ID: 1105753506

View in Genome Browser
Species Human (GRCh38)
Location 13:23444019-23444041
Sequence CCCTTTCAGCAGAAGAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 2, 1: 11, 2: 10, 3: 34, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105753506_1105753514 6 Left 1105753506 13:23444019-23444041 CCATCCCTCTTCTGCTGAAAGGG 0: 2
1: 11
2: 10
3: 34
4: 264
Right 1105753514 13:23444048-23444070 AGGTGGTTTGGCACTTGATGAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1105753506_1105753512 -6 Left 1105753506 13:23444019-23444041 CCATCCCTCTTCTGCTGAAAGGG 0: 2
1: 11
2: 10
3: 34
4: 264
Right 1105753512 13:23444036-23444058 AAAGGGAAATCCAGGTGGTTTGG 0: 1
1: 6
2: 10
3: 33
4: 249
1105753506_1105753515 14 Left 1105753506 13:23444019-23444041 CCATCCCTCTTCTGCTGAAAGGG 0: 2
1: 11
2: 10
3: 34
4: 264
Right 1105753515 13:23444056-23444078 TGGCACTTGATGAGGATGATTGG 0: 1
1: 0
2: 0
3: 16
4: 132
1105753506_1105753516 15 Left 1105753506 13:23444019-23444041 CCATCCCTCTTCTGCTGAAAGGG 0: 2
1: 11
2: 10
3: 34
4: 264
Right 1105753516 13:23444057-23444079 GGCACTTGATGAGGATGATTGGG 0: 1
1: 0
2: 0
3: 17
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105753506 Original CRISPR CCCTTTCAGCAGAAGAGGGA TGG (reversed) Intergenic
900548639 1:3242442-3242464 CCCTTTCACCAGACCTGGGATGG + Intronic
901036283 1:6338219-6338241 CCCTTCCTGGAGAGGAGGGATGG - Intronic
901445136 1:9303910-9303932 CCCTGTCAGCAGAAAAGGGATGG - Intronic
901770523 1:11528171-11528193 TCCTTCCAGCAGAAGGGGCAGGG - Intronic
901926721 1:12570854-12570876 CCCTTTCAGAGGCACAGGGAAGG - Intronic
905805332 1:40872784-40872806 CCCTGTCAGAAAAAGAGGAAAGG - Intergenic
906244227 1:44261945-44261967 CTCTTTCAGCAGAACAGGAAGGG + Intronic
907009473 1:50950083-50950105 CACTTTGAGAAGAAGAGGCACGG - Intronic
908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG + Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909844603 1:80376168-80376190 CCATTTGATCAGAAAAGGGAAGG + Intergenic
910407432 1:86904173-86904195 CACATCCAGCAGAAGAAGGACGG + Intronic
911427682 1:97741087-97741109 TCTCTTCAGCAGCAGAGGGAAGG - Intronic
912528301 1:110301670-110301692 CCCATTGAACAGATGAGGGAAGG - Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
913713471 1:121510756-121510778 CCCTTTAAGCTGTAGGGGGAGGG + Intergenic
913969253 1:143402110-143402132 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
914063630 1:144227709-144227731 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
914115520 1:144738645-144738667 CCCTTCAAGAAGAAGTGGGAAGG - Intergenic
916192118 1:162189934-162189956 CCCTCCCAGCAACAGAGGGATGG + Intronic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916602340 1:166305341-166305363 ACCTTTCAGCAGAGGCTGGAAGG + Intergenic
916932913 1:169597989-169598011 CCCATCCAGTAGAAGAGTGAGGG - Intronic
917227538 1:172800593-172800615 CCCTTGAAGCTGTAGAGGGAGGG + Intergenic
918125959 1:181583813-181583835 TCCTTCCACCAGAGGAGGGAGGG - Intronic
919206251 1:194424194-194424216 CCCTTCAAGCTGTAGAGGGAGGG + Intergenic
919726666 1:200888880-200888902 CCCCTTCAGCCAAAGTGGGAAGG + Intergenic
920535204 1:206732651-206732673 CCTCTTCAGCAGCAGAGGGTTGG - Exonic
921944556 1:220877865-220877887 ACCTTTCAGTAAAAGAGAGATGG + Intergenic
922677605 1:227562081-227562103 CCCTTTGAGCAGGACAGGGTAGG - Intergenic
924810916 1:247401308-247401330 CACATTCAGCAGCAGTGGGAGGG - Intergenic
1062902988 10:1159632-1159654 CGCTTTATGCAGATGAGGGATGG + Intergenic
1062908445 10:1195683-1195705 CTGGTTCAGAAGAAGAGGGATGG + Intronic
1064202244 10:13294650-13294672 CCCTTTCCACAGAGGAGGGCAGG - Intronic
1066598416 10:37077611-37077633 CCTTTTTAGCAGAAAAGGAACGG - Intergenic
1069808568 10:71141694-71141716 CCCTCTCCGCAGTAGAGGCAGGG - Intergenic
1071600391 10:86956043-86956065 CCCTTTCATCAAAAGGCGGAAGG + Intronic
1073603813 10:104873081-104873103 CCCTTTCTGCAGCAGAGAGCTGG + Intronic
1073714440 10:106086806-106086828 TCCTTTCATCAGACTAGGGATGG + Intergenic
1077347754 11:2071978-2072000 GGCTCTGAGCAGAAGAGGGACGG - Intergenic
1078142665 11:8703213-8703235 CTCTTTCTGCAGGAAAGGGAGGG - Intronic
1079777931 11:24557879-24557901 TCCTTTCAGCAGAAGAGAAACGG - Intronic
1079849915 11:25519038-25519060 TCCTCTCATCAGAAGAAGGAAGG + Intergenic
1080142404 11:28938406-28938428 CCCACTCAGATGAAGAGGGAGGG + Intergenic
1080847551 11:36039287-36039309 CCCTTTCAGCCTAGGAGTGAGGG + Intronic
1081500329 11:43660167-43660189 ACCCTCCAGCAGGAGAGGGAGGG - Intronic
1081908962 11:46688036-46688058 CTCCTTCATGAGAAGAGGGAAGG + Intronic
1084196285 11:67524927-67524949 ACCTTGCAGCAACAGAGGGAAGG - Intergenic
1085481087 11:76823604-76823626 CCCTTTCAGGAGAAGGAGGTGGG + Intergenic
1085891476 11:80584912-80584934 TCCTTTTAGCAGAAAAGGAATGG + Intergenic
1086807843 11:91267547-91267569 CCCTTTCAGCAGAAAAGGGTTGG + Intergenic
1087459022 11:98422809-98422831 CCCTTCCAGCTGTAGGGGGAGGG - Intergenic
1087464794 11:98490710-98490732 CCCTTTTAGAAGAAGGGTGAAGG + Intergenic
1087688295 11:101290240-101290262 TTCTTTCAGCAGAAGAGGGATGG - Intergenic
1089677050 11:120097127-120097149 CCCTCGCAGCAGGAGGGGGAAGG + Intergenic
1090719848 11:129461324-129461346 CCCATTCACCAAAAGAGGGCTGG - Intergenic
1091732132 12:2889189-2889211 CCTTTTCAGCAGATGAGTCAAGG - Exonic
1091736014 12:2922688-2922710 CTCTGTCAGAAGAAGAGGGTGGG - Intronic
1091822995 12:3490624-3490646 CCCTTTCAGGCTGAGAGGGAGGG - Intronic
1092047954 12:5445970-5445992 ACCCTTCAGCAGATGAGAGACGG - Intronic
1093272722 12:17084166-17084188 CTCTTTCAGCAGAAGAGGAATGG - Intergenic
1094754924 12:33456720-33456742 TCCTTTCAGTCGTAGAGGGAGGG - Intergenic
1095732493 12:45521187-45521209 CCCTTTCAGCAGAAGAGGGGTGG + Intergenic
1096599704 12:52720897-52720919 CCCTCTGAGGAGACGAGGGACGG + Intergenic
1098084001 12:66821792-66821814 GACTTTCATCAGAATAGGGATGG + Intergenic
1100193362 12:92217088-92217110 CCATTTCAGAATAAGAAGGAAGG - Intergenic
1100605563 12:96149531-96149553 CCCTTTCAGGTTTAGAGGGAGGG - Intergenic
1102138185 12:110592734-110592756 CACTTTCAGCAGCGGAGGCATGG - Intergenic
1102485062 12:113249930-113249952 CCATTTCAGAAGAAGGGTGATGG - Intronic
1102829872 12:115988123-115988145 CCCTTCTAGCTGATGAGGGAAGG + Intronic
1104067767 12:125319566-125319588 CCATCTCAGCAGGATAGGGAGGG - Intronic
1104121339 12:125803029-125803051 CCCATTCACCACCAGAGGGATGG + Intergenic
1104331883 12:127854717-127854739 CCAGTGCAGAAGAAGAGGGAAGG + Intergenic
1105753506 13:23444019-23444041 CCCTTTCAGCAGAAGAGGGATGG - Intergenic
1106653726 13:31719698-31719720 CCCTTTCAGAAGAAGACAGGCGG + Intergenic
1107226468 13:38055015-38055037 TCCTTACAGCAGAGTAGGGATGG + Intergenic
1107869577 13:44734685-44734707 CCCTCTCAGCAGCCGAGGGAAGG - Intergenic
1108373491 13:49792814-49792836 CCCTTGCAGGGGAAGAGGGCAGG - Exonic
1108841917 13:54628213-54628235 CCCTTTCAACAGAAGTGAGATGG + Intergenic
1108848580 13:54702426-54702448 CCCTTCAAGCTGTAGAGGGAGGG + Intergenic
1109388641 13:61665889-61665911 CCCTTGCAGCAGAAGAGGATGGG + Intergenic
1111034140 13:82648409-82648431 CCATTTCAGCAGAAGATGTCAGG + Intergenic
1111762912 13:92487901-92487923 CCCTTTGATGAGAAGAGGTAAGG + Intronic
1112326982 13:98448098-98448120 CCACTTCAGCAGAAGAGCAAGGG - Intronic
1114320528 14:21543692-21543714 TTCATTCAGCAGAAGATGGAAGG + Intergenic
1116778781 14:49212762-49212784 CCCTTTCAGCGGAAGAGGGATGG - Intergenic
1119529845 14:75352431-75352453 CCTTTGCAGCAGGTGAGGGAGGG + Intergenic
1120249928 14:82050974-82050996 CCCTTTAAGCAGAAGACAAAGGG - Intergenic
1120885623 14:89449784-89449806 CCCCTTCAGTTGAGGAGGGAGGG - Intronic
1121623337 14:95365751-95365773 TCCTGTCAGCAGAAAAGGGAGGG - Intergenic
1121816192 14:96930817-96930839 CCATTTTAGCATAAGAGGGTTGG - Intronic
1121901082 14:97694027-97694049 CCCTGTGAGCAGAGCAGGGATGG - Intergenic
1121953875 14:98196707-98196729 TCCATTCAGCAGCATAGGGAGGG + Intergenic
1122781938 14:104147413-104147435 CCCTCCCAGCAGAGGAGGAAGGG + Intronic
1123149284 14:106165750-106165772 GCTTTTCATCAGAAAAGGGAGGG + Intergenic
1123189756 14:106557497-106557519 CATTTTCATCAGCAGAGGGAGGG + Intergenic
1123197666 14:106631753-106631775 GATTTTCAGCAGCAGAGGGAGGG + Intergenic
1123403884 15:20009430-20009452 CTCTGGCAGCAGAAGAGGGGAGG + Intergenic
1123513224 15:21016076-21016098 CTCTGGCAGCAGAAGAGGGGAGG + Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1124704760 15:31954413-31954435 CCCTGAGATCAGAAGAGGGAAGG + Intergenic
1126954315 15:53915074-53915096 CCCTTTCCTCACAGGAGGGAGGG + Intergenic
1127731422 15:61805774-61805796 CCCCTTCAGGAGAAAAGGGATGG + Intergenic
1128563147 15:68681884-68681906 CCCTTTCTGCATAAGAGGACTGG - Intronic
1128873984 15:71187055-71187077 CCTTTTCAGCAGAGGAAGGCGGG + Intronic
1129247228 15:74286900-74286922 CCCTATGAGGGGAAGAGGGAGGG - Intronic
1129452776 15:75659994-75660016 CCCTTTCAGCAGGAGATTGGGGG + Exonic
1129792924 15:78353609-78353631 CCCTATCCCCAGAAGTGGGAGGG + Intergenic
1130029282 15:80296860-80296882 TCCTTTCAGCAGAAGAGGAATGG + Intergenic
1130152522 15:81322328-81322350 CCCTTCCAGAAGAAATGGGAGGG + Intronic
1130370350 15:83281118-83281140 CTATTTCAGCCGAAGAGGGTGGG - Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1131525755 15:93151139-93151161 CCCTTTCGGCAGCAGAGTCATGG + Intergenic
1131761613 15:95628915-95628937 ACATTTCAGAAGAGGAGGGAAGG - Intergenic
1132206387 15:99988808-99988830 CCCAAACAGCAGAGGAGGGAAGG + Intronic
1132244297 15:100281981-100282003 CCCTTTCCTCACAATAGGGAAGG + Intronic
1133379320 16:5316740-5316762 CCCTTTCAGCAGAAGAGAGATGG - Intergenic
1133736351 16:8618988-8619010 CCATGTCTGCAGCAGAGGGAAGG - Intergenic
1134095597 16:11416441-11416463 CCCATTCTGCAGATGAGGAATGG - Intronic
1135246099 16:20858330-20858352 CCCTTTCCTCACAAGAGGGAGGG - Exonic
1136680934 16:31961813-31961835 GCTTTTCATCAGAAAAGGGAGGG - Intergenic
1136781253 16:32903326-32903348 GCTTTTCATCAGAAAAGGGAGGG - Intergenic
1136888545 16:33950514-33950536 GCTTTTCATCAGAAAAGGGAGGG + Intergenic
1137509946 16:49090395-49090417 ACCACTCAGCAGAAGTGGGATGG - Intergenic
1138105959 16:54287192-54287214 CACTTTCAGCAGCTTAGGGAGGG + Intergenic
1138294448 16:55874304-55874326 CGCTCTCAGCAGAAGGGAGATGG - Intronic
1138836383 16:60441144-60441166 ACCTTTGAGCAGAAGATGAAAGG + Intergenic
1203083909 16_KI270728v1_random:1167308-1167330 GCTTTTCATCAGAAAAGGGAGGG - Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143101161 17:4505600-4505622 CCCTATCTGCAGAAGAGACAGGG - Intronic
1143265345 17:5632685-5632707 CCCTTTCAGCAGGTGAAGGACGG + Intergenic
1144430960 17:15191427-15191449 AGCTCTCAGCAGATGAGGGAAGG + Intergenic
1144633603 17:16889010-16889032 CCCTTCCAGCTGCAGAGGAAGGG - Intergenic
1145804079 17:27713993-27714015 CCCTTCAAGCTGTAGAGGGAGGG + Intergenic
1147837672 17:43346550-43346572 CCCTTTCCTCACAAGAGGGAGGG + Intergenic
1148109852 17:45138173-45138195 CCCTTTGGGGAGAGGAGGGAGGG - Intronic
1149577261 17:57723211-57723233 AGCTTTCAGCAGCACAGGGAAGG + Intergenic
1150021721 17:61621841-61621863 CCCCTTCAGCAGAAGAGAGATGG + Intergenic
1152277278 17:79365265-79365287 CCACTCCAGCAGAAGTGGGAGGG + Intronic
1152534166 17:80940880-80940902 CCCTTGCAGAGGAAGAGGCAGGG - Intronic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1153268344 18:3294522-3294544 CTCTTACAGGAGAAGAGGGAAGG + Intergenic
1155678493 18:28459593-28459615 CCCTGTCAGTAGAAGAGGGATGG + Intergenic
1156164063 18:34396773-34396795 TCCTCTTGGCAGAAGAGGGAGGG + Intergenic
1158505846 18:58044965-58044987 CGCTTTCGGGAGGAGAGGGAGGG + Intronic
1158775602 18:60575025-60575047 AGCTTTCAGCAGGAGAGGCATGG + Intergenic
1161154289 19:2724120-2724142 TCCTTTCAGCAGAACAGCAAGGG + Intronic
1164438565 19:28253558-28253580 CACATGCAGCAGAAGAGAGAGGG - Intergenic
1164523723 19:28998413-28998435 CCCTAGCAGGAGAGGAGGGAGGG + Intergenic
1166531067 19:43543890-43543912 CCCTTTCAGAAGCAGGGGTAGGG + Intronic
1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG + Intronic
926743865 2:16134823-16134845 ACCTTTCAGCAGGATAGGGATGG + Intergenic
927159366 2:20242978-20243000 ACCTGTGAGCAGAGGAGGGAGGG - Intergenic
927583680 2:24279417-24279439 CCCTTTCTTAAGAAGAGTGAGGG + Intronic
927652924 2:24923085-24923107 GCCTTTCAGGGCAAGAGGGAAGG + Intergenic
928064540 2:28150043-28150065 CCATAACAGCAGAAGAGAGAAGG + Intronic
928403163 2:30993841-30993863 CCCCTCCAGCAGAGGAGGCAAGG + Intronic
929909470 2:46076716-46076738 CCCTTTTACCAAAAGTGGGATGG + Intronic
930562822 2:52982233-52982255 CCCTCACAGCAGAAGGGGAAGGG + Intergenic
931128292 2:59302309-59302331 CCCTGTTAGCAAAAGAGGAATGG + Intergenic
931709645 2:64977292-64977314 CCATGTCAGAAGGAGAGGGAAGG - Intergenic
933140473 2:78786946-78786968 CCCTTGCATCAAAAGAGGGATGG - Intergenic
934173944 2:89563011-89563033 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
934284259 2:91637360-91637382 CCCTTCAAGAAGAAGTGGGAAGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
935398682 2:102637753-102637775 TCCTTTAAGCAGATGAGTGAGGG - Intronic
935728426 2:106044315-106044337 CCCTTGCAGCACATCAGGGATGG - Intergenic
936257196 2:110927124-110927146 CCATGTCAGCAGGAGAGAGAAGG + Intronic
937361691 2:121234114-121234136 CCCCTGCAGCAGAAGCGGGACGG - Exonic
937460556 2:122082022-122082044 GCCTGTCTGCAGGAGAGGGAAGG - Intergenic
938947612 2:136227350-136227372 CCCATTCTGCAGATGAGGTAAGG - Intergenic
940063570 2:149600069-149600091 TCCTTTCAGCGGAAGAGCGAAGG + Intergenic
942081247 2:172401404-172401426 CCCTTACAGAAGAATAGGGTGGG + Intergenic
942385819 2:175441675-175441697 TGCTTTCATCAGAAGGGGGAAGG - Intergenic
942547977 2:177084324-177084346 CCCTCTCTGCAGAAGTGGGCTGG - Intergenic
945967254 2:216201712-216201734 CCCTTTCTGCAGAAGAGATTCGG + Intronic
946894382 2:224308421-224308443 CACTTTCAGCTGGTGAGGGAGGG + Intergenic
947489785 2:230583634-230583656 CCCTTTTCCCAGAAAAGGGATGG - Intergenic
947898146 2:233694449-233694471 CCTTTTCAGCAAAAGGGGTATGG + Intronic
948263475 2:236621300-236621322 CTCTTTCAAAAGAAGAGAGAGGG + Intergenic
1171458056 20:25282983-25283005 CCCTCTCAGAAGAGGAAGGAGGG + Intronic
1173346325 20:42203830-42203852 CCCTGGCAGCAGATCAGGGAGGG + Intronic
1173434348 20:43019274-43019296 CCCTTTTAGCAGAAATGGGATGG - Intronic
1175316136 20:58048012-58048034 CTCTTTTTGCAGAAGAGGAAAGG + Intergenic
1176104147 20:63377800-63377822 CCCCTTCAGCAGCAGGGAGACGG + Intronic
1176104782 20:63380847-63380869 GCCTTCCAGCAGAGGCGGGAGGG + Intergenic
1178508405 21:33181773-33181795 CACTCCCAGCAGCAGAGGGAAGG - Intergenic
1179384998 21:40933461-40933483 CCATTTCAGCAGCAGTGGGGAGG - Intergenic
1179913710 21:44463084-44463106 CCCTTTCCCAAGCAGAGGGATGG + Intergenic
1183063165 22:35347650-35347672 CCCATGCAGCAGAGCAGGGAAGG - Exonic
1184754222 22:46507385-46507407 CCCCTTCAGCAGCCGAGGCAGGG + Intronic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
949805719 3:7953267-7953289 CCCTTTCAGCAGAAAAGGGAAGG + Intergenic
950095325 3:10325793-10325815 CCCCCTCAACAGATGAGGGAAGG - Exonic
952171381 3:30810870-30810892 CCCTTGTAGCAGGAGGGGGAGGG - Intronic
952979450 3:38723140-38723162 CCCTTTCAACTCAAGAGGGCTGG + Intronic
954196213 3:48998687-48998709 GCCTTTCAGGACAAGAGGGAGGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
957586991 3:82145800-82145822 CTCTTTTAGCAGAAAAGGGATGG - Intergenic
957758478 3:84523173-84523195 CCATTTCAGCACAAGACGCAAGG + Intergenic
958575849 3:95949399-95949421 CCCTTCAAGCTGCAGAGGGAGGG - Intergenic
962955782 3:140265398-140265420 ACCTCTCAGCAGAGGAGAGAAGG + Intronic
964719694 3:159758872-159758894 CCCTAGCTGCAGCAGAGGGATGG - Intronic
965844463 3:172945981-172946003 CCCTTTCTGAAGCAGAAGGAAGG - Intronic
966989191 3:185211452-185211474 CCATTACAGCAGAAGAAGAAGGG - Intronic
968576430 4:1368436-1368458 TCCTTTCATCAGAAGAGGTGAGG + Intronic
969827794 4:9771827-9771849 CCCTTCAAGAAGAAGTGGGAAGG + Intronic
969899322 4:10334061-10334083 CCCTTTCAGCATGTGGGGGATGG + Intergenic
969902590 4:10363439-10363461 CCCCATCAGCAGAAGATGGTTGG + Intergenic
971248700 4:24953328-24953350 TCATTTCAGCTGGAGAGGGAGGG - Intronic
971727126 4:30328171-30328193 GCCTTACAGCAGCAGAGGCAGGG + Intergenic
972247561 4:37261283-37261305 CCCACTCAATAGAAGAGGGAAGG + Intronic
973063394 4:45758235-45758257 CCTTTTCACCAGAAGTGAGATGG - Intergenic
973716844 4:53685276-53685298 CCCTTGCTGGAGAAGAGGGAGGG - Intronic
974002738 4:56527614-56527636 TGCCTTCAGAAGAAGAGGGAAGG + Intergenic
974633892 4:64533455-64533477 CCCTTTCAGGGGAAGTGGGATGG - Intergenic
975326046 4:73059930-73059952 CCCTCACTGCAGAAGAGGCAAGG - Intronic
977504358 4:97882821-97882843 CCCTATCAGAAGAAAAGGTAAGG + Intronic
980588103 4:134846553-134846575 CCCTTTCTGAAGAAAAGGTAAGG + Intergenic
986042232 5:4004951-4004973 CTCTTGGAGCAGGAGAGGGATGG + Intergenic
986142077 5:5040392-5040414 CCATTTTAGAAGAAGAAGGAAGG + Intergenic
986516756 5:8572672-8572694 CCCCTTTAGGAGAAGAGGGCAGG + Intergenic
987945661 5:24605342-24605364 TCCAATCAGCAGTAGAGGGAGGG + Intronic
988088840 5:26508424-26508446 ACCTCTCAGCAGAAAGGGGATGG - Intergenic
988308778 5:29529763-29529785 CCAATTCAGCAGATGATGGAAGG + Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
988809378 5:34769302-34769324 TCTTTTCAGCAGAAAAGTGATGG - Intronic
989957300 5:50372526-50372548 CCCTTCGAGCAGTAGGGGGAGGG + Intergenic
990308521 5:54517282-54517304 CTCCTTGAGCAGAAGAGGGAAGG + Intergenic
992844312 5:80729895-80729917 CCCATTCTGCACAAGTGGGAGGG + Intronic
993900828 5:93583492-93583514 CCATTCCTGCAGAAGAGAGAGGG + Exonic
994766867 5:103929391-103929413 CCCTCTCTGAAGAAGAGGCAAGG + Intergenic
995995335 5:118291659-118291681 CCTTTCCAGCAGGAAAGGGAAGG - Intergenic
996700370 5:126444846-126444868 CCCTGTCAGGAGAGGTGGGAGGG - Intronic
996976518 5:129440826-129440848 CCCTTTCAGCAGAAGCAGAATGG + Intergenic
998059766 5:139110777-139110799 CCCTGTCTTCAGAAGAGGGAAGG + Intronic
998192900 5:140042337-140042359 CCCTTTCTCCAGCAAAGGGAGGG + Intronic
998690809 5:144585443-144585465 CAGTTTCAGCAGTAGAGTGAAGG + Intergenic
998855176 5:146387736-146387758 CCATTTGAGGAGAAGAAGGAAGG - Intergenic
1000292658 5:159885065-159885087 CCCTCTCATCAGAAGATGCAGGG + Intergenic
1000369482 5:160520913-160520935 CCCTTGCAGCAGAAGAGGGAAGG - Intergenic
1001100888 5:168813485-168813507 TCCTTTCAGCAGAAGCTGAAGGG + Intronic
1002539066 5:179894123-179894145 CCAGTTCAGCAGAAGAGGGCAGG + Intronic
1002894351 6:1367634-1367656 CACTTTCATCAGAAGTGGAAGGG - Intergenic
1003110380 6:3247991-3248013 CCGTTTCAGCAGGAGAGAGACGG + Intronic
1003555816 6:7139197-7139219 CCCTTTAAGCAAAGGTGGGAGGG + Intronic
1003805737 6:9724486-9724508 CCCTTCAAGCTGTAGAGGGAGGG + Intronic
1005562054 6:27050377-27050399 AGTTTTCAGCAGATGAGGGATGG - Intergenic
1006093047 6:31639472-31639494 ACCTTGAAGCAGAATAGGGATGG - Intronic
1008246356 6:49178739-49178761 CTCCTTCAGCAGAAGAAAGATGG - Intergenic
1009407760 6:63331037-63331059 CCCTTTAAGCTGTAGGGGGAGGG - Intergenic
1009470746 6:64026813-64026835 CCCTTCAAGCTGTAGAGGGAGGG + Intronic
1009715304 6:67385219-67385241 CCCTATCAGCAGCAGAGAGTGGG + Intergenic
1010564422 6:77391955-77391977 CCCTTTGAGCATAAACGGGAGGG - Intergenic
1012873286 6:104696517-104696539 CTCCTTCTGCAGAAGAGGAAAGG + Intergenic
1014054372 6:116996978-116997000 CCCTTTCAGCAGAGGGGGATGGG - Intergenic
1014638134 6:123874221-123874243 TGAATTCAGCAGAAGAGGGAAGG - Intronic
1015129783 6:129796213-129796235 CTCTTTCAGCAGAAGAGTGGGGG - Intergenic
1015885064 6:137909572-137909594 CCCTTTAAAGAAAAGAGGGAAGG + Intergenic
1016594950 6:145788642-145788664 TCCTTTCAGCAGAAGAGGGATGG - Intergenic
1017265927 6:152446243-152446265 TCCTGTCACCAAAAGAGGGAAGG + Intronic
1017444943 6:154499141-154499163 TCCTTTCTGCAGAATAGGGAGGG - Intronic
1019142033 6:169954438-169954460 CTCTTTTGGCAGAAGAGGGATGG - Intergenic
1019774434 7:2904027-2904049 CCATTTCATCAGAGAAGGGAAGG + Intergenic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1019956386 7:4418119-4418141 CGCTTTCAGGAGAAGAGGGAGGG - Intergenic
1020497646 7:8876286-8876308 CCCTTTCAGCAGAAGAGGACAGG + Intergenic
1021255340 7:18385540-18385562 TCCTGTCAACAGAAGAGGAAGGG - Intronic
1022301014 7:29102631-29102653 CCCTAGCAACAGAAGAGGGTCGG + Intronic
1024041454 7:45559215-45559237 CAGTTTCAGCAGGAGAGGGTTGG - Intergenic
1024163801 7:46709260-46709282 CCCTTTCAGCAGAAGACAGGTGG - Intronic
1024980273 7:55152504-55152526 CCCTGTGAGCTGAAGAGTGAGGG - Intronic
1026900408 7:74033823-74033845 CCCTTTCAGCAAAAGCAGTAAGG + Intronic
1030420458 7:109301391-109301413 CCCTTCAAGCTGTAGAGGGAGGG + Intergenic
1030586680 7:111429358-111429380 ATCTTTCAGCAGAAGAGGCAAGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036570552 8:9976554-9976576 TCTTTTCAGTGGAAGAGGGAGGG - Intergenic
1036805198 8:11826808-11826830 CCCTCTCAAAAGAAGAGGAAGGG + Intronic
1037908468 8:22729173-22729195 CTCTTCCAGGAGAGGAGGGAAGG + Intronic
1038290395 8:26244112-26244134 CCCTTTAATCAGAACAAGGAAGG - Intergenic
1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG + Intronic
1038395122 8:27241004-27241026 CCCTCTCAGCATAAAGGGGAGGG - Intronic
1038521516 8:28236245-28236267 CCCTTCCAGCAGGAGAAGGGAGG - Intergenic
1039776000 8:40737329-40737351 CGATTTAAGGAGAAGAGGGATGG + Intronic
1041043487 8:53869803-53869825 CCCTCTGAGCAGAACAGGGCAGG + Intronic
1041744176 8:61188845-61188867 CCCTTTAAGAAGAAAAGGAATGG + Intronic
1042328614 8:67554989-67555011 TGCTATCAGCAGAAGAGGGCTGG + Intronic
1042732669 8:71954593-71954615 CTCTTTCAGCACAAGAGAGAAGG - Intronic
1049769025 8:144370970-144370992 TCCTTACAGGAGAAGAGAGAGGG - Intergenic
1052168519 9:25364196-25364218 CCCTTTTAGCAGAAGAAAGATGG - Intergenic
1054805483 9:69392825-69392847 AGTTTTCAGCAGAAGAGTGATGG + Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1057793959 9:98142762-98142784 CCTTCTCAGCTGATGAGGGAAGG + Intronic
1057840892 9:98484947-98484969 CCCTTTCAGCATAAGAGAATGGG - Intronic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1059689642 9:116672669-116672691 CCCATTTTGCAGAGGAGGGAAGG + Intronic
1060150003 9:121282418-121282440 TCCTTTTGGCAGAAAAGGGATGG - Intronic
1060394325 9:123304907-123304929 CCCTAGCAGCAGCAGAGAGAAGG + Intergenic
1060549784 9:124479474-124479496 CCCATTCGACAGAAGACGGATGG - Intergenic
1062564820 9:137159503-137159525 CCCTGTCTGCAGAGCAGGGAAGG - Intronic
1185841548 X:3396506-3396528 CCATATCAGCACTAGAGGGATGG + Intergenic
1187959953 X:24558979-24559001 CCCTGACAGGTGAAGAGGGAAGG - Intronic
1189123885 X:38425231-38425253 CCCTGTCAGCAGCTGGGGGATGG - Intronic
1189315584 X:40053796-40053818 CGCTTTGAGCAGATGAGGGTGGG - Intronic
1190233978 X:48602045-48602067 TCCCTGCAGCAGCAGAGGGAGGG - Exonic
1191111222 X:56804273-56804295 CCCTTCTAGCAGAAGAAGGTCGG + Intergenic
1192319390 X:70077313-70077335 CCCTTTCAACTTAAGAGGGTGGG - Intergenic
1194140462 X:90202816-90202838 CTCTTTCAACAGAAATGGGATGG + Intergenic
1196117568 X:112014076-112014098 CTCATTCAGTAGAAGTGGGATGG + Intronic
1196754204 X:119143601-119143623 TCCTTTCTGGAGAAGAGGAAAGG - Intronic
1196768937 X:119273785-119273807 CCTTTGCAGCAGGAGAGGGGCGG - Intergenic
1196869361 X:120098293-120098315 TTCTTACAGCAGAAAAGGGATGG + Intergenic
1197513336 X:127397201-127397223 CCCTTCAAGCAGTAGGGGGAGGG + Intergenic
1198343875 X:135740924-135740946 CCCATACAGCCCAAGAGGGATGG - Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1200005962 X:153084424-153084446 ACCATTCCTCAGAAGAGGGAAGG + Intergenic
1200124335 X:153806175-153806197 CCCTTTCGGTAGAAGGGGGCAGG + Intronic
1200486207 Y:3771784-3771806 CTCTTTCAACAGAAATGGGATGG + Intergenic
1201908282 Y:19107069-19107091 CCCTTCAAGCTGTAGAGGGAGGG - Intergenic