ID: 1105743584

View in Genome Browser
Species Human (GRCh38)
Location 13:23354985-23355007
Sequence GCCGGAGGCGAGCAAAGTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105743584_1105743590 10 Left 1105743584 13:23354985-23355007 CCTTGACTTTGCTCGCCTCCGGC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1105743590 13:23355018-23355040 AGATAACATCAACTGACAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 188
1105743584_1105743589 9 Left 1105743584 13:23354985-23355007 CCTTGACTTTGCTCGCCTCCGGC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1105743589 13:23355017-23355039 TAGATAACATCAACTGACAAGGG 0: 1
1: 0
2: 0
3: 24
4: 206
1105743584_1105743588 8 Left 1105743584 13:23354985-23355007 CCTTGACTTTGCTCGCCTCCGGC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 1105743588 13:23355016-23355038 ATAGATAACATCAACTGACAAGG 0: 1
1: 0
2: 1
3: 12
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105743584 Original CRISPR GCCGGAGGCGAGCAAAGTCA AGG (reversed) Exonic
908443951 1:64183662-64183684 GGCAGAGGAGAGCAAAGTCCGGG - Intergenic
915106140 1:153536132-153536154 GCAGGAGGCGTGGAAAGTCGAGG - Exonic
922756718 1:228101065-228101087 GCAGGAGGCAAGCAAGGTGAAGG + Exonic
923024787 1:230195818-230195840 GCCGGAGGTGAGCAGAGACCTGG + Intronic
924775691 1:247113295-247113317 GCCAGTGACCAGCAAAGTCAGGG + Intergenic
924835830 1:247646227-247646249 GCTGGAGGGGAGCAATGTCAAGG + Intergenic
1064532362 10:16323265-16323287 GTAGGAGGAGAGAAAAGTCAGGG - Intergenic
1072615473 10:97046594-97046616 GCAGGAGGCAGGCAAAGCCAAGG - Intronic
1076384047 10:130044606-130044628 GCTGCAGATGAGCAAAGTCAGGG + Intergenic
1079312603 11:19379624-19379646 GCCGGAGGAGGGAAGAGTCAGGG - Intronic
1083253135 11:61481285-61481307 GCCAGAGGCGGGCAAGGCCATGG + Intronic
1089353779 11:117836760-117836782 GCAGGAGGAGAGGAAAGTGAAGG + Intronic
1091549745 12:1528946-1528968 ACCTGAGGTGAGAAAAGTCACGG + Intergenic
1097798270 12:63886560-63886582 GCCTGAGCCCAGGAAAGTCAAGG - Intronic
1100259027 12:92914196-92914218 GCTAGAGGCAAGCAAAGGCAGGG - Intronic
1102923798 12:116811780-116811802 GCCAGAGGCCAGCAAAGCCTCGG - Intronic
1105529812 13:21209096-21209118 GGCTGAGGCCAGCAAAGCCATGG + Intergenic
1105743584 13:23354985-23355007 GCCGGAGGCGAGCAAAGTCAAGG - Exonic
1113909645 13:113836166-113836188 ACCAGAGGAGAGCAAAGGCAGGG + Intronic
1119386545 14:74260947-74260969 GCCCGAGGAGAGCAGAGTCTTGG - Exonic
1132516222 16:367402-367424 GCCGGGAGCGAGTAAAGTCTGGG - Exonic
1135327964 16:21539436-21539458 GCCAGGGCCCAGCAAAGTCAAGG - Intergenic
1136338316 16:29625460-29625482 GCCAGGGCCCAGCAAAGTCAAGG - Intergenic
1142041047 16:87894370-87894392 GCCAGGGCCCAGCAAAGTCAAGG - Intronic
1142415545 16:89939166-89939188 GGCGGAGGAGAGAGAAGTCAGGG - Intergenic
1148240534 17:45996990-45997012 GCCGGAGGCTCTCATAGTCAGGG + Intronic
1150173383 17:63023231-63023253 GGCTGAGCCCAGCAAAGTCATGG + Intronic
1152223722 17:79083051-79083073 GCCGGGGGCAAACAAAGCCACGG - Exonic
1152861440 17:82698685-82698707 GCCGGAGGCGAGCAAGGACTCGG - Exonic
1161346806 19:3772245-3772267 GCCGGAGCCGAGCCAGGTCGGGG + Intergenic
1165488203 19:36108168-36108190 GCAGGAGGGGAGTAAGGTCAGGG - Intergenic
1168161837 19:54515651-54515673 GCCTGAGTCGAGCATGGTCAAGG + Intergenic
936446107 2:112596531-112596553 GCCCAAGGGGAGCAAGGTCAGGG - Intergenic
942651630 2:178174779-178174801 ACCTGAGCCGAGGAAAGTCAAGG + Intergenic
1172517298 20:35543715-35543737 AGTGGAGGAGAGCAAAGTCATGG + Intronic
1173881159 20:46413303-46413325 GCAGGAGGAGAGCGTAGTCATGG + Intronic
1175853762 20:62107949-62107971 ACAGGAGGCCATCAAAGTCAGGG + Intergenic
1175886870 20:62297129-62297151 GCCGGAGGCTGGGAAACTCACGG - Intergenic
1182926396 22:34129334-34129356 GCAGGAGGAGAGTAAGGTCAGGG + Intergenic
1184224160 22:43119616-43119638 GCCAGAGGGGAGCAGAGACAGGG + Intronic
1184677276 22:46050581-46050603 GCCAGAGGCCAGAAAAGGCAAGG - Exonic
953675189 3:44995650-44995672 GCCTGAGTCCAGCAAAGGCAGGG + Intronic
965841343 3:172909157-172909179 GCAGGAGGATAGTAAAGTCAAGG - Intronic
968755204 4:2412116-2412138 GCCTGAGGCGTACTAAGTCAGGG + Intronic
983635410 4:169893064-169893086 GTGGAAGGCGAGGAAAGTCAAGG + Intergenic
988655691 5:33209393-33209415 GCAGGATGTGAGCAAACTCACGG + Intergenic
993509506 5:88754168-88754190 GCAGGAGGGGAGCAAAGTCAGGG + Intronic
994545464 5:101161594-101161616 GCTGGAGGCCAGCAAAGACATGG - Intergenic
999721143 5:154400180-154400202 GCCGTAGCCGAGAAAAGCCATGG + Intronic
1002712091 5:181201503-181201525 GGCTGAGGGGGGCAAAGTCAGGG + Intronic
1003621715 6:7706588-7706610 GCCGGAGGGGTGCAGGGTCAAGG - Intergenic
1016017948 6:139205171-139205193 GCTGGAGGCCAACCAAGTCAGGG + Intergenic
1020537145 7:9413938-9413960 GCCTGAGGGAAGCAAAGTCTGGG - Intergenic
1026155176 7:67819980-67820002 GCCAGAGATGAGCAAAGACAAGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1028540904 7:91941126-91941148 GCTGGAGGCCGGCAAAGCCAAGG + Exonic
1033141578 7:138831845-138831867 TCCGGAGGAGGGCAAAGTCGAGG + Intronic
1033446894 7:141431020-141431042 GCTGGAGGCCAGCAGAGCCATGG - Intronic
1035240112 7:157523834-157523856 GCCAGAGACGGGCAAAGTCCAGG - Intergenic
1035579382 8:730858-730880 GGCGGAGGCGAGCCCAGCCAGGG - Intronic
1048505654 8:135018788-135018810 GCAGGTGGGGACCAAAGTCAGGG - Intergenic
1056406722 9:86282328-86282350 GGCGGACACGAGCAATGTCACGG + Intronic
1056984677 9:91351631-91351653 GCAGGAGGTGAGCACAGGCAAGG + Intronic
1059251464 9:112890840-112890862 GCCAGTGGCGAGCAGAGCCAGGG + Exonic
1061512247 9:131068363-131068385 GCCGAAGGGGAGCAAAGGGATGG + Intronic
1062605955 9:137348959-137348981 GCGAGAGGGGAGCAAAGTCCTGG - Intronic
1189971320 X:46420895-46420917 GGCTGAGTCCAGCAAAGTCATGG - Intergenic