ID: 1105738087

View in Genome Browser
Species Human (GRCh38)
Location 13:23293009-23293031
Sequence ATTTCCTGCTTGGCATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105738087_1105738090 26 Left 1105738087 13:23293009-23293031 CCTCTCTATGCCAAGCAGGAAAT 0: 1
1: 0
2: 2
3: 16
4: 146
Right 1105738090 13:23293058-23293080 ATTGTACTCTAAAATTTGACTGG 0: 1
1: 0
2: 0
3: 12
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105738087 Original CRISPR ATTTCCTGCTTGGCATAGAG AGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902365641 1:15972135-15972157 ATTTCCTGCATTGCATTGTGAGG + Intronic
902779836 1:18697913-18697935 CTGTCTTGCTTGGCACAGAGAGG + Intronic
904617418 1:31757507-31757529 ATTTCCTGGTTGGAATAAGGGGG + Exonic
908496864 1:64703063-64703085 ATTTCCAGTTTGGCAGTGAGCGG - Intergenic
909255943 1:73422026-73422048 ATTTGTTGCCTGTCATAGAGGGG + Intergenic
909979254 1:82078625-82078647 CTTTTCTGCTTGTCTTAGAGTGG + Intergenic
911472107 1:98331843-98331865 ATATCCTGCTCTGCATATAGTGG + Intergenic
914787097 1:150843830-150843852 ATATCCTCCTTGGGATATAGAGG - Intronic
916418079 1:164611147-164611169 ATTTCTTTCTTGCCTTAGAGTGG + Intronic
917431140 1:174970571-174970593 ATTTAGTGCTTGGCACATAGTGG - Intronic
919223763 1:194666233-194666255 ATTTCATGCTTTTCATAGATGGG - Intergenic
919739626 1:200973942-200973964 CTGTCCTGCCTGGCCTAGAGAGG - Exonic
920954436 1:210605102-210605124 ATTTCCTCTTTGGCAAAGGGTGG - Intronic
924747801 1:246853904-246853926 TTTTCCTGTTTGGCAAAAAGAGG + Intronic
1063686584 10:8242418-8242440 ACCTGCTGCTTGGCATAGAGTGG + Intergenic
1064620898 10:17216415-17216437 ATATCCTTCTTAGCATAGGGAGG - Intergenic
1064623303 10:17236822-17236844 ATTTCTTTCCTGGCATAGGGAGG - Intronic
1064714169 10:18158788-18158810 AAGTCCTGCTTGGCATGGATGGG + Intronic
1066127179 10:32352785-32352807 ATTTCCTGTTGGGTTTAGAGAGG + Intronic
1067562030 10:47310838-47310860 ATTTCCTGCCTGGAATAGATAGG - Intronic
1068026212 10:51648597-51648619 TTTTCCTGCTGGACCTAGAGTGG + Intronic
1069181700 10:65369013-65369035 ATTTCCTACCTGGTACAGAGGGG + Intergenic
1069710350 10:70483801-70483823 CTTTCCTGCTGGTCACAGAGTGG + Intronic
1072307546 10:94121930-94121952 ATTTCCAGCTGGGCAGAGAGAGG + Intronic
1072783480 10:98265767-98265789 ATTTCCTTCTTTGTACAGAGAGG - Intronic
1073354790 10:102845310-102845332 ATGTCCTGGTTGGCAAAGACTGG - Intergenic
1074245495 10:111687145-111687167 TTTTTCTGCTTGGCATAGAGGGG + Intergenic
1075832727 10:125425009-125425031 ATTTCCTGCATGGCACAGCTGGG - Intergenic
1078053331 11:7986234-7986256 ATTTCCTTCTTGGTATAATGGGG - Intronic
1079363547 11:19790031-19790053 TTTTCCCCCTTGGCAAAGAGAGG - Intronic
1079769570 11:24443100-24443122 ATTTTCTGCTTTGCAAATAGTGG + Intergenic
1083184490 11:61009243-61009265 ATCTCCTGCTTATCAAAGAGAGG - Intronic
1085231785 11:74978283-74978305 ATTTCCTGTTTGTCTTGGAGAGG + Exonic
1090021972 11:123136479-123136501 ACTTCCATCTTGGCCTAGAGCGG - Intronic
1090775427 11:129960860-129960882 TTTTCCAGCTTGGTATTGAGAGG - Intronic
1091356950 11:134944496-134944518 TTTTCCTGCTTGGCACCAAGAGG - Intergenic
1092197702 12:6559787-6559809 TTTTCCTTCTTGGCACAGGGTGG - Intronic
1092884341 12:12912306-12912328 AATGAGTGCTTGGCATAGAGAGG + Intronic
1093396178 12:18685267-18685289 ATTTCTTGCTTGGCAGAAATTGG - Intronic
1093751025 12:22800268-22800290 ATTTCCTGCTTTCCATACATGGG - Intergenic
1095641201 12:44487012-44487034 AGTTCCTGCTTAAAATAGAGTGG - Intergenic
1097594353 12:61610008-61610030 ATTTTCTCCTTGGCATAGGACGG - Intergenic
1098526667 12:71494439-71494461 ATTTTTTGATTGGCATACAGAGG - Intronic
1099106534 12:78503653-78503675 ATTTCCTTCTTGGCATTGAATGG - Intergenic
1100228209 12:92580478-92580500 ACTGCCTGCTTGGCTTATAGAGG - Intergenic
1101845383 12:108359198-108359220 AATTTCTGCTTGGCAAGGAGGGG - Intergenic
1103909672 12:124345329-124345351 TTTTTCTGCTTGGCATTGGGTGG - Intronic
1104239670 12:126975838-126975860 ATTTGCAGCTTGTCATAGAAAGG - Intergenic
1105626042 13:22113533-22113555 ATTTACTGCCAGGCAGAGAGGGG - Intergenic
1105738087 13:23293009-23293031 ATTTCCTGCTTGGCATAGAGAGG - Intronic
1105928966 13:25034173-25034195 GCTTCCTGCTTAGCAGAGAGGGG + Intergenic
1106855795 13:33851235-33851257 ATTTCCTGCTTTACAAAGATTGG + Intronic
1108147029 13:47488722-47488744 GTTTCCTCCTTGGTATAGACAGG + Intergenic
1109838726 13:67893856-67893878 ATTTCCTGCATGGCAGAATGAGG + Intergenic
1112237839 13:97652193-97652215 ATTTCCTGCTTGCTATAGTTTGG - Intergenic
1121554326 14:94824842-94824864 ATTTCCTGCTTGCTATAAAATGG + Intergenic
1124870112 15:33532827-33532849 ATTTTCAGCTGGGCATAGGGTGG + Intronic
1125973036 15:43927582-43927604 ATATGCTGCATGGGATAGAGTGG - Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1128231412 15:66038064-66038086 GTTTCAGGCTTGGCTTAGAGAGG + Intronic
1128385540 15:67145706-67145728 ATTTCCTCATTGGTATAAAGGGG - Intronic
1133585025 16:7185000-7185022 ATTTCCTTATTGGCAAAGTGGGG - Intronic
1134031203 16:10993868-10993890 ACATGCTGCTTGGCATTGAGAGG + Intronic
1134379680 16:13712319-13712341 ATTTCCTTCTGGGGATAGAATGG - Intergenic
1140746268 16:77983067-77983089 ATTCCCAGCTTGGCATTCAGCGG - Intergenic
1141148149 16:81546330-81546352 CTGTCCTGCCTGGCATTGAGAGG - Intronic
1142387035 16:89772040-89772062 TTTTCCTGATTGGCTGAGAGGGG + Intronic
1143773599 17:9183448-9183470 ATTTCCTCCATGGCAAAGAGAGG + Intronic
1144825109 17:18101407-18101429 ATTTCCTGCTTGGCTTTTTGGGG + Intronic
1149517050 17:57288658-57288680 AATTCCTGCTTGATTTAGAGAGG + Intronic
1154497717 18:14974799-14974821 TTTTCCTGCTTGGCACCAAGAGG + Intergenic
1157670864 18:49527377-49527399 ATTTCCTGTTTGGTAGAGGGAGG + Intergenic
1158415777 18:57248660-57248682 ATTTCCTGCTTTGCAAAATGAGG - Intergenic
1159874980 18:73800774-73800796 TTTTCCTGTTTTGCAGAGAGAGG - Intergenic
1164072493 19:21780975-21780997 AGTTCCTGCTTTGCATACATAGG - Intergenic
1166486024 19:43213205-43213227 TTTTCCTGCTTGGTATAGGCTGG + Intronic
1167523124 19:49968906-49968928 ATTACCACCTGGGCATAGAGGGG - Intergenic
926543229 2:14206603-14206625 ATTTCCTCCTTGGGGTAGGGAGG - Intergenic
928209445 2:29312660-29312682 ATGTCCTCCTGGGCAGAGAGTGG + Intronic
930740221 2:54824911-54824933 ATTTCCTACTTGGAAAACAGTGG - Intronic
930987505 2:57608586-57608608 TTTTGCTGCTGGGAATAGAGAGG + Intergenic
939857223 2:147373885-147373907 AATCCCTGTTTGGCATAGAGTGG + Intergenic
942132504 2:172894202-172894224 ACTGCCTGTTTGGCATGGAGTGG + Intronic
942758073 2:179365208-179365230 ATTTTCTCTTTGGCTTAGAGAGG - Intergenic
944870934 2:203911204-203911226 TTTTCCTGCATGACACAGAGTGG - Intergenic
945489596 2:210439512-210439534 ATTTACTACTGGGAATAGAGAGG + Intronic
945788065 2:214269596-214269618 ATTTGTAGTTTGGCATAGAGTGG - Intronic
946775572 2:223136721-223136743 ATTTCTTGCTTGGCAGAGACTGG - Intronic
948909845 2:240997680-240997702 CTTTCCTGCTTGTCTTCGAGGGG + Intergenic
1168859510 20:1036077-1036099 ATTGCTGGCTTGGCAGAGAGTGG + Intergenic
1169180268 20:3559495-3559517 GTTTCTTGCTTAGCACAGAGTGG - Intronic
1170285638 20:14705365-14705387 GTTCCATGCTAGGCATAGAGGGG - Intronic
1171007046 20:21476536-21476558 ATTTCCTGTCTGGCATGGAATGG + Intergenic
1171219487 20:23382048-23382070 CTTTCCTGCTTGACAGAGACAGG - Intronic
1172105344 20:32513975-32513997 AGTTCCTGCTTGGCAAGGATAGG + Intronic
1172692253 20:36797966-36797988 TTTTCCTGCTGGGCCTTGAGGGG + Intronic
1174608691 20:51781070-51781092 AATTCCTGCTTGGGATAGCTGGG - Intergenic
1174993220 20:55536362-55536384 ATTTATTTTTTGGCATAGAGAGG - Intergenic
1175173779 20:57097465-57097487 CTGTCCTGCTTGACAGAGAGTGG - Intergenic
1178794560 21:35731995-35732017 ATCTCCTGCTTCCCAGAGAGGGG - Intronic
1182932636 22:34189685-34189707 CTTTTCTGCTTGGAATGGAGGGG + Intergenic
1183784624 22:40022215-40022237 ATTCCAGGCTTGGCATGGAGGGG + Intronic
949646209 3:6097796-6097818 ATTTCCAGATTTGCATAGAAGGG - Intergenic
949769024 3:7558280-7558302 ATTTAATACCTGGCATAGAGTGG + Intronic
950343986 3:12275289-12275311 TCTTCCTGTTTGGAATAGAGTGG + Intergenic
950647251 3:14384450-14384472 ATTTCCTTGTTGGCAAAGTGGGG + Intergenic
950676007 3:14554877-14554899 ATGTACTGCTTGGCACAGAGTGG + Intergenic
955411332 3:58657549-58657571 ATTTCCTGCTCAGCATGGACAGG - Intronic
956350031 3:68324452-68324474 ATTTCTTGCTTGTAACAGAGAGG + Intronic
957031278 3:75244832-75244854 ATTTCCTGTTAAGAATAGAGAGG + Intergenic
963085979 3:141436903-141436925 ATTTGCTGCATGGCTTACAGTGG + Intronic
969359820 4:6656375-6656397 ATCTCCTGCTTGGAATAGCACGG + Intergenic
970265002 4:14272571-14272593 GTTTCCTGCTTTGCAAAGAATGG - Intergenic
971636851 4:29072385-29072407 ATTTCCTTCTTGGTAGAGACAGG + Intergenic
976410216 4:84704851-84704873 ATATTCTCCTTGGCAGAGAGGGG + Intronic
977911583 4:102543327-102543349 ATTTCTGGTTTTGCATAGAGTGG - Intronic
978616606 4:110603172-110603194 ATTTCCTGTTTTGCCTAAAGTGG - Intergenic
979931728 4:126640469-126640491 TTTTCCTTCTTGGCAGAAAGAGG + Intergenic
988126741 5:27049321-27049343 GTTACCTGCTTGGCATATAGTGG + Intronic
989543878 5:42649776-42649798 ATGTTCTCCTGGGCATAGAGTGG + Intronic
991594308 5:68287458-68287480 AATTCCTGCATGCCATAGAGGGG - Intronic
1000173703 5:158729040-158729062 ATTTCCTGCTCTGCAGAGATTGG + Intronic
1002383158 5:178845100-178845122 TTGTCCTTCTTGGTATAGAGGGG - Intergenic
1006793968 6:36720674-36720696 AGTTCCAGCTTGGCAGAGGGTGG - Intronic
1014789280 6:125653522-125653544 GTCTCCTGCTTAGCATATAGTGG + Intergenic
1016407287 6:143744010-143744032 ATGTCCTTCTGGGCATGGAGAGG - Intronic
1016690059 6:146927459-146927481 ATTTTTTGCTTGGAGTAGAGTGG - Intergenic
1017608385 6:156157658-156157680 ATTATCTACTTGGCAGAGAGGGG - Intergenic
1018463542 6:164021563-164021585 CTTTGCTGCTTGGCAAGGAGAGG + Intergenic
1020689383 7:11335999-11336021 TTTTCCTGCTTGGAATGCAGAGG + Intergenic
1021117032 7:16755207-16755229 ATTACCTCCTTGGAATAGAGAGG + Intronic
1021759527 7:23890156-23890178 ATTCCAAGCTTGGCATACAGTGG - Intergenic
1021777243 7:24065799-24065821 ATTTCCTGCTTGACAACGTGCGG + Intergenic
1022101222 7:27170074-27170096 GTTTCCTGCTTGCCAGAGTGGGG - Intronic
1023758517 7:43442517-43442539 ATTTCCTTCTAGGGATAGGGTGG + Exonic
1027467529 7:78534752-78534774 ATTTCCTGCTTCTGATAGTGGGG + Intronic
1030520587 7:110593487-110593509 ATTTCCTGCTAAGCACTGAGGGG - Intergenic
1030828491 7:114190865-114190887 ATTTTCTGCTTGGATTAGGGAGG + Intronic
1035218724 7:157391516-157391538 CTTTCCTGCTTGGCAGGGACTGG - Intronic
1038420628 8:27431871-27431893 ATTTTCTCCTTGGCATAGGGAGG + Intronic
1038680368 8:29661693-29661715 AGTTACTGGTTGGCAAAGAGAGG + Intergenic
1039829504 8:41201676-41201698 ATTTCCTGCTTGCTGCAGAGTGG - Intergenic
1040969918 8:53124794-53124816 ATTTTATGCTTGGCATAGAAGGG + Intergenic
1042346345 8:67732025-67732047 ATTTCCTGGCTGGCCTAGAATGG - Intronic
1042572667 8:70183856-70183878 ATTTGCTGCCTGGCACATAGTGG + Intronic
1042819525 8:72915324-72915346 GTTTTCTGTTTGGGATAGAGTGG - Intronic
1046396938 8:113652505-113652527 ATTTCCTGCTTGAGATTTAGTGG - Intergenic
1047520888 8:125594572-125594594 CTTTCCTGCTTGGTGTAGACGGG + Intergenic
1050880212 9:10689941-10689963 ATTTAGTGCTTGGCATAGAAGGG - Intergenic
1055380102 9:75697300-75697322 ATTTGGGGCTTGGCCTAGAGAGG - Intergenic
1056642067 9:88379974-88379996 CTTTTCTTCCTGGCATAGAGAGG + Intergenic
1057274302 9:93668242-93668264 ATTTCCTGCTTGGCACTAGGTGG + Intronic
1060085509 9:120696440-120696462 AATTCCTGCTTGGTAGAGTGGGG + Intronic
1061207828 9:129174756-129174778 AGTTCCAGCTTTGCAAAGAGGGG - Intergenic
1062166249 9:135108973-135108995 TTTTCCTGCTCTGCATAGTGGGG - Intronic
1185639061 X:1576427-1576449 ATGGCCTGCTCTGCATAGAGTGG + Intergenic
1189070055 X:37853950-37853972 ATGTGCTGCTTGACATATAGAGG - Intronic
1190566480 X:51734967-51734989 ATTTCATGCTTGTCATAGCATGG - Intergenic
1191998762 X:67125802-67125824 ATGTTCTTCTTGGCATATAGGGG - Intergenic
1192233579 X:69282343-69282365 ATTTACTGCTTGGCACAGAGTGG - Intergenic
1195751946 X:108168830-108168852 ATTTCCTGGTTAACATGGAGTGG + Intronic
1196180233 X:112681452-112681474 ATTTACTGCTGTGCATAGAGTGG - Intergenic
1198411399 X:136373125-136373147 ATTTACTCCTTGGGAGAGAGAGG + Intronic
1199940789 X:152625709-152625731 ATTTCCAGTTTGGTATAGTGAGG - Intergenic