ID: 1105745987

View in Genome Browser
Species Human (GRCh38)
Location 13:23377333-23377355
Sequence GCTTTTCCTGGACCACCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105745983_1105745987 17 Left 1105745983 13:23377293-23377315 CCTGAAAAAAATTCACAATGTAG 0: 1
1: 0
2: 3
3: 40
4: 484
Right 1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105745987 Original CRISPR GCTTTTCCTGGACCACCTCT GGG Intronic
900146341 1:1160516-1160538 GTTCTTCCTGGACCCCCTCTTGG - Intergenic
900536503 1:3180475-3180497 GCATCTCCAGGACCACATCTTGG + Intronic
900596439 1:3482194-3482216 GCTTTTCCTGGAGCTCCTGTGGG + Intergenic
901074779 1:6547086-6547108 TCTTTGCCTGGACCTCTTCTTGG + Intronic
901622868 1:10603000-10603022 GCTTTTCCAAGACCACCCCAGGG + Intronic
902137612 1:14323734-14323756 GGATTTGCTGGACCACATCTTGG + Intergenic
905267924 1:36767777-36767799 GCTCTTCCTGGACCCTCTTTTGG + Intergenic
905884586 1:41484863-41484885 TCTGTGCCTGGAGCACCTCTGGG + Intergenic
906472874 1:46145768-46145790 GCTGTTCCTTGACCACCTCTTGG + Intronic
910262235 1:85303821-85303843 GCTTTACCAGGACCAGGTCTGGG + Intergenic
911514804 1:98854563-98854585 GGGATTCCTGCACCACCTCTAGG - Intergenic
911864799 1:103004445-103004467 GCTTCACCTGGAAGACCTCTTGG + Exonic
916747732 1:167697455-167697477 GCGATTCCGGGACCTCCTCTTGG - Exonic
920164765 1:204028123-204028145 GCCTTTCCTGGCCCACATATGGG + Intergenic
921287615 1:213622999-213623021 GGCTTTCCTGGACTGCCTCTAGG - Intergenic
1063004065 10:1952228-1952250 GGTTTTCCTGGAAGACTTCTTGG + Intergenic
1064516720 10:16157583-16157605 GCTTTTCCTCCACCATATCTGGG + Intergenic
1068380895 10:56252726-56252748 CCTTTTCCTGGATGACTTCTGGG - Intergenic
1070891170 10:79943010-79943032 CCATTTCCTGGATCACCACTGGG - Intronic
1071726501 10:88203017-88203039 CCTTTTCCTGGACCTCAGCTAGG - Intergenic
1071813368 10:89207220-89207242 GCTGTTCCTGCAGCCCCTCTGGG - Exonic
1071814565 10:89219690-89219712 CCTTTTCCTGCACTGCCTCTTGG + Intronic
1072720899 10:97780546-97780568 GCTTTGCCTCTACCACTTCTGGG + Intergenic
1073146466 10:101284914-101284936 GCTTTTCTTGTAGCTCCTCTAGG - Intergenic
1076098218 10:127750993-127751015 ATTTTTCCTGGACCACTTCTGGG - Intergenic
1076107587 10:127835514-127835536 TGTTCTCCTGGACCCCCTCTTGG - Intergenic
1076234954 10:128856289-128856311 GGATTTCCTGGCCCAGCTCTGGG + Intergenic
1076575114 10:131460706-131460728 GTGTTGCCTGGACCAGCTCTGGG + Intergenic
1076937473 10:133575832-133575854 CCTCTTCCTGGCCCAACTCTCGG - Intergenic
1076980067 11:199500-199522 GCTCTTCCTGGACCTTCTCAGGG - Exonic
1077535066 11:3120124-3120146 GCTGTTCCTCGGCCACCCCTGGG + Intronic
1078459319 11:11501575-11501597 GCTTTACTTGGGCCATCTCTAGG - Intronic
1080438025 11:32264157-32264179 GATTTTCCTGGACAATCTCATGG + Intergenic
1081436732 11:43034944-43034966 TCTTTGCCTGCTCCACCTCTAGG - Intergenic
1081786942 11:45754313-45754335 GCACTTCCTGGACCAGCTCGTGG - Intergenic
1083299975 11:61735181-61735203 GGCTTGCCTGTACCACCTCTGGG + Intronic
1084261293 11:67980466-67980488 GCTTTTGCTGGGACACCTCATGG - Intergenic
1084337858 11:68471558-68471580 GCTTTTCCTGCACCACCATGTGG - Intronic
1084715566 11:70871306-70871328 GCGCTCCCTGGACCTCCTCTTGG - Intronic
1086583336 11:88424209-88424231 GCTTTCACTGGCCCACGTCTTGG + Intergenic
1090958573 11:131535786-131535808 GCTTCTCCTTGGCCACCGCTTGG + Intronic
1091435332 12:468121-468143 GTTTTTCCTGGACCAAATCAAGG + Intronic
1098322335 12:69258727-69258749 CTTTTTCCTGGACAACCTTTTGG + Exonic
1098322395 12:69258919-69258941 CATCTTCCTGGACCACCTCCAGG + Exonic
1098482895 12:70986577-70986599 CCTCTTCCTGAAGCACCTCTTGG + Intergenic
1098835042 12:75414088-75414110 ACTTTTAATTGACCACCTCTTGG + Intronic
1100787320 12:98092164-98092186 GCTTATCCTGGATCATCTCGGGG + Intergenic
1100810840 12:98336514-98336536 GCTTTTCTTCCACCATCTCTAGG - Intergenic
1101235369 12:102783374-102783396 GTTTTTTCTGGACAATCTCTGGG + Intergenic
1102715623 12:114969491-114969513 GCTTGCCAAGGACCACCTCTTGG - Intergenic
1103197432 12:119057057-119057079 GATTTTCCTAGATCACCTCAAGG + Intronic
1104749035 12:131226947-131226969 GCATTCCCAGGACCCCCTCTTGG - Intergenic
1104967827 12:132517232-132517254 CCTTCCCCTGGACCAACTCTTGG - Intronic
1105745987 13:23377333-23377355 GCTTTTCCTGGACCACCTCTGGG + Intronic
1105887440 13:24653727-24653749 CCTTATGCTGGACCACCCCTTGG + Intergenic
1106870098 13:34009936-34009958 GTGTTTCCGGGACCCCCTCTTGG - Intergenic
1112310642 13:98314791-98314813 GCATTTCCCAGAGCACCTCTAGG + Intronic
1117285479 14:54282538-54282560 GCTTTTCCTGGGCCTGCTCATGG - Intergenic
1118763581 14:68895394-68895416 GCTTTTCCTGGAGCCTGTCTAGG + Intronic
1118867342 14:69713718-69713740 GCTTTACCGGGCTCACCTCTAGG + Exonic
1119655905 14:76416756-76416778 ACTATTCCTGGCCCATCTCTGGG + Intronic
1121754062 14:96388559-96388581 GCTTTTGCTAGACAGCCTCTAGG - Intergenic
1124083777 15:26526927-26526949 TCTTTTCATGGACCACTTTTTGG + Intergenic
1127610467 15:60631350-60631372 TCTTTTCCTTGACCACCTCAAGG - Intronic
1127910566 15:63412928-63412950 GCTGTCCCTTGACCACCTCTTGG + Intergenic
1128647093 15:69385686-69385708 GCTCCTCATGGACAACCTCTTGG - Intronic
1128995597 15:72292158-72292180 GCTTTCCTTGGAGCCCCTCTAGG - Intronic
1129391350 15:75222502-75222524 GCTCTGCCTGCACCTCCTCTGGG - Intergenic
1132128480 15:99251616-99251638 GCTTTGGCAGGACCACGTCTGGG - Intronic
1133342525 16:5045897-5045919 GCCTTTCCTGGAACACCTCCAGG - Intronic
1134376477 16:13679944-13679966 GCTGTTCTTGGAACACCACTTGG + Intergenic
1136396230 16:29993963-29993985 GCCTTTCCTGGAGCTCTTCTTGG + Exonic
1136684054 16:31983859-31983881 TGTCTTCCTGGACCACCTCCAGG + Intergenic
1136784680 16:32927411-32927433 TGTCTTCCTGGACCACCTCCAGG + Intergenic
1136885103 16:33926395-33926417 TGTCTTCCTGGACCACCTCCAGG - Intergenic
1141537499 16:84692540-84692562 CCTTTTCCTTCTCCACCTCTTGG + Intergenic
1141665515 16:85463367-85463389 GCTGTGCCTGGGCCAACTCTAGG + Intergenic
1142211574 16:88811111-88811133 GTTCTCCCTGGGCCACCTCTTGG + Intronic
1203087338 16_KI270728v1_random:1191417-1191439 TGTCTTCCTGGACCACCTCCAGG + Intergenic
1146790497 17:35747990-35748012 CCTCTTCCTGGACCAGCTCGCGG + Intronic
1147246425 17:39124079-39124101 GCTTTTCCAAGAGCACCCCTGGG + Intronic
1149647782 17:58252623-58252645 GCTAGTCCTGGACCACTGCTAGG - Intronic
1152124515 17:78438276-78438298 GCTTGTCCTCGAGCGCCTCTGGG - Intronic
1152200152 17:78940769-78940791 GGTTTTCCTGCAGTACCTCTTGG + Intergenic
1153259176 18:3206387-3206409 GCTTTTTCTGGGCCTCTTCTGGG + Intronic
1156164754 18:34404748-34404770 CCTTTTCTAGGACCACCTCATGG - Intergenic
1161569472 19:5022650-5022672 GCTGTTCCTGCTCCACCTCTTGG + Intronic
1163478806 19:17542495-17542517 GATGTTCCTGATCCACCTCTGGG + Intronic
1164757530 19:30701594-30701616 GGGGTTCATGGACCACCTCTTGG + Intronic
1166043090 19:40214889-40214911 GCTTTTCATGTAACAGCTCTGGG + Intronic
1166586170 19:43951320-43951342 GAATTTCCTGGACCTACTCTCGG + Exonic
1167859120 19:52269121-52269143 GAGTTTCCTGGGCCACATCTGGG - Intergenic
925236088 2:2278948-2278970 GCTTTCCCTTGCCCAGCTCTGGG + Intronic
926129223 2:10290450-10290472 GCTCTTCCTGGATCCCCTCCCGG + Intergenic
926923234 2:17960282-17960304 GCTTCTCCTGTAGGACCTCTTGG + Intronic
928091477 2:28377472-28377494 GCTTCCCCTTGGCCACCTCTAGG + Intergenic
928684037 2:33729359-33729381 GATTTTCCTGGAGCAAGTCTTGG - Intergenic
929629620 2:43445999-43446021 GTGTTTCCTGGCCCACCTTTGGG - Intronic
929783526 2:44973023-44973045 GCTTATCTTGGAACACCTTTGGG + Intergenic
929967630 2:46547564-46547586 GCTGCTCCTGGACCACCCATGGG - Intronic
930606165 2:53495744-53495766 CCTCTGCCTGGACCACCTCCAGG + Intergenic
932039810 2:68287246-68287268 GCCTTTCCTGATCCACATCTGGG - Intronic
933454918 2:82508206-82508228 GCTTTTCCTGGACCCACCCATGG + Intergenic
935236675 2:101144494-101144516 GCTGCCCCTGAACCACCTCTTGG - Intronic
936687893 2:114849769-114849791 GATGTTCCTGAACCATCTCTTGG - Intronic
938554173 2:132408788-132408810 GCTGGCCATGGACCACCTCTTGG + Intergenic
939738005 2:145873477-145873499 GTTGTTCCTGGATCCCCTCTTGG - Intergenic
941772558 2:169361009-169361031 GATTTTCCTGGATCACATATTGG - Intronic
942171801 2:173296863-173296885 CCTTTTCCTGGGCCTCCTCTTGG + Intergenic
943529914 2:189066418-189066440 ACTGTTCCTGGGTCACCTCTGGG + Exonic
947487454 2:230565312-230565334 TCCTTGCCTGGACCACTTCTTGG + Intergenic
1174715984 20:52759253-52759275 GCATCTGCTGGACCACCTGTGGG + Intergenic
1175323120 20:58103334-58103356 GATTGTCCTGGACTCCCTCTTGG - Intergenic
1177630600 21:23722351-23722373 GCTTTTCCTGAACCTCCTCCAGG - Intergenic
1177908134 21:26997309-26997331 TCTTTCCCTGGTCCACCTGTGGG - Intergenic
1179112589 21:38460238-38460260 GCCTTTCCTGGTTCACCTCCTGG - Intronic
1181876017 22:25941440-25941462 GCTCTTCCTGGAGCTCCTCAGGG + Intronic
1182977819 22:34639975-34639997 GCTTTTCCTGTTCCTCCTCCTGG - Intergenic
1183684730 22:39355164-39355186 GCCTCTCCTGGGCCACCCCTTGG - Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
951571521 3:24068344-24068366 GCTTTTACTGGTCTATCTCTAGG - Intergenic
951709813 3:25576420-25576442 GCATTTCTTGGACATCCTCTAGG + Intronic
954408477 3:50358784-50358806 GCGTTTGCTGGAGCCCCTCTGGG - Exonic
954899294 3:54005437-54005459 GCTTCTGATGGTCCACCTCTAGG - Intergenic
963084695 3:141426133-141426155 GCTTATGCTGGAGCCCCTCTGGG - Intronic
963258504 3:143170022-143170044 GGTTTTACTGGACAAACTCTGGG + Intergenic
965499434 3:169440438-169440460 GCTTTTCTTGGACCTCCACTTGG - Intronic
968027638 3:195455928-195455950 GCTTTTCATTGACCAACCCTAGG + Intergenic
968585144 4:1412861-1412883 CCTCTTCCTGCACCGCCTCTGGG - Intergenic
970082263 4:12300822-12300844 GCTTTGACTTGATCACCTCTTGG - Intergenic
973941277 4:55913005-55913027 GCTTTTCCTAGAATACTTCTAGG - Intergenic
978431713 4:108639868-108639890 GCCTTCCCTGGTCCAGCTCTTGG + Intergenic
980674387 4:136056416-136056438 ATTTTTCCTAGACCATCTCTGGG + Intergenic
981398502 4:144283349-144283371 GCTTTTCGTGGACCAGTCCTAGG + Intergenic
981688643 4:147481791-147481813 GCTTTTCCTCCCCCACATCTGGG + Intronic
985013423 4:185607184-185607206 TCGTTTCCTGGACAACTTCTTGG - Intronic
989563378 5:42876022-42876044 GCTTTCCCTGAACCAACTCCTGG - Intronic
990139291 5:52684037-52684059 GCTTTTCCTGGGCAATCTATTGG + Intergenic
996425989 5:123313740-123313762 GCTTTACCTACTCCACCTCTGGG - Intergenic
997026415 5:130067626-130067648 GCTTTCCCTGGACCTTCTCTAGG - Intronic
997421044 5:133766981-133767003 GCCTTTCCTTGACCATCTCCTGG - Intergenic
998348545 5:141485746-141485768 GCTTCTCCAGGAGCAGCTCTGGG - Exonic
999020898 5:148164357-148164379 GCTTTCTCTGCTCCACCTCTTGG + Intergenic
1004427147 6:15514127-15514149 GCTTTTCTGAGCCCACCTCTGGG - Intronic
1007287250 6:40756459-40756481 GATTTCCCAGGACCCCCTCTGGG + Intergenic
1011775967 6:90730957-90730979 ATTTTTCCTGGGCCACCTCTTGG + Intergenic
1020474844 7:8582711-8582733 GCTTTTTCTGGCCCACCTGTGGG - Intronic
1023907862 7:44534810-44534832 GGGTTTCCTGGACCTCCCCTTGG - Intronic
1023998121 7:45174405-45174427 GCTGTTCTTGGTCCATCTCTGGG + Intronic
1032609522 7:133397042-133397064 GCTTTGTCTGGACCAGCTCCAGG - Intronic
1033252574 7:139773781-139773803 GCTCTTGGTGAACCACCTCTGGG + Intronic
1033441664 7:141385723-141385745 GTTATTCCTGGACCACCTGTTGG + Intronic
1035534378 8:379907-379929 TCTTTTCCTGTTCCTCCTCTAGG - Intergenic
1036504040 8:9339208-9339230 GATTTTCCTGGGCCACCTTGAGG + Intergenic
1038409443 8:27346749-27346771 TCTTTTCCTTGAGCACCTGTTGG + Intronic
1039470420 8:37809929-37809951 GCTTGTCCTTGCCCTCCTCTGGG + Intronic
1048461720 8:134626707-134626729 GCTCATCCAGGCCCACCTCTGGG + Intronic
1049041797 8:140118122-140118144 GCTTTGCCTGGAGCAAATCTTGG - Intronic
1049342110 8:142118748-142118770 GATTTTCCAGGCCCACCTCTAGG + Intergenic
1049423229 8:142525963-142525985 GCTGTTCCTGGAGCACCCCCGGG - Intronic
1051709647 9:19918730-19918752 GCTTTTCTTGGACCACATGTGGG - Intergenic
1052310529 9:27063049-27063071 GCTTTTCTTGTATCAACTCTAGG + Intergenic
1055113169 9:72579554-72579576 CTTTTTCCTGGAGCCCCTCTTGG + Intronic
1055889075 9:81103605-81103627 GCTTTTCCAGAACCAAGTCTAGG + Intergenic
1061253566 9:129440529-129440551 GCTTTGCCTGGACTCCCTCATGG - Intergenic
1062099044 9:134718540-134718562 GCTTCTCCTGTTCCACGTCTTGG - Intronic
1062405799 9:136395647-136395669 GCTTCTCCTGGATGACCTCCTGG + Exonic
1190034148 X:47005105-47005127 GCTTCTCCAGCACCAACTCTGGG - Intronic
1195964974 X:110421830-110421852 GCTTTTCCTGTCACACCTCAAGG - Intronic
1198265164 X:135002070-135002092 GCCTTTCCTGAACCACACCTTGG + Intergenic
1199090476 X:143686106-143686128 GCTATTCCTGGACCAGCTCTCGG - Intergenic
1200018586 X:153183109-153183131 ACTTTTCCTGCACCAAATCTTGG - Exonic