATTGTTGGAAATATTGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011048356 6:83112748-83112770 CATAATGCTGTTAGGCATGGTGG - Intronic
1011796383 6:90958135-90958157 CTAAATGCTAGTAGAAATATGGG - Intergenic
1011939239 6:92822117-92822139 TAAAAGGCTGTTTGAAATGGTGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1013815651 6:114094459-114094481 CAAATTCCTGTTAGAAATGTAGG + Intronic
1014598534 6:123377454-123377476 CAAAATGTTATTAGAAATGAAGG - Intronic
1014974351 6:127860572-127860594 CAAAAGACTGTAGGAAATGTTGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015308978 6:131743949-131743971 CCAAATGCTATTGGAAATATTGG - Intronic
1015398734 6:132764482-132764504 CACATTGCTGTTGGGAATGTAGG + Intergenic
1015429673 6:133116091-133116113 CAAACTGCTGTCATAAGTGTAGG + Intergenic
1016050458 6:139524939-139524961 CAGAATTCTGTTAGAACTCTGGG - Intergenic
1016600986 6:145860002-145860024 CAAAATGATGTTAGCAGTATAGG - Intergenic
1016784633 6:147996779-147996801 CAAAATGATGTTAGAGAAGATGG - Intergenic
1017454479 6:154588421-154588443 AAAAATGCTCTTAGTAATGCAGG - Intergenic
1017465470 6:154689313-154689335 AAAAATGCTATTTGCAATGTTGG - Intergenic
1017966011 6:159266657-159266679 CAAAATTCTATTAGAAATCTAGG + Intronic
1018012079 6:159680457-159680479 TAAAATTCAGTTAGAAAAGTAGG - Exonic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1021243057 7:18228865-18228887 CTGTATTCTGTTAGAAATGTTGG - Intronic
1021385364 7:20023154-20023176 TGAGATGCTGTTAGAAATGGTGG + Intergenic
1022198332 7:28091763-28091785 CATATTGCTGTTAGAATAGTCGG + Intronic
1022665100 7:32403348-32403370 CAAAGGGATGTTAGAAATTTGGG - Intergenic
1024226347 7:47329038-47329060 CCAAATGCTGAAAAAAATGTGGG - Intronic
1025529530 7:61861269-61861291 CAAACTGCTGAATGAAATGTAGG + Intergenic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028072559 7:86469767-86469789 CAGAATGGTGGTAGAAATCTAGG - Intergenic
1028416111 7:90582456-90582478 AATAATGCTGTTATAAACGTGGG + Intronic
1030573340 7:111254512-111254534 CAAAGTGCTGTTTTAAATCTGGG + Intronic
1030657131 7:112180719-112180741 CAAAGTGCTGTTGGCACTGTGGG - Intronic
1031031347 7:116738974-116738996 TAAAAGGCTATTAGAGATGTTGG + Intronic
1031250181 7:119370397-119370419 AAAAATGCTGGCAGAAATGAAGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031931074 7:127686512-127686534 GCAAATGCTATTTGAAATGTTGG + Intronic
1032063142 7:128741761-128741783 AGAAATGCTATTTGAAATGTAGG - Intronic
1033562429 7:142545177-142545199 CAAAATGATGATGGAGATGTAGG - Intergenic
1033880259 7:145872830-145872852 CAAGCTGCTAATAGAAATGTGGG - Intergenic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034658967 7:152752769-152752791 CAAAAGGCAGTTAGAAAGGGAGG + Intergenic
1034705957 7:153144722-153144744 GAAAAGGCTGTTAGAAATGAAGG - Intergenic
1034832688 7:154323356-154323378 CAAAAGGCTGTAAGAAATGAGGG + Intronic
1035427655 7:158791368-158791390 AAAAATGCTGCTAAGAATGTGGG + Intronic
1035762612 8:2080747-2080769 CCAAATACTGTTAGAAAAGAAGG + Intronic
1037071665 8:14658041-14658063 AAAAATGCAGTTATAAATGATGG + Intronic
1037551393 8:19975105-19975127 CAGAATGCTGGGGGAAATGTAGG - Intergenic
1038276003 8:26121304-26121326 AAAAATGGTGTTTAAAATGTAGG - Intergenic
1038590101 8:28829780-28829802 AAAAATCTTTTTAGAAATGTTGG - Intronic
1038812004 8:30856885-30856907 CAAAATTCTGATAGATTTGTTGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1041963755 8:63650239-63650261 CAAAATTCTCTCAGAAATATAGG + Intergenic
1043017327 8:74956018-74956040 TGAAATGCTGTTAGAAATTACGG - Intergenic
1043386934 8:79757964-79757986 AAAAATCCTGTCAGAAATATTGG + Intergenic
1043503187 8:80876062-80876084 CAAAATGCTGTAAGAGCTTTGGG - Intergenic
1043820966 8:84863694-84863716 CAAAATGCAGTTCAAAATGCAGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044025700 8:87169083-87169105 CCAAAAGCTGTAAGAAATGCTGG - Intronic
1044078068 8:87847614-87847636 CAGAATATTGGTAGAAATGTGGG - Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044906277 8:97007152-97007174 CAGAATGCTGTTAAAGATGTCGG - Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045187492 8:99853954-99853976 CAACCTGCTGTTAGGAAGGTAGG - Exonic
1045518607 8:102883400-102883422 AATAATGCTGGTAGTAATGTAGG - Intronic
1046071246 8:109256872-109256894 CAAAATAAAGTTAAAAATGTTGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046477331 8:114763269-114763291 CAAAACTCTGTTGGAAATCTAGG - Intergenic
1047095338 8:121619071-121619093 CTAGATGCTTTTAAAAATGTTGG - Intronic
1047972516 8:130097441-130097463 CAAGAGGCTGTTGGAGATGTGGG - Intronic
1050242378 9:3650643-3650665 GAAAATACTGTAACAAATGTTGG + Intergenic
1050447529 9:5740906-5740928 AAAAATACTGGTATAAATGTGGG - Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050821334 9:9883639-9883661 CAAAATATTTTTAGAATTGTTGG - Intronic
1051380328 9:16451518-16451540 GGAGATGATGTTAGAAATGTAGG - Intronic
1054846422 9:69803249-69803271 CTAAATGGTGTTGGAAAAGTGGG + Intergenic
1055726809 9:79239046-79239068 CCTGATGCTGCTAGAAATGTAGG - Intergenic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1056196361 9:84232633-84232655 TAAAGTGCTCTTAGAATTGTTGG - Intergenic
1056340121 9:85621105-85621127 AAAAATTCTGTGAAAAATGTTGG - Intronic
1057612482 9:96557920-96557942 CAGAAAGATGTTAGAAATGGTGG + Intronic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058388416 9:104465434-104465456 CAGACTTCTGTAAGAAATGTAGG - Intergenic
1058591986 9:106575068-106575090 AATAATGCTGTTATGAATGTTGG - Intergenic
1059109015 9:111537054-111537076 CAAAGTGCTGCTAGTAATGCTGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059620418 9:115998553-115998575 CAAAGTGCTTTTAGAAAACTTGG - Intergenic
1059631888 9:116133889-116133911 AATAATGCTGTTATAAATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1060473569 9:123968796-123968818 AATAATGCTGTTATAAATGTGGG + Intergenic
1061008262 9:127940719-127940741 CAACATTCTGTTAGAAAGGAGGG + Exonic
1187000667 X:15173547-15173569 CAAAATGCAGTGAGTAATGTGGG + Intergenic
1187732090 X:22265515-22265537 GAAAGTGCTGTAAGAAATCTGGG - Intergenic
1189230570 X:39449491-39449513 TAAAATGCTGTGAGAGATCTAGG - Intergenic
1189823183 X:44890483-44890505 TACATTGCTGGTAGAAATGTAGG - Intronic
1189829326 X:44954580-44954602 TAACAAGCTGTTAAAAATGTAGG + Intronic
1190890890 X:54566747-54566769 AAAAATGCTGTTATGAATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1193747897 X:85305041-85305063 AGAAGTGCTGTTAGTAATGTTGG + Intronic
1194025010 X:88740274-88740296 CACAATGGTGCTAGAAATGTGGG - Intergenic
1194547520 X:95256608-95256630 AAAAATGATGTAAGAAATGAGGG - Intergenic
1194660170 X:96622151-96622173 AAAAAGGCTTTTTGAAATGTTGG + Intergenic
1194806093 X:98329962-98329984 CAAAATGATACTACAAATGTGGG + Intergenic
1195003321 X:100663247-100663269 CAAATTCCTGTTGAAAATGTTGG - Intronic
1195805869 X:108764395-108764417 CAGAATGTTGCTAGAAATGTGGG - Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196091653 X:111750591-111750613 AAAAATGCTGACAGAAATGAAGG - Intronic
1196407748 X:115382980-115383002 CAAAATGGTTTTAAAAGTGTGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197443444 X:126518652-126518674 CACCATTCTGTGAGAAATGTAGG + Intergenic
1197977872 X:132184583-132184605 CAAAATGCTTTCATAAATATTGG - Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199312697 X:146340126-146340148 CCAAATACTGTTAGAATTTTTGG + Intergenic
1199540603 X:148953891-148953913 AAAAGTGCTGTTAAAAATCTGGG - Intronic