ID: 1105745983

View in Genome Browser
Species Human (GRCh38)
Location 13:23377293-23377315
Sequence CTACATTGTGAATTTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 484}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105745983_1105745984 -5 Left 1105745983 13:23377293-23377315 CCTGAAAAAAATTCACAATGTAG 0: 1
1: 0
2: 3
3: 40
4: 484
Right 1105745984 13:23377311-23377333 TGTAGCTGATGTGAATGCAAAGG 0: 1
1: 0
2: 2
3: 47
4: 302
1105745983_1105745987 17 Left 1105745983 13:23377293-23377315 CCTGAAAAAAATTCACAATGTAG 0: 1
1: 0
2: 3
3: 40
4: 484
Right 1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 153
1105745983_1105745986 16 Left 1105745983 13:23377293-23377315 CCTGAAAAAAATTCACAATGTAG 0: 1
1: 0
2: 3
3: 40
4: 484
Right 1105745986 13:23377332-23377354 GGCTTTTCCTGGACCACCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 155
1105745983_1105745985 5 Left 1105745983 13:23377293-23377315 CCTGAAAAAAATTCACAATGTAG 0: 1
1: 0
2: 3
3: 40
4: 484
Right 1105745985 13:23377321-23377343 GTGAATGCAAAGGCTTTTCCTGG 0: 1
1: 0
2: 4
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105745983 Original CRISPR CTACATTGTGAATTTTTTTC AGG (reversed) Intronic