ID: 1105736855

View in Genome Browser
Species Human (GRCh38)
Location 13:23280612-23280634
Sequence TAGGATAAAGAATATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 330}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105736850_1105736855 5 Left 1105736850 13:23280584-23280606 CCTTAAGCATCAGAAATGCACTG 0: 1
1: 0
2: 1
3: 28
4: 164
Right 1105736855 13:23280612-23280634 TAGGATAAAGAATATGGGCTGGG 0: 1
1: 0
2: 2
3: 38
4: 330
1105736849_1105736855 16 Left 1105736849 13:23280573-23280595 CCAACAAAGCACCTTAAGCATCA 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1105736855 13:23280612-23280634 TAGGATAAAGAATATGGGCTGGG 0: 1
1: 0
2: 2
3: 38
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105736855 Original CRISPR TAGGATAAAGAATATGGGCT GGG Intronic
901183012 1:7354447-7354469 TTGGATAAAGAAAATGTGGTAGG - Intronic
901304804 1:8225128-8225150 CAGGATCAGGAATAAGGGCTTGG - Intergenic
901395779 1:8980369-8980391 AAGAATATAGAAGATGGGCTGGG + Intergenic
903187761 1:21638946-21638968 TAGGGGAAAGAGTGTGGGCTTGG - Intronic
903635283 1:24809754-24809776 TAAAATAAAGAATATTGGCTGGG - Intronic
903731848 1:25502278-25502300 TAGAATTAAAAATTTGGGCTGGG + Intergenic
904242313 1:29155786-29155808 TAAGATTTAGAAAATGGGCTGGG - Intronic
906170987 1:43725035-43725057 TAGGACAAACACTATGTGCTAGG - Intronic
906757939 1:48338572-48338594 TAGGATAAAAAATTGGGTCTTGG + Intronic
906862524 1:49376868-49376890 CAGCATAAACAATATGGGCGAGG - Intronic
907202740 1:52741923-52741945 TATGATGAAGAGTGTGGGCTTGG - Intronic
907227341 1:52960182-52960204 TAGAAAAAAGAATATAGGCCAGG - Intronic
907779542 1:57553192-57553214 TAGGATTAGGAATATGGCTTTGG + Intronic
908719107 1:67105029-67105051 TGTGATAAAGAATATTGGCCAGG + Intronic
910050772 1:82971621-82971643 TAGAATAAATAATATTGGCAAGG + Intergenic
910989647 1:93041735-93041757 GAAGATAAAGAATAAGGGCCGGG - Intergenic
911198085 1:95016149-95016171 ATGGATAGAGAAAATGGGCTTGG - Intronic
911452313 1:98079132-98079154 TAGGAGAAAGAATATTGATTTGG - Intergenic
913378452 1:118182829-118182851 TAGGAAGATGAATATGGGCTGGG - Intronic
914794522 1:150908913-150908935 TATTATCAAGAAAATGGGCTGGG - Intergenic
914859390 1:151373754-151373776 TAGGAAAAAGAATAAAGTCTGGG + Intergenic
914899077 1:151702535-151702557 TAGGGAAAAGAAAATGGGGTGGG - Exonic
914984199 1:152442205-152442227 TAGGATAAGGACTCTGTGCTTGG + Intergenic
915162078 1:153927756-153927778 AAGTATAAAAAATTTGGGCTGGG - Intergenic
915476671 1:156156586-156156608 AGGGATAAAGAGTGTGGGCTGGG + Intronic
915930418 1:160057448-160057470 TGGGATAAAGAATAGTGGGTTGG - Intronic
916097075 1:161360809-161360831 TAGAATAGAAAATATAGGCTGGG + Intronic
916199294 1:162254931-162254953 TAATAGAAAGAATATGGACTTGG - Intronic
919530988 1:198719904-198719926 AGTGATAAAGAATATGGGCCGGG - Intronic
920011643 1:202872289-202872311 GAGGAGATAGAATGTGGGCTGGG - Intergenic
921137153 1:212271955-212271977 TTGGGTCAAGGATATGGGCTAGG - Intergenic
921291929 1:213666158-213666180 AAGGATAAACAATATGGTCCAGG + Intergenic
923376334 1:233367562-233367584 TACGATAAAGAATGTTGGCTGGG + Intronic
923456218 1:234167865-234167887 TAGGGGATAGAACATGGGCTGGG - Intronic
923955390 1:239012448-239012470 TAGCATAGAGAATATGTGATAGG + Intergenic
924432467 1:244008682-244008704 TGGGAGATAGAATATGGGATAGG - Intergenic
1063336641 10:5222118-5222140 TATGATATAGAATATGGGGCTGG + Intergenic
1063820976 10:9835234-9835256 AATAATTAAGAATATGGGCTGGG + Intergenic
1064040130 10:11954678-11954700 TAGAAACAAGAATTTGGGCTGGG + Intronic
1064250858 10:13705480-13705502 TAGGATAAAAATGAGGGGCTGGG - Intronic
1064290948 10:14033482-14033504 TTGGATAAAGAAAATGTGATAGG + Intronic
1064987985 10:21230196-21230218 AAATATAAAGAATATGGGCTTGG + Intergenic
1065011924 10:21428646-21428668 TAGGAAAAGGAAAGTGGGCTGGG + Intergenic
1065889587 10:30109719-30109741 GAGGATAAATAATATGGTATAGG + Intronic
1068246403 10:54376188-54376210 CAAAATAAAAAATATGGGCTGGG - Intronic
1069025605 10:63537684-63537706 CAGGAAGAAGCATATGGGCTGGG - Intronic
1069786933 10:70994507-70994529 TAGGATGGAGAATATGGCCCAGG + Intergenic
1070116645 10:73535142-73535164 TAGGAGAAAGATTATGGGATAGG - Intronic
1070759897 10:79017568-79017590 TATGACTAAGAATATTGGCTTGG - Intergenic
1071347517 10:84706847-84706869 TAAGAATAAGAATCTGGGCTAGG + Intergenic
1072039436 10:91593004-91593026 GAGGCTAAAGAATTTGTGCTGGG + Intergenic
1072214424 10:93276231-93276253 AAAGAAAAAGAAAATGGGCTGGG - Intergenic
1072444433 10:95486229-95486251 TAAGATAAAGAAAATGGGTTTGG + Intronic
1072545030 10:96430578-96430600 TAGAATAAAGAATAACAGCTGGG + Intronic
1072664380 10:97383295-97383317 CAGGAAAAAGAATGTGGGCTGGG + Intronic
1073412733 10:103355631-103355653 TATGATAAAGAATTAAGGCTGGG + Intergenic
1073571581 10:104584853-104584875 TTGCATAAAAGATATGGGCTGGG + Intergenic
1073689556 10:105792760-105792782 TAGGATAAAGAGAGGGGGCTGGG - Intergenic
1074726999 10:116321343-116321365 TAGGATATAAAATATGAGCTGGG - Intergenic
1074952696 10:118355261-118355283 TAGGAGAAAGCATATGGGCTTGG - Intergenic
1077668983 11:4140102-4140124 TATTATAAAAAATATGAGCTGGG - Intergenic
1079356191 11:19731987-19732009 AATGATTAAGAGTATGGGCTGGG + Intronic
1079841414 11:25404820-25404842 TAGAAGAAAGAATATGGGGAGGG + Intergenic
1079841473 11:25406036-25406058 TAGAAGAAAGAATATGGGGAGGG - Intergenic
1080111232 11:28570049-28570071 TAGTATAAAGAATACAGGCTGGG - Intergenic
1080178773 11:29397800-29397822 TAGGATAAACCATATAGCCTAGG - Intergenic
1080178813 11:29398178-29398200 TAGGATAAACCATATAGCCTAGG - Intergenic
1080720229 11:34841258-34841280 TAGGATAAAGAACATAGTCTGGG - Intergenic
1084405473 11:68969723-68969745 TAAGAAAAAGAATACAGGCTGGG + Intergenic
1085090721 11:73710901-73710923 AAGTTTAAAGAAAATGGGCTAGG - Intronic
1085417950 11:76331754-76331776 TTTGATAAAGAATATGGGCCAGG - Intergenic
1085924954 11:81006376-81006398 TAAGATAAAAAATATGGTCTAGG + Intergenic
1086210939 11:84317894-84317916 TAGCATAAAGAATATATGTTTGG - Intronic
1086753263 11:90526725-90526747 TAGGATAAAAATTCTAGGCTGGG + Intergenic
1087266700 11:96069376-96069398 TAAGATAAACAAAATTGGCTGGG + Intronic
1087841021 11:102921249-102921271 ATGGATAAAGAAAATGTGCTAGG + Intergenic
1088269825 11:108022595-108022617 TAGGAAAAAGAAAATGTGTTTGG - Intronic
1088273294 11:108057913-108057935 AAAAATAAAGAATATTGGCTGGG + Intronic
1089990345 11:122853523-122853545 TAAGTTAAAAAATATGGGCCGGG + Intronic
1090423988 11:126594431-126594453 TAGGAGAAAGAACATGAGTTTGG + Intronic
1092079776 12:5706113-5706135 TAGGTTAAAGAATATTGCCACGG - Intronic
1092466053 12:8732875-8732897 AAGAATAAAGAATTTTGGCTGGG - Intronic
1092786932 12:12035100-12035122 ATGGATAAAGAAAATGGGGTTGG - Intergenic
1092859459 12:12707877-12707899 TAAAATACAGAATTTGGGCTCGG - Intergenic
1096059340 12:48683185-48683207 AGGGATAAAGAATGCGGGCTGGG - Intergenic
1096725607 12:53559381-53559403 TAAAATACAGAAAATGGGCTGGG + Intronic
1097129182 12:56797786-56797808 TAAGAAAAAGAATTTGGGCCAGG + Intergenic
1097658117 12:62394552-62394574 TAAGAAAAAGAATCAGGGCTGGG + Intronic
1098037704 12:66322265-66322287 TAAGATAAAAAATACAGGCTGGG + Intronic
1098232094 12:68381780-68381802 TAAGATATAGAATTTGGGTTAGG - Intergenic
1098405356 12:70120172-70120194 TAGGTTAAAGAGAATGGGTTTGG + Intergenic
1100524958 12:95410538-95410560 AAGGATTAAGAATAAGGGCCGGG + Intergenic
1101526816 12:105538474-105538496 TCTCATAAGGAATATGGGCTGGG + Intergenic
1101684804 12:107008462-107008484 TATGATAAAGAATACGGGGATGG + Intronic
1103711095 12:122913240-122913262 GAAGAAAAAGAATCTGGGCTGGG + Intergenic
1105427096 13:20303125-20303147 GAGCAGAAAGAACATGGGCTTGG - Intergenic
1105736855 13:23280612-23280634 TAGGATAAAGAATATGGGCTGGG + Intronic
1106323580 13:28665852-28665874 TAGGGTAAAGTATATGAGGTTGG + Intronic
1107123867 13:36823141-36823163 GAGGCTAAAGAATTTGGCCTAGG + Intronic
1107242618 13:38254958-38254980 TTAGAGAAAGAATAAGGGCTTGG - Intergenic
1107456635 13:40561671-40561693 TAGAATATAGAATATAGGCCAGG + Intronic
1107658080 13:42612291-42612313 AAGGATATAGCAAATGGGCTAGG - Intergenic
1107725208 13:43292352-43292374 TAGGAAAAAGATGATGGGCATGG + Intronic
1108079141 13:46715561-46715583 TAGGAGGAAGAATGAGGGCTGGG - Exonic
1109922660 13:69089108-69089130 AAGGCTAAAACATATGGGCTAGG + Intergenic
1110383421 13:74880093-74880115 TAGGTTAAAGAAAATGGGAGGGG - Intergenic
1110568409 13:76979246-76979268 TGGGATGATGAATATGGTCTGGG + Intergenic
1110896288 13:80756456-80756478 TAGAGTAAATAATATGGCCTTGG - Intergenic
1111624152 13:90762419-90762441 TAAGATAAAGTTTATGAGCTAGG + Intergenic
1112194180 13:97208548-97208570 TAGGGTAAAGACTAGGGACTAGG - Intergenic
1114468782 14:22944171-22944193 AAGCCTAAAGAAAATGGGCTGGG - Intergenic
1114721574 14:24888426-24888448 TAAGATAGAAAAAATGGGCTGGG + Intronic
1114915071 14:27253382-27253404 TAGGAAGAAGAATATGTACTGGG - Intergenic
1114970691 14:28025075-28025097 TAAAAGAAAAAATATGGGCTGGG + Intergenic
1116189103 14:41640093-41640115 CCGATTAAAGAATATGGGCTGGG - Intronic
1116970606 14:51060760-51060782 TAAGAGAATGAATATAGGCTGGG - Intronic
1117136535 14:52739981-52740003 TAAGTTAAAGAATCTAGGCTGGG + Intronic
1117449214 14:55834833-55834855 TAGGGCAAAGCATATGGGATGGG + Intergenic
1117611179 14:57484906-57484928 GAGGACAAAGATGATGGGCTGGG + Intronic
1118281240 14:64430589-64430611 TATAATAAAGAATCTAGGCTGGG - Intronic
1118352263 14:64981437-64981459 TAGATTAAAGAATTTGGGCCAGG + Intronic
1118661426 14:68017489-68017511 TAAGATAAAAAAGATAGGCTGGG - Intronic
1119336950 14:73841213-73841235 TATAATAAAGAATCTGGGCCAGG - Intergenic
1120017574 14:79491253-79491275 TAGGAGAAAGAACCTGGGCTTGG - Intronic
1120248397 14:82032284-82032306 TAGGTAAAACAATATGGGCCAGG - Intergenic
1120299985 14:82693494-82693516 TTGGATATAGAATAAGTGCTAGG - Intergenic
1120487103 14:85127757-85127779 TAGGATATAGCATATGGCCTGGG - Intergenic
1120547359 14:85828355-85828377 TAGTGTAAAGAATATAGACTTGG - Intergenic
1121714341 14:96062255-96062277 TCAGGTAAAGAAAATGGGCTTGG + Intronic
1125596578 15:40891116-40891138 CAGGAGAAAGAACATAGGCTGGG - Intergenic
1126136388 15:45396573-45396595 TAAGATACAGTATTTGGGCTGGG + Intronic
1127217368 15:56837930-56837952 TAGAATAAAGAATTTGGAATAGG - Intronic
1128411493 15:67403488-67403510 TAGGATGAAGAGAATAGGCTTGG - Intronic
1130670643 15:85909390-85909412 TAATATAAAGAATATTGGCTGGG - Intergenic
1132201481 15:99957225-99957247 TAAGACAAAGGACATGGGCTGGG + Intergenic
1133733182 16:8593483-8593505 TTGGATAAAGAAAATGTGGTAGG + Intergenic
1135557650 16:23450530-23450552 TACAATAAAGAATAAGGGCTGGG + Intronic
1138020576 16:53476399-53476421 TAGGATAGAGCATATATGCTAGG - Intronic
1138081068 16:54091979-54092001 TAGAAAAAAGAAAAAGGGCTGGG + Intronic
1138214016 16:55187269-55187291 AAGGATAAACAACATGGGTTAGG + Intergenic
1138617529 16:58182233-58182255 TAAGAAACAGAAAATGGGCTAGG + Intronic
1139275528 16:65724117-65724139 TGGGATAAAGTATAGGGTCTAGG - Intergenic
1140052536 16:71494777-71494799 AAGTTTAAAAAATATGGGCTGGG - Intronic
1140197820 16:72870105-72870127 TAGATTAAAGAATATGGGCCAGG + Intronic
1141062754 16:80889533-80889555 TAGTTTTAAGAATCTGGGCTGGG - Intergenic
1143240664 17:5440289-5440311 GAGAATGAAGCATATGGGCTGGG - Intronic
1144706591 17:17372438-17372460 TAGGATAAAGAAAGTGGGCTGGG - Intergenic
1146041845 17:29463122-29463144 TAGCATAAAGAATATGGAAAGGG - Intronic
1148335785 17:46840379-46840401 CTGGATTAAGAAAATGGGCTGGG - Intronic
1148641116 17:49188509-49188531 TAAGAAAAAGAATATGTGCTGGG + Intergenic
1150381480 17:64723712-64723734 CAAGATAAAAAATATGGGCTGGG + Intergenic
1150774905 17:68073509-68073531 CAAGATAAAAAATATGGGCTGGG - Intergenic
1151846387 17:76658838-76658860 TAGAAAATAGAAAATGGGCTGGG + Intergenic
1152187809 17:78869123-78869145 TAGGAATAAAAATATAGGCTGGG + Intronic
1153546413 18:6210283-6210305 TAGGACAGACAATGTGGGCTTGG + Intronic
1154416925 18:14181008-14181030 TATAATAAACAATATAGGCTGGG - Intergenic
1155681603 18:28493188-28493210 TAATATAAATAATATTGGCTGGG - Intergenic
1157599693 18:48886301-48886323 TAGGTAAAAGAATATGGGGAAGG + Intergenic
1158009095 18:52708144-52708166 TAGGAAAAAAAATTTTGGCTGGG + Intronic
1158363823 18:56707718-56707740 TAGGACATAAATTATGGGCTAGG + Intronic
1159686710 18:71430623-71430645 TACGATAAAGACTATGAGCCAGG - Intergenic
1159930044 18:74301853-74301875 TAGGACTAAGAATGGGGGCTTGG + Intergenic
1165339102 19:35197866-35197888 TGGAATACAGAATATGGTCTAGG + Intergenic
1165426363 19:35747939-35747961 TAGGAGAAAGAATATGATCTGGG - Intronic
1167001964 19:46750822-46750844 TAAGATAAGGAACGTGGGCTGGG - Intronic
1168224837 19:54987189-54987211 GAAGATAAAGATTCTGGGCTGGG - Intronic
927336801 2:21934244-21934266 GAGAATTAAGAATATGAGCTAGG + Intergenic
927765669 2:25805090-25805112 TGTTAGAAAGAATATGGGCTTGG + Intronic
928407920 2:31028951-31028973 TAGAATGAAGAATGAGGGCTAGG + Intronic
928469410 2:31558794-31558816 TAGGATATAGTATATGGTCTAGG + Intronic
928561086 2:32486146-32486168 TAGGATAGAGAATATAGTGTAGG + Intronic
929118533 2:38465164-38465186 TAGGATAAAGATAAGGGGCTGGG - Intergenic
929755392 2:44760054-44760076 TAGGAGAATGAATATGCACTAGG + Intronic
930030963 2:47057736-47057758 GAGGACAAGGAAGATGGGCTGGG - Intronic
930881170 2:56272179-56272201 AAGGTTAAAGAATATGGGATAGG + Intronic
931144291 2:59500296-59500318 TTGCATATAAAATATGGGCTGGG + Intergenic
931167084 2:59759701-59759723 TAAGATGAAGAGTATGGGTTAGG - Intergenic
932273611 2:70434314-70434336 TAGGATATGGGATATGGGATAGG - Intergenic
932273617 2:70434338-70434360 TAGGATATAGGATAGGGGATAGG - Intergenic
933736465 2:85499251-85499273 CAGGAAAAGGAAAATGGGCTGGG - Intergenic
936503822 2:113088613-113088635 GAGGAAAAAGGAGATGGGCTAGG + Intergenic
936754304 2:115687273-115687295 CAGAATAAAGAATATGGGGGAGG - Intronic
936948892 2:117957184-117957206 TAAGAGAATGAATATGGGCCAGG - Intronic
939159405 2:138568353-138568375 TAGGAGGAAGAATTTGGGGTTGG + Intronic
939296844 2:140277288-140277310 TAAGATTAAAAAGATGGGCTGGG + Intronic
939971854 2:148670977-148670999 AATGAGAAAGAATAGGGGCTGGG - Intronic
941754418 2:169169350-169169372 TAGTATAAAGAACTTGGGTTGGG - Intronic
941914473 2:170801229-170801251 TAGGATGAAGAGTATGGACAGGG - Intergenic
942298929 2:174543736-174543758 TAAGAAAAAAAGTATGGGCTGGG + Intergenic
945639041 2:212399236-212399258 TAGAATGAACAATATGGGCCAGG - Intronic
945849157 2:214984613-214984635 TAGGGTAAAGATCATGAGCTCGG - Intronic
1170084999 20:12520379-12520401 TAGAATACAGAATATTGGCTGGG - Intergenic
1173153155 20:40584920-40584942 CAGGACAAAGAGTATGGTCTGGG - Intergenic
1174011010 20:47449646-47449668 TAAAAAAAACAATATGGGCTGGG - Intergenic
1176856410 21:13978268-13978290 TATAATAAACAATATAGGCTGGG + Intergenic
1177928828 21:27253852-27253874 AAGGAGAAAGAGTGTGGGCTAGG - Intergenic
1178904427 21:36624786-36624808 TAGGATTAAGAACATTGGATTGG - Intergenic
1181840423 22:25653981-25654003 TACGTTAAAGAATGTGGGCTGGG - Intronic
1182838877 22:33368233-33368255 TTTGAAAAAAAATATGGGCTGGG + Intronic
949690450 3:6631042-6631064 TAAGATAAAAAACATGAGCTGGG - Intergenic
949775687 3:7630171-7630193 AAGGTTAAATAATTTGGGCTGGG + Intronic
950540106 3:13607279-13607301 AAGAATACAGAATATAGGCTGGG - Intronic
951202785 3:19893234-19893256 GAAAATAGAGAATATGGGCTGGG - Intronic
951704935 3:25534928-25534950 AAGCATACAGAATATGGTCTGGG - Intronic
951883284 3:27500365-27500387 AAGAATAAAGAATGTAGGCTGGG + Intergenic
952112740 3:30143361-30143383 GAGTAGAAAGGATATGGGCTAGG + Intergenic
952287820 3:31984936-31984958 TATGATTAAAAATATTGGCTAGG + Intronic
953689763 3:45107819-45107841 GAGAATAAAGAATGAGGGCTGGG + Intronic
953976037 3:47382111-47382133 TAGGAAAAAGAAAATGGGTTTGG + Intronic
954447839 3:50556061-50556083 TAGGAAAAAGAAGGTGGGGTGGG - Intergenic
954475400 3:50739681-50739703 AAGTATAAAGAGAATGGGCTTGG + Intronic
955184518 3:56702289-56702311 TAGAATATAAAATTTGGGCTGGG + Intergenic
955411206 3:58656695-58656717 TAGGATAAAGACTCTGGGGTGGG - Intronic
955437024 3:58912084-58912106 CAGAATAAAGAATATGGGAGGGG - Intronic
955897742 3:63718500-63718522 AAGGATAAAGAATATTAGCAAGG - Intergenic
956000767 3:64727892-64727914 TAGGAAAAAGAATATGGAGGTGG - Intergenic
958933808 3:100236474-100236496 TAGGATAGAGAATATGCTTTTGG + Intergenic
958943879 3:100342665-100342687 TAGCATAAAGAATGAGGGCAGGG - Intronic
959073775 3:101729046-101729068 TATGATAAGAATTATGGGCTGGG + Intronic
959133203 3:102384041-102384063 TAGTAAAAAGGATATGGGCTTGG + Intronic
961059879 3:123819608-123819630 TAAGATAAAGACTATGGGAAAGG - Intronic
961333970 3:126159116-126159138 TGGGATGAAGAAGCTGGGCTGGG - Intronic
962565223 3:136650981-136651003 AAGGGTAAAGATAATGGGCTCGG + Intronic
962608316 3:137050868-137050890 GAGGAAAAAGAACCTGGGCTGGG - Intergenic
963010388 3:140763980-140764002 TAAGATAAAGAATGGGGGATGGG - Intergenic
963119348 3:141763164-141763186 AAGGATGAAAAATATGGGCTTGG + Intergenic
963200412 3:142580277-142580299 TAGGAGAAAGGACATGGGATTGG + Intergenic
963352361 3:144167622-144167644 CAGGATGAAGAACATAGGCTTGG + Intergenic
964295351 3:155227117-155227139 TAGAATAAAGACAATGGGTTGGG - Intergenic
965117867 3:164515108-164515130 TGGCCTAAAGTATATGGGCTCGG - Intergenic
965460312 3:168953893-168953915 TAGGACCAAGAATATGGTCCTGG + Intergenic
967522893 3:190455337-190455359 TAGGATAGAGAGTGTTGGCTGGG - Intergenic
967742963 3:193023157-193023179 TAAGAAAAATAATATGGGCCGGG - Intergenic
968821328 4:2854024-2854046 TATTCTAAAGAATATGGGCTGGG + Intronic
968893251 4:3383803-3383825 GAGGCCAAAGAATATGGGCATGG - Intronic
971055763 4:22910761-22910783 TAGGAAAATGTATATGGGGTAGG + Intergenic
972710228 4:41588251-41588273 TTAGATACAGAATATGGGATGGG + Intronic
972990562 4:44818541-44818563 TAGGTTAAAGAATCTTGGCTAGG - Intergenic
973751281 4:54022987-54023009 GAGGATAGAGTATATGGGTTTGG - Intronic
974096859 4:57373322-57373344 TAGGACTAAGAATATTGGTTAGG - Intergenic
977844597 4:101753512-101753534 AAGGAAAGAGAATCTGGGCTGGG - Intronic
978461386 4:108957249-108957271 CTGGATGAAGAAGATGGGCTTGG + Intronic
978698174 4:111608658-111608680 TAGGATATACCATATAGGCTAGG + Intergenic
981179358 4:141720934-141720956 TAGGATAAAGATCAAGGGATAGG - Intronic
981860205 4:149345960-149345982 TAGGATAAAGAAGATTGAATTGG + Intergenic
982287577 4:153751313-153751335 CAGGATAGAGAAGATGGGGTAGG - Intronic
982767386 4:159364660-159364682 TAAGATAAAGAGAATAGGCTGGG + Intergenic
983310597 4:166055963-166055985 TAGGATAAATGATATAGGATAGG + Intronic
983628274 4:169825182-169825204 TAGAATAAAGGAAATGGGCTGGG - Intergenic
986964031 5:13248481-13248503 TAGATTAAAGAAAATGTGCTTGG + Intergenic
987808122 5:22796813-22796835 TAAGATAAAAAATCTGGGCCGGG - Intronic
988318232 5:29659518-29659540 TAAGATAATGATTATAGGCTGGG + Intergenic
988334358 5:29886745-29886767 TAGGATACAGAATTTGGGGGAGG + Intergenic
988581313 5:32471250-32471272 TTAGATAATGAATATGGGGTGGG + Intergenic
988723342 5:33900970-33900992 TTTTAAAAAGAATATGGGCTGGG + Intergenic
991258762 5:64644377-64644399 TAGGATAAAGAATTCCGGCCGGG + Intergenic
991638990 5:68734755-68734777 TAAGAAAAAGAATTTGGGCTGGG - Intergenic
992123159 5:73614939-73614961 AAATAAAAAGAATATGGGCTGGG + Intergenic
992697101 5:79300628-79300650 AGTGGTAAAGAATATGGGCTAGG - Intronic
992846646 5:80756042-80756064 TAGAATAAAAAATATGAGCATGG + Intronic
994441865 5:99817486-99817508 TAAGATAAAGAATAGAGGCAGGG + Intergenic
995398940 5:111718942-111718964 TAGGAGATAGAATATGGGAAAGG - Intronic
995981090 5:118105101-118105123 AAGGATAAAGAAAATGTCCTTGG - Intergenic
997145930 5:131433279-131433301 CAGAATAGAGAATATGTGCTTGG + Intronic
997808920 5:136947574-136947596 TAGGATAAAGAAAATGTGGGGGG - Intergenic
1000002244 5:157150137-157150159 CAAGATAAATAATATCGGCTGGG + Intronic
1000196719 5:158966623-158966645 CAGGAAAAAGAATATGTGTTTGG - Intronic
1000513362 5:162210576-162210598 TATGAAAGAGAATATAGGCTGGG + Intergenic
1002115278 5:176957190-176957212 TGGGCTAAAGAATATGGCTTTGG - Intronic
1004821475 6:19372532-19372554 TAGGAAAACGAATATGGAGTTGG - Intergenic
1005571680 6:27151751-27151773 TAGGACAAACACTCTGGGCTTGG - Intergenic
1005945037 6:30589299-30589321 TAAGAAAAGGAATAGGGGCTGGG - Intronic
1006150463 6:31984180-31984202 TAGGAAGGAGAATAGGGGCTGGG + Intronic
1006156764 6:32016918-32016940 TAGGAAGGAGAATAGGGGCTGGG + Intronic
1006356731 6:33563581-33563603 TAATATAAAGAAAATAGGCTGGG - Intergenic
1006976337 6:38105792-38105814 TAATAAAAAGAAAATGGGCTCGG + Intronic
1007585335 6:42985562-42985584 TAGGATTAAGAATAAGGGTGAGG - Intronic
1007726185 6:43917284-43917306 TTGGGTAAGGATTATGGGCTTGG - Intergenic
1007813862 6:44506267-44506289 TTGGATAAAGCAAATGTGCTAGG - Intergenic
1008012769 6:46486451-46486473 AAGTATAAAGAACATGGACTTGG - Intronic
1010383259 6:75248381-75248403 TAAGATAAAGGATGTGGGCCGGG - Intronic
1010929810 6:81788003-81788025 TAGTACAAATAATATGGGCTAGG - Intergenic
1011821681 6:91260596-91260618 TAGGATAAGGAATATGGAAAGGG - Intergenic
1011857533 6:91713261-91713283 TGGCATAAAGAATATGAGGTAGG - Intergenic
1013649259 6:112177434-112177456 TAGGATAAAGAAGATTTCCTTGG - Intronic
1014087590 6:117365465-117365487 AATGACAAAGAAGATGGGCTTGG + Intronic
1015158986 6:130130344-130130366 TAGGATAAAGACTATGGCTTTGG + Intronic
1015544446 6:134347272-134347294 TAGGGTAAAGTCTTTGGGCTTGG + Intergenic
1016083971 6:139889648-139889670 TAGGAAATAGAATATGACCTTGG + Intergenic
1016173169 6:141044907-141044929 AAGGATAAAGAAAATGTGGTAGG - Intergenic
1016410099 6:143773948-143773970 GAGGAGAAAGAATTTGGTCTGGG + Intronic
1018082978 6:160274741-160274763 TAGAATAAAGAATCTGGACCAGG - Intronic
1018550295 6:164989909-164989931 GAGGATACTGAAAATGGGCTGGG - Intergenic
1020168480 7:5826444-5826466 TAGAAAAGAGAATAGGGGCTGGG + Intergenic
1021202986 7:17746303-17746325 TTGTAGAAAGAATAGGGGCTTGG - Intergenic
1021550653 7:21867945-21867967 CAGGATGAAGAATATGGGGGTGG - Exonic
1023157814 7:37268593-37268615 TACCATAAAAAATATAGGCTGGG - Intronic
1023600654 7:41878782-41878804 TAGGATCAAGAGTGCGGGCTGGG - Intergenic
1023730356 7:43185658-43185680 TAGGAGAAAGCATTTTGGCTTGG + Intronic
1023749605 7:43359119-43359141 TAGGTTAAAAGATATGGGCCGGG - Intronic
1024761326 7:52599870-52599892 TAGGATAAAGAAAATTGTCAAGG - Intergenic
1026808769 7:73444717-73444739 GAGAATAAAGAATATAGGCCGGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029094045 7:98071191-98071213 AAGGATTAAGAAGATGGGATAGG - Intergenic
1029917247 7:104223630-104223652 TATGTTAAAGAATCTGGGCCGGG - Intergenic
1030010465 7:105161218-105161240 TTAAATAAAGTATATGGGCTGGG - Intronic
1030165255 7:106548207-106548229 GAGGACAAAGAATATGGAATGGG - Intergenic
1030861980 7:114643104-114643126 TAATATAAAGAATATAGGCCGGG - Intronic
1030967908 7:116016884-116016906 TAGGAGAAATAATAAGTGCTTGG - Intronic
1031452614 7:121940399-121940421 TGAGATAAAGACTATGGACTTGG + Intronic
1031887260 7:127254738-127254760 TTGGAGAGAGAAAATGGGCTGGG + Intergenic
1032435025 7:131893617-131893639 TAGGATATAGAAAATGGGGCAGG - Intergenic
1034036292 7:147826713-147826735 TGGGATAAAGAAAAAGGGCTTGG + Intronic
1036062287 8:5337212-5337234 GAGAAAAAAGAATATTGGCTAGG + Intergenic
1036283805 8:7425463-7425485 TAGTATAAAGAAAATAGGATTGG - Intergenic
1036337670 8:7886067-7886089 TAGTATAAAGAAAATAGGATTGG + Intergenic
1038843591 8:31208845-31208867 TAAAATAAAGAAAATGGGCCAGG - Intergenic
1039320151 8:36420725-36420747 AAGGAGAAAGAACATGGGCAGGG - Intergenic
1040420634 8:47237045-47237067 TGGGATAAAAAATGTGGGCCGGG - Intergenic
1041596548 8:59660627-59660649 TTGGTTAAAGAATTTAGGCTTGG - Intergenic
1042181906 8:66098147-66098169 AAAGATAAAGATTTTGGGCTGGG - Intronic
1043006170 8:74821368-74821390 TATGAAAAAAAAAATGGGCTGGG - Intronic
1044066013 8:87701236-87701258 TAGGATAAAAAATACAGGCCAGG + Intergenic
1045186862 8:99846913-99846935 TAGGAAAAGGAATATGAGATGGG + Intronic
1045274509 8:100690684-100690706 TATGATAAAGAATATGGTTGTGG + Intronic
1045894068 8:107193383-107193405 AAGGAAGAAGAATATGAGCTTGG + Intergenic
1046133834 8:110000927-110000949 TATGTTAAAGAATATAAGCTAGG - Intergenic
1046136559 8:110034876-110034898 TAGGATCAAGAAGATGGATTAGG + Intergenic
1047711663 8:127558835-127558857 TAGGAGAAAGGTTCTGGGCTGGG - Intergenic
1049752848 8:144293731-144293753 TAAGAAAAAGAAGAAGGGCTGGG - Intronic
1050505967 9:6350103-6350125 TAGGGTTAATAATATGGTCTGGG - Intergenic
1051048125 9:12899912-12899934 TAGGAGAAAGAATTTTGGCAGGG - Intergenic
1051086155 9:13351008-13351030 TCAGATAAAGAATCTGAGCTGGG - Intergenic
1051349064 9:16181840-16181862 TTACATTAAGAATATGGGCTTGG - Intergenic
1051861972 9:21635951-21635973 TAGGATATATAATATCTGCTTGG - Intergenic
1052261900 9:26526518-26526540 TAGCATATTGAAAATGGGCTTGG - Intergenic
1052531457 9:29689626-29689648 AATGATAAAAAATATGGGCCAGG - Intergenic
1052687664 9:31775250-31775272 TATAATAAAGAATATAGGCCTGG - Intergenic
1052785622 9:32825550-32825572 TAGGATAAAGATAATGACCTGGG + Intergenic
1055613971 9:78052377-78052399 TGGGATGCAGAAGATGGGCTGGG + Intergenic
1055784821 9:79861723-79861745 TGGGAAAGAGAATATGTGCTTGG + Intergenic
1056474132 9:86936517-86936539 TTGGATCAATAATTTGGGCTGGG - Intergenic
1056890482 9:90487490-90487512 TAGGAAAAAGAATAAGGCCAAGG - Intergenic
1057737061 9:97672831-97672853 AAGAATATAGCATATGGGCTGGG + Exonic
1057750761 9:97790979-97791001 TAAGATGATGAATATGGGTTTGG - Intergenic
1058005732 9:99911870-99911892 TATGAAAAACAGTATGGGCTGGG - Intronic
1059711326 9:116870251-116870273 TAGGAGAAAGAATGTGGAGTTGG - Intronic
1059942569 9:119371887-119371909 GAGGATAAAGATTTTGGACTTGG - Intergenic
1060072337 9:120560910-120560932 TAAGATAGACAATATCGGCTGGG - Intronic
1061913337 9:133736689-133736711 TAGTTTAAAGAATTTAGGCTGGG - Intronic
1062167305 9:135114408-135114430 TAGGATTAAGAATCTCGGCTGGG - Intronic
1185511368 X:667315-667337 GAGGAAAAAAAAAATGGGCTTGG - Intergenic
1185895156 X:3851839-3851861 TAGAAAAAAAAATACGGGCTGGG + Intergenic
1185900274 X:3890264-3890286 TAGAAAAAAAAATACGGGCTGGG + Intergenic
1185905390 X:3928695-3928717 TAGAAAAAAAAATACGGGCTGGG + Intergenic
1190914834 X:54803600-54803622 TAGGAGAAAGTAAATGTGCTAGG + Intergenic
1190936608 X:55003733-55003755 CAGGAAAAAGTATATGGGCCAGG + Intronic
1191844765 X:65538823-65538845 TACGATTAACAATATAGGCTAGG - Intergenic
1192578290 X:72260193-72260215 TAGGATGAAGACTTGGGGCTGGG - Intronic
1192724891 X:73739129-73739151 TAAAATAAAGAATTTGGTCTTGG + Intergenic
1193514238 X:82444484-82444506 TAGGCTAAAAAGTCTGGGCTAGG + Intergenic
1195311544 X:103636377-103636399 GAGAATAAAGAAAATAGGCTGGG - Intergenic
1195414115 X:104602009-104602031 TTGGATAAAGAAAATGTGGTAGG + Intronic
1196610573 X:117709876-117709898 TAACATAAAGAATAAGAGCTTGG - Intergenic
1198460707 X:136860419-136860441 AAGGAAAAAGAAAGTGGGCTGGG + Intronic
1198738763 X:139817703-139817725 TAGGTGAAAGATGATGGGCTTGG + Intronic
1199590056 X:149459292-149459314 GGGGATAAAGAACAGGGGCTGGG - Intergenic
1200036153 X:153332651-153332673 TTGGATAAAGAAAATGTGGTAGG + Intergenic
1201559679 Y:15302734-15302756 TAGGATTAAAAGTTTGGGCTGGG + Intergenic
1201866576 Y:18661963-18661985 TGTGAGAAAGAACATGGGCTGGG + Intergenic
1201964471 Y:19716541-19716563 AAGTATAAAGAATATGGGTAAGG - Intronic