ID: 1105745987

View in Genome Browser
Species Human (GRCh38)
Location 13:23377333-23377355
Sequence GCTTTTCCTGGACCACCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105745983_1105745987 17 Left 1105745983 13:23377293-23377315 CCTGAAAAAAATTCACAATGTAG 0: 1
1: 0
2: 3
3: 40
4: 484
Right 1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105745987 Original CRISPR GCTTTTCCTGGACCACCTCT GGG Intronic