ID: 1105745995

View in Genome Browser
Species Human (GRCh38)
Location 13:23377392-23377414
Sequence CAGGCTCCACGGAAAAACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105745995 Original CRISPR CAGGCTCCACGGAAAAACCG AGG (reversed) Intronic
901691481 1:10976208-10976230 GAGGCTCCATGGGAACACCGTGG + Exonic
903883551 1:26528788-26528810 CAGGCTCCCAGGATGAACCGAGG - Intergenic
907524172 1:55044389-55044411 CAGGCTCCACTGAACATCCCAGG - Intronic
916735705 1:167605277-167605299 CAGTCTCCACTGAGAAACCTGGG + Intergenic
918069151 1:181122358-181122380 CAGGCTCCTGGGAAAACCCGGGG - Intergenic
1067215705 10:44300814-44300836 CAGGCACCATGGAAACACCGTGG - Intergenic
1075247083 10:120832279-120832301 CAGGCTCCACGGGACAGCTGAGG + Intergenic
1075418984 10:122286925-122286947 CAGGTGCCACGGAAAATTCGAGG + Intronic
1077342828 11:2033589-2033611 CAGGGCCCAGGGAAAAACTGAGG + Intergenic
1077847528 11:6041649-6041671 GAGGCACCACAGAAAAACCTAGG + Intergenic
1084644339 11:70445911-70445933 CAGGCTCCAGGGAAAATGGGAGG + Intergenic
1089626668 11:119755348-119755370 CAGGCTCCAAAGACAAACAGTGG + Intergenic
1202825814 11_KI270721v1_random:88778-88800 CAGGGCCCAGGGAAAAACTGAGG + Intergenic
1101903971 12:108811839-108811861 CTGGCGCCACTGAAAAACAGAGG + Intronic
1105745995 13:23377392-23377414 CAGGCTCCACGGAAAAACCGAGG - Intronic
1106168823 13:27271408-27271430 CAGGCACCTCGGACAAACTGGGG - Intronic
1107133386 13:36919851-36919873 CAGGCTCCACCAAAAAACCCGGG + Intronic
1112503052 13:99956930-99956952 CAGGCTCCTCGGAAAGACATCGG + Intergenic
1113470978 13:110545931-110545953 CTGACTCCACAGAAACACCGTGG + Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115058210 14:29156744-29156766 CAGGCTCCAGGGAAGAGACGGGG - Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1122935497 14:104954178-104954200 CAGGCTCCATGGAAAGACCCTGG - Exonic
1137391584 16:48085862-48085884 CAGGCACCAGGGAAAGACCAGGG + Intronic
1141596661 16:85101102-85101124 CAGGCCCCATGGAAAAGCCGTGG + Intronic
1147306779 17:39569633-39569655 TAGGATCCACGGAAAAACCTGGG - Intergenic
1152834274 17:82519528-82519550 CGGGCGCCGCGGAAAACCCGGGG - Intergenic
1158299628 18:56036789-56036811 CAGGCTCCCCTGAAGAACAGAGG - Intergenic
1162369471 19:10270288-10270310 CAGGCTCCGCGGGGAAACTGAGG - Intergenic
1163372111 19:16907088-16907110 GAGGCTCCACTGACAAAGCGAGG - Exonic
1163632380 19:18424072-18424094 CAGTCTCCAGGGAAGAACTGTGG - Intronic
924992886 2:329002-329024 CAGGCTCCATGGAACATCTGAGG - Intergenic
935148991 2:100417293-100417315 CGGGGCGCACGGAAAAACCGGGG - Intronic
1171376288 20:24696268-24696290 CAGGCTTCATGGAAAAGCAGAGG + Intergenic
1174198496 20:48790421-48790443 CAGGCTCCAAGGAAAAAGGAGGG + Intronic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1180017727 21:45098182-45098204 CAGGCTCCACGGACCCACCAGGG + Intronic
1180941039 22:19659563-19659585 CAGGCCCCAGGGAAACACCCAGG + Intergenic
1182584913 22:31339381-31339403 CAGGCTCCCCAGAAAACCTGGGG - Intronic
1182745230 22:32600597-32600619 CATGCCCCACGGGAAGACCGTGG - Intronic
1184590378 22:45478010-45478032 CAGGCTCCAGGGAAAGACTTTGG + Intergenic
949545230 3:5066771-5066793 CCTGCTCCACGGAAAGACAGAGG - Intergenic
960375861 3:116900537-116900559 CAGGGTTCAGGGAAAAACTGGGG + Intronic
960526920 3:118720563-118720585 CAGGCTCCACAGAAGAACGGAGG - Intergenic
961094453 3:124142564-124142586 CAGGAACCACTGAAAAACCCTGG - Intronic
962012628 3:131407857-131407879 CAGGCTCCATGGGACAGCCGAGG + Intergenic
966783420 3:183604121-183604143 CTGGCTCCATGGAAACACAGGGG + Intergenic
968617204 4:1582889-1582911 CAGGATCCAGAGAAAAACCTTGG + Intergenic
983787852 4:171757589-171757611 CAGTCTCCACAGAAAAATGGGGG - Intergenic
993901983 5:93590376-93590398 CAGGCTGCAGGGAAACACTGTGG + Intronic
997361969 5:133300897-133300919 CCGGCTCCACAGAGAAAGCGGGG - Intronic
1008430466 6:51410694-51410716 CAGGCTCCCCGGAAAGGACGGGG - Intergenic
1010180853 6:73085327-73085349 CACGCTCCAGGCAAAAAACGAGG + Intronic
1012959415 6:105606948-105606970 CAGGCCCCAGGGAAACACTGTGG - Intergenic
1021624239 7:22576809-22576831 CAGGGTCCAGGGAAAATCCCAGG + Intronic
1024001642 7:45193862-45193884 CAGTCTCCATGGAAAAAGAGAGG + Intergenic
1035569284 8:661307-661329 CAGGCTCCAGGGCAGAACTGTGG - Intronic
1041090991 8:54300398-54300420 CAGACTCCACCGCAAAACCATGG - Intergenic
1049738801 8:144224590-144224612 GAGGCTCCACGGAAACAGCAAGG - Intronic
1049773525 8:144394538-144394560 CAGGCTCCACAGGAAAATCTGGG + Exonic
1061923982 9:133797082-133797104 CAGGCTCCACGCAGAAACCAGGG + Intronic
1186394767 X:9196441-9196463 CTGGCTCCATGGAAAAACCTGGG + Intergenic
1196180735 X:112687004-112687026 CAGGCTCCTCCAAAAAACCTGGG + Intergenic
1196689805 X:118547267-118547289 CAGGCTGCAAGTAGAAACCGTGG + Intronic