ID: 1105750602

View in Genome Browser
Species Human (GRCh38)
Location 13:23419419-23419441
Sequence GCCTCTCCTAGACGGCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105750602_1105750609 11 Left 1105750602 13:23419419-23419441 CCTAGAGGCCGTCTAGGAGAGGC 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1105750609 13:23419453-23419475 AGTCTCAACAGGGCTTGATGGGG 0: 1
1: 0
2: 1
3: 13
4: 117
1105750602_1105750607 9 Left 1105750602 13:23419419-23419441 CCTAGAGGCCGTCTAGGAGAGGC 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1105750607 13:23419451-23419473 AGAGTCTCAACAGGGCTTGATGG 0: 1
1: 0
2: 2
3: 21
4: 155
1105750602_1105750606 1 Left 1105750602 13:23419419-23419441 CCTAGAGGCCGTCTAGGAGAGGC 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1105750606 13:23419443-23419465 TGCAGTTCAGAGTCTCAACAGGG 0: 1
1: 0
2: 3
3: 24
4: 144
1105750602_1105750605 0 Left 1105750602 13:23419419-23419441 CCTAGAGGCCGTCTAGGAGAGGC 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1105750605 13:23419442-23419464 CTGCAGTTCAGAGTCTCAACAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1105750602_1105750608 10 Left 1105750602 13:23419419-23419441 CCTAGAGGCCGTCTAGGAGAGGC 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1105750608 13:23419452-23419474 GAGTCTCAACAGGGCTTGATGGG 0: 1
1: 0
2: 1
3: 11
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105750602 Original CRISPR GCCTCTCCTAGACGGCCTCT AGG (reversed) Intronic
901337512 1:8463848-8463870 GCCTGGCCTAGGCGGCCTCAGGG - Intronic
902755204 1:18544909-18544931 TGCTCTCCTAGCTGGCCTCTGGG - Intergenic
907074250 1:51564391-51564413 CCCTCTTCTTGAAGGCCTCTTGG + Intergenic
912527506 1:110294651-110294673 ACCTCTCCTAGAAGGGCTCCTGG + Intergenic
914896103 1:151675043-151675065 ACCTCTCCTAGATGGCCACCTGG + Intronic
916000704 1:160612481-160612503 GCCTCACCTGGACAGACTCTGGG + Exonic
918049469 1:180961790-180961812 CCCTTTCCTAGATGGCTTCTAGG + Intergenic
921287615 1:213622999-213623021 GGCTTTCCTGGACTGCCTCTAGG - Intergenic
922586135 1:226736423-226736445 GCCTCTCCACCAGGGCCTCTGGG + Exonic
1070238738 10:74656536-74656558 CTCTCTCCTATACTGCCTCTGGG - Intronic
1072104022 10:92256876-92256898 GCCTTTCCTAGAAGACCTCCAGG + Intronic
1075097404 10:119481596-119481618 GCCTCTGCTCGAATGCCTCTTGG + Intergenic
1076217944 10:128710974-128710996 GCCTCTCCCACCCGGCCTCGAGG + Intergenic
1076546698 10:131250176-131250198 GATTCTCCTTGACAGCCTCTGGG - Intronic
1078664253 11:13311351-13311373 GACTCTCCTCCATGGCCTCTGGG - Intronic
1084410697 11:69004539-69004561 GCAGCTCCTGGACAGCCTCTTGG - Exonic
1089791492 11:120948141-120948163 GCCTCTCCCAGAAGGAGTCTTGG + Intronic
1090383541 11:126343503-126343525 GTCTCTCCAAGATGGACTCTGGG - Intronic
1091599270 12:1908218-1908240 GCCTCTCCGCGCCGGCCTCCTGG - Intronic
1094813947 12:34166152-34166174 GCCTCTCCTAAACGGGCTTTGGG - Intergenic
1095102972 12:38202365-38202387 GCCTCTCCTAAACGGGCTTTGGG + Intergenic
1100956634 12:99916170-99916192 GCCTCCCCTTGATGGGCTCTGGG - Intronic
1101903074 12:108806031-108806053 GCCTCACCTATATGGCCTTTGGG - Intronic
1103351015 12:120283603-120283625 GCCTCTCCTAGAGGGCCGAAGGG - Intergenic
1105750602 13:23419419-23419441 GCCTCTCCTAGACGGCCTCTAGG - Intronic
1106180077 13:27362644-27362666 GCCTCACCTAGATGTCCTTTGGG + Intergenic
1106416155 13:29547745-29547767 GCTTCTCCTAGACAGACTCGAGG - Intronic
1107556564 13:41520870-41520892 GCCTCTCCTAGATGGCTTTGGGG + Intergenic
1108122331 13:47202564-47202586 GCCATTCCTAGATGTCCTCTTGG - Intergenic
1110617152 13:77554044-77554066 GCCTCTCAGAAACGGCTTCTGGG - Intronic
1112710872 13:102127694-102127716 GCCTTTCCTAGAAGGAATCTAGG - Intronic
1120701804 14:87706307-87706329 GCCTCTCCTGCAAGGCCACTTGG + Intergenic
1120849607 14:89158123-89158145 GCCTCTCCTGGAAGGGCTCTTGG - Exonic
1121623923 14:95371168-95371190 GCCTCTCCCTGAAGGCGTCTCGG + Intergenic
1121754062 14:96388559-96388581 GCTTTTGCTAGACAGCCTCTAGG - Intergenic
1122130529 14:99602629-99602651 GCCTCTCCCCAACTGCCTCTGGG + Intronic
1126421696 15:48480413-48480435 TCAACTCCTATACGGCCTCTCGG - Intronic
1127696892 15:61458949-61458971 GCCTCTCCACGAAGCCCTCTTGG - Intergenic
1132674251 16:1115098-1115120 GCCTCTCCTGGCTGGCCTCTAGG + Intergenic
1132687931 16:1170068-1170090 GCCTCTCCAGGGCGGCCTCCCGG + Intronic
1137748720 16:50842332-50842354 GCATCTCCTAGCGGGCCTCTCGG + Intergenic
1138673076 16:58630726-58630748 TCCTTTCTTAGACGGCTTCTAGG - Intergenic
1144130080 17:12238403-12238425 GCCTCTCCTGGAAGGGCTCTTGG - Intergenic
1145887318 17:28391472-28391494 GCCCCTCCTACATGGCCTCTGGG - Intronic
1149649387 17:58267530-58267552 GCCTCTCCTGGCCTGCCTCTTGG + Exonic
1151697242 17:75723887-75723909 GCATCTCTTAGAGGGCCTCAGGG + Intronic
1152447144 17:80352327-80352349 ACCTCTCCTGGACTGACTCTAGG + Intronic
1152600589 17:81260276-81260298 GCCTCTCCAAGCCGGCCGCCAGG + Exonic
930753905 2:54957394-54957416 GCCGCTCCCAGAGGGCCACTGGG - Intronic
932765260 2:74465170-74465192 GCCTCCCCGAGCCGCCCTCTCGG + Exonic
933193523 2:79363825-79363847 GCCTGTCCTGGACTGCTTCTTGG - Intronic
934063619 2:88319904-88319926 GCCTCTCCTAGACCTTGTCTTGG - Intergenic
935727727 2:106038211-106038233 GGCTCTCCCAGACAGCCTCCTGG + Intergenic
946739848 2:222790555-222790577 TCCTCTCCAACATGGCCTCTGGG - Intergenic
948368258 2:237472564-237472586 GCTTCTCCTAGAAGGCCACCAGG - Intergenic
948551509 2:238775829-238775851 GCCTGTCCAATCCGGCCTCTGGG - Intergenic
1173846512 20:46191989-46192011 GCCTCTCCTAGAAGAAATCTGGG - Intronic
1174688804 20:52482084-52482106 CCCTCTACTCGACGGCTTCTTGG - Intergenic
1175503978 20:59469152-59469174 GCCTCTCCCCGACTGCCTCCAGG - Intergenic
1183292298 22:37010255-37010277 GCCTCTCTTAGACCTCCTTTGGG - Intergenic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1185138405 22:49086844-49086866 GCCTCTCCCCGACGGCCTCCTGG - Intergenic
950576200 3:13833565-13833587 GCCTCTCCTAGATGCATTCTGGG + Intronic
956702915 3:71974343-71974365 CCCACTCCTAGACGCCCTGTGGG + Intergenic
961146798 3:124600777-124600799 GCCTCTCCAAACCTGCCTCTAGG - Intronic
961773680 3:129268638-129268660 GCCTGGCCTTGATGGCCTCTGGG - Intronic
963983215 3:151563187-151563209 CCCTCTCCTAGAGGGCCGCAGGG - Intergenic
968896953 4:3409863-3409885 GCCTCGCCTAGGCAGCCTCCAGG + Intronic
969391509 4:6894571-6894593 CCCTCCCCTAGACGGCCACCAGG - Intergenic
973845808 4:54912097-54912119 GTCTCTCCTATACAGCCTGTTGG - Intergenic
978366766 4:107990536-107990558 TTCTCTCCTAAACGGCCTCCCGG + Intronic
982508918 4:156255460-156255482 GCCTCTCCTAGATGTTTTCTTGG + Intergenic
985194475 4:187413619-187413641 GCCTCTCCTGGGCAGCCTCATGG + Intergenic
985590442 5:761732-761754 GCCTCTCAGAAAAGGCCTCTTGG + Intronic
997225905 5:132209203-132209225 GCCTCTCATAGATGCCTTCTGGG + Exonic
998767288 5:145501993-145502015 GCCTCTGCTAGACAGTTTCTAGG - Intronic
1000616936 5:163437708-163437730 CCCTCTCCTCGTAGGCCTCTCGG + Exonic
1001309626 5:170601736-170601758 GCCTCTCCCTGCCGGCCTGTGGG - Intronic
1001318710 5:170663007-170663029 GCCTCTCCTAGGTGTCCTCAGGG - Intronic
1007718089 6:43869033-43869055 GCATCTGCTCGCCGGCCTCTGGG - Intergenic
1016646118 6:146410592-146410614 GCCTTTACTAGAGGCCCTCTAGG - Intronic
1019201115 6:170316298-170316320 GCCTCTCCTAGACAGGCTGAAGG - Intronic
1022797712 7:33745364-33745386 GCCTCTCCTAGGCTGGCTCCCGG - Intergenic
1023815457 7:43946133-43946155 GCCTCACCTACACTCCCTCTGGG - Intronic
1024995179 7:55268748-55268770 GCCTCTCCTGGAGGGACTCCTGG - Intergenic
1031726472 7:125246199-125246221 GTCTCTGCTAGAGTGCCTCTGGG - Intergenic
1035640752 8:1183191-1183213 CCCGCTCCGAGACGCCCTCTCGG - Intergenic
1037951127 8:23019351-23019373 GCCTCCCCTCCACGGCCTCCAGG + Intronic
1038672771 8:29595697-29595719 TCCTCTCCCAGATGGCCTCTGGG - Intergenic
1041746812 8:61216074-61216096 TCCTCTCCTAGACTGCCTTGGGG + Intronic
1044622706 8:94205892-94205914 CACTCTGCTAGATGGCCTCTTGG + Intronic
1048974657 8:139664412-139664434 CCCTCCCCTACACAGCCTCTAGG + Intronic
1051723134 9:20060546-20060568 GCCTCTACTAGATGGCCATTTGG - Intergenic
1052850121 9:33373153-33373175 GCCTCTCCAAGACAGGATCTAGG - Intergenic
1053362960 9:37502570-37502592 GGCTCTCCTAGACACCCTCTGGG - Intronic
1060058241 9:120434541-120434563 GCCTCTCCTGTTTGGCCTCTGGG - Intronic
1060781264 9:126415017-126415039 CCCACTCCCAGCCGGCCTCTCGG + Intronic
1062358374 9:136175789-136175811 GCCCCTCCTCGAAGGCCCCTCGG - Intergenic
1062521515 9:136959834-136959856 GCCCCTCCCAGGCTGCCTCTTGG - Intergenic
1203780841 EBV:100024-100046 GCCTCTCCTTCACGGCCTCCTGG - Intergenic
1185547160 X:954704-954726 CCCTCTCCCACACGGCTTCTGGG - Intergenic
1188086918 X:25910209-25910231 GTCTCTCCTAGTCATCCTCTGGG - Intergenic
1192938606 X:75888090-75888112 GCCTCTCCTGGAAGGGCTCTTGG + Intergenic