ID: 1105753616

View in Genome Browser
Species Human (GRCh38)
Location 13:23444687-23444709
Sequence AAAAACAAGGAGAACTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 576}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105753610_1105753616 0 Left 1105753610 13:23444664-23444686 CCCCAATTGTTGAGGTGCTGCCT 0: 1
1: 0
2: 1
3: 11
4: 215
Right 1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG 0: 1
1: 0
2: 2
3: 46
4: 576
1105753608_1105753616 16 Left 1105753608 13:23444648-23444670 CCAATGGAGTAAAGGACCCCAAT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG 0: 1
1: 0
2: 2
3: 46
4: 576
1105753611_1105753616 -1 Left 1105753611 13:23444665-23444687 CCCAATTGTTGAGGTGCTGCCTA 0: 1
1: 0
2: 0
3: 9
4: 89
Right 1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG 0: 1
1: 0
2: 2
3: 46
4: 576
1105753612_1105753616 -2 Left 1105753612 13:23444666-23444688 CCAATTGTTGAGGTGCTGCCTAA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG 0: 1
1: 0
2: 2
3: 46
4: 576
1105753607_1105753616 17 Left 1105753607 13:23444647-23444669 CCCAATGGAGTAAAGGACCCCAA 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG 0: 1
1: 0
2: 2
3: 46
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105753616 Original CRISPR AAAAACAAGGAGAACTGGTG TGG Intergenic
901536485 1:9885651-9885673 AAAAAAAAAGAGGACAGGTGCGG + Intronic
901811624 1:11770123-11770145 AAAAAAAAGGGAAAATGGTGTGG + Intronic
902263045 1:15241357-15241379 AAAAACAAACAGAACTGGCCAGG + Intergenic
903265063 1:22153303-22153325 AAATTCATGGAGAACTGGGGTGG + Intergenic
905108547 1:35577955-35577977 GAAAGCAAGCAGGACTGGTGGGG + Intronic
905141736 1:35851423-35851445 AAAAGCAAAGTGAACTGGTCAGG - Intronic
905674173 1:39813862-39813884 AAAAAAAAAAAGAATTGGTGGGG - Intergenic
906351234 1:45061730-45061752 AAAAAAAAAAAAAACTGGTGAGG - Intronic
906619754 1:47266347-47266369 TAAAAAAAGGTGAACTGGTAAGG - Intronic
906990397 1:50731257-50731279 AAAATCAAGGGGAACTGGACAGG - Intronic
907343486 1:53754823-53754845 CAAACCAAAGAGAAATGGTGTGG + Intergenic
907355538 1:53870147-53870169 AAAAAAAAAGAGACCCGGTGCGG - Intronic
907357524 1:53888733-53888755 AAAAACAAAAACAGCTGGTGTGG + Intronic
907802293 1:57781723-57781745 AAAAAAAAGCAAAACTGTTGTGG + Intronic
908821836 1:68094866-68094888 AAAAACAAGCAAAACTGGCCAGG - Intergenic
909020538 1:70426229-70426251 AAAGAGAGGGAGAACTTGTGTGG - Intronic
909883115 1:80905164-80905186 AAAAAAATGGAGAAATCGTGAGG + Intergenic
910863479 1:91766024-91766046 CAAAAAAAGGAGAACTTGAGAGG - Intronic
910891257 1:92022783-92022805 AATAAGAAGGAAAACTGGGGTGG + Intergenic
911370008 1:96985438-96985460 AGAAACAATGGGTACTGGTGTGG - Intergenic
911571271 1:99520030-99520052 AAACACAAAGAGAAAAGGTGAGG + Intergenic
912567171 1:110596163-110596185 AAAAAAGAGTAGAACTGGAGAGG + Intronic
913577265 1:120189317-120189339 AAATACATGGAGAACTGGCTGGG + Intergenic
914256656 1:145965451-145965473 GAAAGCAAGGAGAACTGGAATGG + Intronic
914559178 1:148800744-148800766 AAATACATGGAGAACTGGCTGGG + Intergenic
914613655 1:149329479-149329501 AAATACATGGAGAACTGGCTGGG - Intergenic
915170577 1:153974400-153974422 AAAACAAGGGAGAAGTGGTGGGG + Exonic
915371480 1:155354953-155354975 TATAACAAGGAGAACTGGACTGG + Intronic
915375238 1:155388644-155388666 AAAAACAAAGAGAAAGGCTGGGG - Intronic
915459259 1:156060048-156060070 AAAAAAAAAGAGGCCTGGTGCGG - Intergenic
915908766 1:159899451-159899473 AAAAAAAAAAAGCACTGGTGAGG - Intronic
916254925 1:162777717-162777739 AAAAATAAGGATAACTGGCATGG + Intronic
916485312 1:165253648-165253670 AAGGGCAAGGAGGACTGGTGTGG - Intronic
916871701 1:168921713-168921735 AGAAAAATGGAGAAGTGGTGAGG - Intergenic
917161564 1:172062516-172062538 AAATAGCAGGAGAAGTGGTGAGG - Intronic
917431021 1:174969207-174969229 AGAAACGAACAGAACTGGTGAGG - Intronic
917493847 1:175522108-175522130 AAAAAAAAGGAGAAGTGGAGTGG - Intronic
917496820 1:175548028-175548050 AAAGGCAAAGAGACCTGGTGGGG + Intronic
917633988 1:176917533-176917555 AAAAACCAGGAGAACTCCAGAGG - Intronic
917667823 1:177242388-177242410 AAAAACAGGAAGAAATGGTGGGG - Intronic
917951864 1:180046722-180046744 AAAAACAACAAGCATTGGTGAGG - Intronic
918287964 1:183077157-183077179 AAAAAAAAGGAGAAATGCAGGGG - Intronic
918939684 1:190976005-190976027 AAAAAAAAGGAGAAGTGAAGAGG + Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919347375 1:196401642-196401664 AAAAACAAAGAGAAAAGGTAAGG + Intronic
919546803 1:198932906-198932928 GAAAACAAGGGAAACTGGTTTGG - Intergenic
919748386 1:201022444-201022466 AAAAACTGGGAGAAGTGGTGAGG + Intronic
920133581 1:203752044-203752066 AAAAATAAGGAGGCTTGGTGTGG - Intergenic
920760975 1:208783446-208783468 GAAAACAAGGAGGCCGGGTGTGG - Intergenic
920824655 1:209413999-209414021 AAAGAGAAGGAAAACGGGTGGGG + Intergenic
921488147 1:215740532-215740554 AAACAGAAGGAAAACTGGAGAGG + Intronic
921852675 1:219947660-219947682 AAAAACAATGAGGCCAGGTGTGG + Intronic
921971841 1:221158160-221158182 AAAAGCAAGGAGCACTTGTGGGG - Intergenic
922598813 1:226834436-226834458 AGAGACATGGAGAAGTGGTGGGG - Intergenic
922778450 1:228229236-228229258 AAAAACAAGAAGAGTTGGTGAGG - Intronic
923181718 1:231526636-231526658 TAAAACAAGGAGACCAGGTAGGG + Intergenic
923289420 1:232530108-232530130 AAAAAAAAGAATAAATGGTGAGG - Intronic
923485204 1:234423221-234423243 AAAAATAATGAGCATTGGTGAGG - Intronic
923533998 1:234834469-234834491 AAAAAAAAAGAGACCTGGTTTGG - Intergenic
923592959 1:235336391-235336413 AAAAAAAAGAAGAACTTGTCTGG + Intronic
923826483 1:237506148-237506170 AAAAAAAAGGAGTGTTGGTGGGG - Intronic
924281416 1:242440901-242440923 AAATACAAAGAGAACTGGATTGG + Intronic
924318506 1:242823608-242823630 AAAAAAAAAGAGGCCTGGTGTGG + Intergenic
924344912 1:243064681-243064703 AAAAAAAAAAATAACTGGTGTGG - Intergenic
1062954022 10:1528597-1528619 AAAACCATGGAGAACTTGAGAGG - Intronic
1063149471 10:3323194-3323216 AAAAAAAAGGAGGCCAGGTGCGG + Intergenic
1063448557 10:6135744-6135766 AAATACATAGACAACTGGTGAGG - Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1063737448 10:8776065-8776087 AAAAAAAATAAGATCTGGTGAGG + Intergenic
1064012667 10:11747230-11747252 ACAAGAAAGGAGAACTGCTGGGG - Intronic
1065587431 10:27233432-27233454 AAAAAAAAAAAAAACTGGTGTGG + Intronic
1066325720 10:34355631-34355653 AAAAACAAACAGACCTGGTGGGG + Intronic
1067222906 10:44356861-44356883 AAATACAAAGAGGACTGCTGGGG - Intergenic
1069111199 10:64449057-64449079 AAAAAAAAGGAAAACTTTTGTGG - Intergenic
1069334232 10:67328828-67328850 AAAAAGAAAAAGAATTGGTGGGG - Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1070331931 10:75423619-75423641 ATAAACAAGGAGGTCAGGTGTGG - Intergenic
1071016425 10:81002284-81002306 ACAAACAAAGAAAACTAGTGGGG - Intergenic
1071678341 10:87678774-87678796 AAAAAAAAGTAATACTGGTGAGG + Intronic
1071707225 10:88012250-88012272 AAAGACAATCAGAAGTGGTGGGG + Intergenic
1072022150 10:91412799-91412821 GAAATCCAGGAGAACTGGGGTGG + Intronic
1072443274 10:95476307-95476329 TAAAACAATGTGAACAGGTGTGG + Intronic
1072881569 10:99233994-99234016 AAAAAGAAAGAAAGCTGGTGGGG + Intronic
1072983745 10:100121764-100121786 AAAAAAAAGGAGAATTTGTCAGG + Intergenic
1073560064 10:104488881-104488903 AAAAAAAAGGAGCACTGGACTGG - Intergenic
1075574801 10:123570617-123570639 AAAACCAGGGAGAGCAGGTGAGG + Intergenic
1076223079 10:128750502-128750524 TAAAAAAAGGTGAACTTGTGTGG - Intergenic
1077116276 11:886162-886184 AAAAAAAAGGAAAAATGGCGGGG + Intronic
1077840621 11:5970979-5971001 AGAAACAAAGGGAACTGATGTGG + Intergenic
1078476799 11:11637098-11637120 AGAAAAAAGGAGAAATGCTGAGG + Intergenic
1078518542 11:12045418-12045440 AAAAATAAGAAGGACAGGTGTGG + Intergenic
1078912968 11:15750397-15750419 AAAAACAAAGACCAATGGTGTGG + Intergenic
1079553444 11:21730028-21730050 AAAATCAAGGCCAAATGGTGCGG + Intergenic
1079652251 11:22943708-22943730 AAAGAGAAAGAGAACTTGTGCGG + Intergenic
1079727886 11:23898958-23898980 AAAAACAAGGAAAGCTGGCAGGG + Intergenic
1080527763 11:33144117-33144139 AAAAAAAAGGGGGAGTGGTGGGG - Intronic
1082952055 11:58827860-58827882 AAAAAGAAGGAGGCCGGGTGCGG - Intergenic
1083221444 11:61255470-61255492 AAAAAAAAGGAGTCCGGGTGTGG - Intergenic
1083247635 11:61441872-61441894 AAAAAAAGGGAGGAGTGGTGGGG - Intronic
1083569650 11:63751625-63751647 AAATACAAGGAGCACAGGTGTGG - Intronic
1083989125 11:66235968-66235990 GAAGACCAGGAGAACGGGTGGGG - Intronic
1084327547 11:68410527-68410549 CAAAGCAAGGAGACCTGGTCAGG - Intronic
1085132491 11:74053287-74053309 AAAAACAAGAAAAACTGATACGG + Intronic
1085667566 11:78428499-78428521 AAACATTAGGAGAAGTGGTGGGG + Intergenic
1085810146 11:79672585-79672607 GAAAGGAAGGAGAATTGGTGAGG + Intergenic
1086129902 11:83390297-83390319 AAAGACAAGGAGGACTGGCTTGG + Intergenic
1086515707 11:87610654-87610676 AAAAGCAAGGAGTGCTGGTGAGG + Intergenic
1086762498 11:90650266-90650288 AAAAACAACAGAAACTGGTGAGG + Intergenic
1087848799 11:103004454-103004476 AAAAATAACGAGTGCTGGTGAGG + Intergenic
1088047599 11:105472714-105472736 AAAAAGAAAGAAAAGTGGTGGGG + Intergenic
1088310452 11:108454748-108454770 AAAAACAAGAAAATCAGGTGTGG - Intronic
1088572344 11:111234649-111234671 AGAAACAAAGAGAACTGATGAGG + Intergenic
1088897880 11:114091763-114091785 AAAAACAAGGGGAAGGGGAGTGG - Intronic
1089414565 11:118276617-118276639 GAAAACAAGAATTACTGGTGGGG - Intergenic
1089769533 11:120793414-120793436 AAGAAGAAGGAGGCCTGGTGAGG + Intronic
1090160117 11:124483727-124483749 AAAAGCCAGGGGAACTGGTACGG - Intergenic
1090820077 11:130334133-130334155 AACAACAATGAACACTGGTGAGG - Intergenic
1091572787 12:1704007-1704029 AAAAAAAAAAAAAACTGGTGGGG - Intronic
1092063450 12:5569428-5569450 AAAATGAAGGAGGACTGGAGGGG - Intronic
1092066345 12:5592714-5592736 AATTCCAAGGAGAAATGGTGAGG + Intronic
1092086243 12:5764703-5764725 AAAAAGCAGGAGAACAGGGGAGG - Intronic
1092201452 12:6586432-6586454 ATACACAAGGAGGCCTGGTGTGG + Intronic
1092242869 12:6846145-6846167 AGAATCAAGGAGATCTGGAGTGG + Intronic
1093412546 12:18884066-18884088 AGAAACAATGAGAAGTGGTAGGG - Intergenic
1094173905 12:27522811-27522833 AAAAACAATGAGGCCTGGTGTGG + Intergenic
1094612287 12:32006115-32006137 AAAAAGAAGGAGAACACTTGAGG - Intergenic
1095341918 12:41100176-41100198 AAGAAAGAGGAGAACTGGTTTGG + Intergenic
1095682040 12:44988639-44988661 AAAAGCAAGTAAAAATGGTGTGG - Intergenic
1095766855 12:45905285-45905307 AAAAAAAAAAAGAACTGCTGTGG + Exonic
1095790892 12:46165806-46165828 CAAAATAAGGGGTACTGGTGGGG + Intergenic
1096146891 12:49284601-49284623 AAAAACAAAAAGAACTACTGGGG + Intergenic
1096366563 12:51033261-51033283 AAAAAGAAGGAGGAGGGGTGGGG - Intergenic
1096380248 12:51150988-51151010 GAAAGCAAGGAGTGCTGGTGAGG + Intronic
1096840496 12:54376849-54376871 AAAAGGGAGGAGAACTGTTGAGG - Intronic
1097126098 12:56776594-56776616 AAAGACATGGAGAACAGGTGTGG - Intronic
1099324549 12:81197801-81197823 AAATACAAGGAAAAATAGTGAGG - Intronic
1099484161 12:83207661-83207683 TAAAAAAAGGAAAATTGGTGAGG + Intergenic
1100029929 12:90174182-90174204 ATATCCAAGGAGAACCGGTGTGG + Intergenic
1100526661 12:95425952-95425974 CAAAACAAGAAGTATTGGTGAGG - Intergenic
1101013723 12:100477516-100477538 AAAGAAAAGGAGAAATGGTATGG + Intronic
1101493297 12:105230068-105230090 AAAAACAAGCAGGCCAGGTGCGG - Intronic
1101550349 12:105755528-105755550 AAAAATAGGGAGAATTGGTGTGG + Intergenic
1102286806 12:111664333-111664355 AAAAAAAAGTAAAACTGGAGTGG + Intronic
1102757441 12:115354424-115354446 AAAAACCAGGGGAACTGGGTGGG - Intergenic
1102757946 12:115358554-115358576 ATAAACAAGCAGATCTTGTGAGG - Intergenic
1102913482 12:116736754-116736776 AACAGCAAGGAGCACGGGTGGGG - Intronic
1103260187 12:119580722-119580744 AAAAACATGCAGTAGTGGTGTGG + Intergenic
1103389766 12:120563589-120563611 AGTAACAAGGAGAGCTGCTGAGG - Exonic
1103984426 12:124757997-124758019 AAAAACAAGGATAAATGCCGTGG + Intergenic
1103988626 12:124783809-124783831 AAAAACAAAAAAAACTGGTAAGG + Intronic
1104171255 12:126283571-126283593 AAAAACAATGAGAAATGTAGAGG - Intergenic
1104849486 12:131864777-131864799 AAAAACAAGCAGGCCGGGTGCGG + Intergenic
1105499321 13:20957720-20957742 AAAAAAAAAGAGAACGAGTGTGG + Intergenic
1105636560 13:22221053-22221075 AATTAAAAGGAGAACTGGTAGGG + Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1105839090 13:24238113-24238135 AAAGTCAAGAAGAACTGGTTTGG - Intronic
1106046554 13:26147303-26147325 AAAAACAAAGAGAGGTGATGGGG + Intronic
1106279074 13:28247069-28247091 AAAAATAATGAATACTGGTGAGG - Intronic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1106369455 13:29117465-29117487 AAAACCAAGGAGAGTGGGTGGGG - Intronic
1106508199 13:30390180-30390202 AAAAGCAAGGAGTCCAGGTGTGG + Intergenic
1106920617 13:34559351-34559373 AAAAACAAAGAGAACTAGCATGG - Intergenic
1107348138 13:39485201-39485223 AAAGACAAGGAGAAATGTTTTGG + Intronic
1107454843 13:40545660-40545682 AAAAAGAAGAAGAACTCATGGGG + Intergenic
1107519566 13:41166238-41166260 TAACAAAAGGAGAACTGGGGTGG - Intergenic
1107714657 13:43188240-43188262 AAAAACAAGGTGAGCTACTGTGG - Intergenic
1109074143 13:57811829-57811851 AAAAACAAATATAACTAGTGAGG + Intergenic
1109366065 13:61357520-61357542 TAAAACAAGGAAAATTGCTGAGG - Intergenic
1110107490 13:71696053-71696075 AAAAACAATGAGATCTAGGGAGG + Intronic
1110335302 13:74323289-74323311 AAAAAGAAGGAGAGAGGGTGGGG - Intergenic
1111525450 13:89462352-89462374 AAAAACCTGGAGAACATGTGAGG - Intergenic
1112711251 13:102131356-102131378 ATAAACAATGAGAGCTGCTGTGG - Intronic
1114165647 14:20216055-20216077 AAAAACAGGGAGCACTTGGGTGG - Intergenic
1115459072 14:33638981-33639003 AAAACCAAGGTTAAATGGTGCGG - Intronic
1115959434 14:38819220-38819242 AACAACAAGGAGAACTGACATGG - Intergenic
1116040892 14:39685367-39685389 GAAAGCATGGAGAACTGATGGGG - Intergenic
1118461627 14:65992736-65992758 AAAAGCAGGGAGAACTAGTGTGG + Intronic
1118499199 14:66342251-66342273 AGAAGCAATCAGAACTGGTGAGG + Intergenic
1119343183 14:73898246-73898268 AAAAACCAGCAGCAATGGTGAGG + Exonic
1119595812 14:75932599-75932621 ATACACAAGGTGAACTGCTGTGG + Intronic
1119870127 14:78009841-78009863 AAAGAGAAGGAGAAATGGAGAGG - Intergenic
1120483323 14:85080246-85080268 AAAAACCAGGAGGTCAGGTGTGG - Intergenic
1120574105 14:86159317-86159339 AAAAAGAAGGAGATCTGGGAAGG - Intergenic
1120789570 14:88566930-88566952 AAAAAAAAAGAGAACTGGAATGG + Intronic
1120886255 14:89454011-89454033 AAGAAGAAGAAGGACTGGTGTGG + Intronic
1121170140 14:91846965-91846987 AAAAACAAGGAGGCCAGGCGCGG + Intronic
1122737644 14:103852606-103852628 AAAAACAAGGAAAGCTGGCGAGG - Intergenic
1124924608 15:34059185-34059207 AAAAATAAGGAGGCCAGGTGTGG - Intronic
1125438359 15:39672933-39672955 AAAAACCAGAAGAAATGGTCAGG + Intronic
1125457047 15:39870567-39870589 AACAAAATGGAGAATTGGTGTGG + Intronic
1125669027 15:41456493-41456515 AAAAAAAAAAAGAACTGCTGGGG + Intronic
1125786259 15:42320960-42320982 AAAAACAAAGAGAATGGGAGTGG - Intronic
1126926513 15:53593773-53593795 AAAAAGAAAGATAGCTGGTGTGG + Intronic
1127622479 15:60747249-60747271 AGAAACAAGGCAAGCTGGTGAGG + Intronic
1127988133 15:64090993-64091015 AACAATAAAGAGAAATGGTGAGG + Intronic
1128010267 15:64287919-64287941 AAGGACAAAGAGAACAGGTGAGG + Intronic
1128066010 15:64764929-64764951 AAAAAAAAGAAGAACTGGCCAGG + Intronic
1128410216 15:67389393-67389415 AAAAACACGGAGTACCTGTGTGG - Intronic
1128651521 15:69418287-69418309 AGATACAAGGAGAGCTGGAGGGG - Intronic
1129689890 15:77707198-77707220 AGAAAGAGGGAGAAATGGTGGGG + Intronic
1129783749 15:78293579-78293601 AAAAACAAGTAAAACCAGTGGGG + Intronic
1129825535 15:78632599-78632621 AAAAATAAGGAGACTGGGTGAGG - Intronic
1131730183 15:95271199-95271221 AAAAACAAAGCGACCTGGAGGGG - Intergenic
1131781637 15:95866037-95866059 AAAGACAAGGAGAATTGCTGGGG - Intergenic
1132023194 15:98382503-98382525 AAGGACAAGGAGATCTGATGAGG + Intergenic
1132077784 15:98837226-98837248 ACAAACAAACAAAACTGGTGGGG - Intronic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1134101304 16:11453675-11453697 AGAAACAAGGAGGCCAGGTGCGG + Intronic
1134101728 16:11457188-11457210 AAAAACAAGGAGCGTTGGTAAGG + Intronic
1134361410 16:13534211-13534233 AAAAAAAAAGTGAAATGGTGTGG - Intergenic
1134598202 16:15512586-15512608 AGAAAAAAGAAGACCTGGTGTGG + Intronic
1135264081 16:21007062-21007084 AAAAACAACAAGTATTGGTGAGG - Intronic
1135664371 16:24323765-24323787 AAAAAGAAGGACATCTGGTAAGG - Intronic
1135706608 16:24680427-24680449 AAAAAAAAGGAGGCCCGGTGCGG + Intergenic
1135968618 16:27055821-27055843 GAAAAAAAGGACAGCTGGTGAGG - Intergenic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1136534295 16:30890402-30890424 AAAAAAAAGCAGAGCTGATGAGG + Intronic
1137523600 16:49214223-49214245 AACAGCAATGAAAACTGGTGTGG + Intergenic
1139218923 16:65158805-65158827 AACAATAAGGATAAATGGTGAGG + Intergenic
1139427925 16:66894663-66894685 AAAAGCAAGGAAAGTTGGTGAGG + Intronic
1140064718 16:71601210-71601232 CCAAACAAAGAGAACTGTTGTGG - Intergenic
1140790431 16:78386036-78386058 AGAAACCAGGAGAACTGGAGAGG - Intronic
1141614840 16:85204568-85204590 AATAACAAGAAGTGCTGGTGAGG - Intergenic
1141635006 16:85309946-85309968 ATAAAAAAGGAGAAGTGGCGGGG + Intergenic
1141696660 16:85623495-85623517 AAAACCAAGGGGAACGGGGGTGG - Intronic
1141948182 16:87324426-87324448 AACAACCAGGAGTGCTGGTGTGG - Intronic
1142702216 17:1669954-1669976 AGAAACATGGAGAACAGGTCTGG - Intronic
1142818416 17:2446738-2446760 AAAAAAAACGAGAACCAGTGAGG - Intronic
1143850040 17:9804096-9804118 AAGGACAAGGAGAATTGGAGAGG + Intronic
1143863813 17:9909636-9909658 AAAGACAAGGAGACCTGGGAGGG - Intergenic
1144016750 17:11203506-11203528 TAAAACAAGGTGATGTGGTGGGG + Intergenic
1144766727 17:17737302-17737324 CAAAACAAGGACCACAGGTGGGG - Intronic
1144768269 17:17744806-17744828 AAAAAAAAGGAAAACTGTAGAGG + Intronic
1144957759 17:19027870-19027892 AAAAAAAGGGAGAAGTGGTTTGG - Intronic
1144977398 17:19146650-19146672 AAAAAAAGGGAGAAGTGGTTTGG + Intronic
1145861814 17:28217471-28217493 AAAAAAAAGGAGTCCAGGTGCGG - Intergenic
1146408250 17:32558598-32558620 AAAACCAGGGAGAACTGTGGAGG - Intronic
1146492080 17:33290840-33290862 AGAATCTAGGAGAACTTGTGAGG - Intronic
1146960750 17:36974858-36974880 AAAAAAAAGGAGAATTAGAGTGG - Intronic
1147727596 17:42576238-42576260 AAAAATAATGAGGATTGGTGAGG + Intronic
1148080393 17:44964792-44964814 GAAAACCAGGAGAAATAGTGGGG - Intronic
1148476778 17:47933853-47933875 AAAAAAAAGAAGAATGGGTGTGG - Intergenic
1148544853 17:48509947-48509969 AAAAACAAGGCGAGGTGCTGTGG + Intergenic
1149118541 17:53131477-53131499 AAAAATAACAAGTACTGGTGAGG + Intergenic
1149134871 17:53352470-53352492 AAAAAAAAAAAGAACTGGGGAGG + Intergenic
1149496795 17:57123580-57123602 TAAAACAAGGAAAACTGGCCAGG + Intergenic
1149528975 17:57379877-57379899 AAAAACAAAGAGAAGTTGGGAGG - Intronic
1150539119 17:66077895-66077917 AAAAACAAAGATAAATGGTTGGG - Intronic
1150590505 17:66558353-66558375 AAAAACAAGGAGTACTGGTAAGG + Intronic
1151666446 17:75547831-75547853 AAAAAAAATGAGGACTGGGGTGG + Intronic
1151976880 17:77488305-77488327 ATCAACAACGAGAACTGGTGAGG + Exonic
1152326926 17:79647012-79647034 AAAATCAAGGAGGAGAGGTGGGG - Intergenic
1152779786 17:82221746-82221768 AAAAACAAACAGGGCTGGTGTGG + Intergenic
1152886261 17:82852302-82852324 AAAGAAAAGGAGCACTGCTGGGG - Intronic
1153007999 18:514313-514335 GAAAATAAGGGGAACCGGTGAGG - Intergenic
1153646596 18:7201623-7201645 AAAAAAAAGGAGCGTTGGTGTGG - Intergenic
1153703580 18:7721916-7721938 AGAACAAAGGAAAACTGGTGGGG - Intronic
1153861142 18:9208711-9208733 AAAAAGAATGCTAACTGGTGTGG - Exonic
1154081822 18:11264821-11264843 AAAAATAAGGATAATTGTTGCGG - Intergenic
1154348554 18:13564511-13564533 AAAACCAAGGAGAGCAGGTGAGG - Intronic
1155147881 18:23098894-23098916 AAAAAAAGGGAGAACAGTTGTGG + Intergenic
1155705403 18:28804522-28804544 AAAAGTATGGAGAACTGGGGAGG - Intergenic
1155913632 18:31534352-31534374 CAAAGCAAGGAGAATTAGTGTGG - Intronic
1156816551 18:41318155-41318177 AAAAGCAAAGAGAAAGGGTGTGG - Intergenic
1157734884 18:50038520-50038542 AATAACAAGCAGAACATGTGAGG - Intronic
1157775342 18:50390609-50390631 AAGACAAAGGAGAACTGATGGGG - Intronic
1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG + Intronic
1158558117 18:58491788-58491810 ACAGGCAAGGAGAACTTGTGGGG + Intronic
1158956490 18:62545093-62545115 AAAAAAATGGAGACCGGGTGCGG + Intronic
1159269248 18:66127832-66127854 ACCAACAAGGACAAATGGTGTGG - Intergenic
1159632577 18:70765915-70765937 AAATACAATGAGAAATGATGAGG - Intergenic
1159700011 18:71615072-71615094 AAAAATAACGAGTACTGTTGAGG + Intergenic
1159711604 18:71766377-71766399 AAAAACAACAAGACCTGCTGAGG + Intronic
1160011751 18:75111311-75111333 AAAAACAGGAAGAGCTGCTGGGG - Intergenic
1160238441 18:77104381-77104403 CAAAGGAAGGAGAACTGGTGAGG + Intronic
1162539749 19:11287619-11287641 AAAAAAAAGGAGGCCAGGTGTGG - Intergenic
1162721044 19:12663221-12663243 AAAAATAAGGAGAACGTGTTAGG + Intronic
1163162219 19:15471555-15471577 ACAGACAAGGAGGCCTGGTGCGG - Intronic
1163269093 19:16239226-16239248 AAAAAAAAAGAGAACTGGCCGGG - Intronic
1163286780 19:16353596-16353618 AGTTACAAGGAGAACTGGTCAGG - Intergenic
1163948626 19:20563873-20563895 AAAAATAAGTAGGCCTGGTGCGG + Intronic
1164080028 19:21854242-21854264 TAAAAAAAGGAGACCAGGTGCGG - Intergenic
1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG + Intronic
1165988934 19:39794864-39794886 AAAAAAAAAGAGAGCAGGTGGGG - Intergenic
1166142873 19:40814543-40814565 AAAAACAAAGAGAAGTAGCGAGG - Intronic
1167069923 19:47215380-47215402 AAAAAAAAGGAGGCCGGGTGTGG + Intergenic
1167456472 19:49598948-49598970 AAAAGCAAGCAGACCGGGTGAGG - Intronic
1168475658 19:56673393-56673415 AGAAACAAGCAGACCTGGTGTGG + Intergenic
925123965 2:1440583-1440605 ACAAACAAGAAGTACAGGTGTGG - Intronic
925513589 2:4654193-4654215 AAAAACAGGAAGGACTGGTCAGG + Intergenic
926167675 2:10531558-10531580 AAAAAGAAGGCGGCCTGGTGCGG + Intergenic
926332812 2:11838911-11838933 AAATACAAGAAGAGCTGGTATGG - Intergenic
926525589 2:13975787-13975809 AAATACAAGGAGAACAAGAGAGG + Intergenic
927231706 2:20830412-20830434 AAAAAAAAGGAGAGGTGGGGTGG - Intergenic
927299099 2:21490237-21490259 AAAAAGAAGGAATACAGGTGTGG - Intergenic
927356151 2:22175837-22175859 AAAGAAAAGGAGATGTGGTGAGG - Intergenic
927394309 2:22631659-22631681 TGAGAAAAGGAGAACTGGTGGGG - Intergenic
928665841 2:33549943-33549965 AAAAACAGGGAAGGCTGGTGAGG + Intronic
930662042 2:54064137-54064159 AAAAAAAAAGAGGCCTGGTGTGG - Intronic
931263773 2:60642403-60642425 AAATAAAAGGAAAACTGGTTGGG - Intergenic
931784491 2:65607209-65607231 AAAAAAAAAAAGAGCTGGTGGGG + Intergenic
931954774 2:67409959-67409981 AAAGACAAGAAGCACTGGTTCGG + Exonic
932153515 2:69394341-69394363 AAGAACAAGGAGGAAAGGTGTGG - Intergenic
932797439 2:74709006-74709028 AAACACAAAAAGAGCTGGTGTGG + Intergenic
933223628 2:79719545-79719567 AAAAACAACAGAAACTGGTGAGG - Intronic
933634901 2:84698210-84698232 AAAAACAAGGAAAAAAGCTGGGG - Intronic
934681764 2:96288916-96288938 AAAAACTAGGAGAACTGAGCAGG + Intronic
936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG + Intronic
936323341 2:111484934-111484956 AAAAAAAAGAAGAAGTGGTGAGG + Intergenic
937142043 2:119610369-119610391 AACAAAGAGGAGAAATGGTGGGG + Intronic
937910435 2:127073083-127073105 AAACACAAGGAGCCCTGGTACGG - Intronic
937970815 2:127547302-127547324 AAAAACAGGGATAAATGCTGAGG + Intronic
938612496 2:132962572-132962594 AAAAACAAAAAGACCTGGAGGGG - Intronic
939640029 2:144629111-144629133 ATAAACAAGGAGAAGTTGTTCGG - Intergenic
940613285 2:156018159-156018181 GAAAACAAGGAGAAGTTGTTTGG - Intergenic
941183759 2:162294553-162294575 TAAAACAAGGGGAACTTGTTAGG - Intronic
941968105 2:171320555-171320577 AGACACAAGGAGATCTGCTGGGG + Exonic
942021415 2:171869954-171869976 AAAAAAAAGCAGGACTGTTGAGG - Intronic
942544817 2:177052682-177052704 ATAAACAAAGAGAAATGGTCAGG - Intergenic
942553268 2:177143851-177143873 AAAAAAAAGGAAGACTGGAGAGG + Intergenic
942562481 2:177235279-177235301 AACAACAACAACAACTGGTGTGG + Intronic
943224659 2:185155390-185155412 AAAAACAACGTGTACTGGAGAGG + Intergenic
944143263 2:196479704-196479726 AGAAATAAGGAGATCTGGAGAGG - Intronic
944255556 2:197619929-197619951 AAAAACAAGGTAAAATAGTGTGG + Intronic
944534663 2:200697072-200697094 CAAAACCAGGAGTACTGATGAGG + Intergenic
944833297 2:203554498-203554520 AAAAACAAGGAACACTTGTTTGG + Intergenic
945651054 2:212559787-212559809 AATAACAATTAGATCTGGTGCGG + Intergenic
946165391 2:217860388-217860410 AAAAATAAGGAGACCAGGGGAGG + Intronic
946177197 2:217929076-217929098 AACAACAAGGGGAACTCGGGGGG + Intronic
946194266 2:218023784-218023806 CAAAACAAGGAGGGCTGGTGGGG - Intergenic
946231547 2:218294488-218294510 AAAAAAAAGGAAGGCTGGTGGGG - Intronic
946884428 2:224208973-224208995 TAAAACAAGGAAAACAGCTGTGG - Intergenic
947044254 2:225961446-225961468 ACAAAGAGGGAGAAGTGGTGGGG + Intergenic
947135298 2:226971442-226971464 CAAAACAATGAGAAATGGGGAGG - Intronic
947304389 2:228727658-228727680 AAAAAAAAGGAGCACTGGCTGGG + Intergenic
947503023 2:230685152-230685174 AAAAGCAAGAAGATCTGATGAGG + Intergenic
947643300 2:231719484-231719506 AAAAAAAAAAAGAACTGCTGAGG + Intergenic
947718713 2:232354651-232354673 AAAAACAAACAAAGCTGGTGGGG + Intergenic
947874796 2:233461028-233461050 AAAAAAAAAGACAACTGCTGGGG + Intronic
948362760 2:237434397-237434419 AAAGACAGTGAGATCTGGTGAGG - Intergenic
1168731746 20:88970-88992 AAAAACAAAAAGGACTGATGAGG - Intronic
1168944590 20:1742055-1742077 AAAAAAAAAGAGAGCGGGTGGGG + Intergenic
1170045400 20:12080123-12080145 AGAAATAAGGAGAAAAGGTGGGG - Intergenic
1170228651 20:14020808-14020830 AAAAACTGGGAGAACTCCTGAGG - Intronic
1170418898 20:16172946-16172968 AAATACAAGGAGATCAGGAGAGG + Intergenic
1170473445 20:16690947-16690969 AAAAAAAAGAAGCACTGGTATGG + Intergenic
1170506347 20:17029752-17029774 AAAAAGAAGGAGATCTGGGGAGG + Intergenic
1170950104 20:20928761-20928783 AAAAACAAGCAAAACTGGCCAGG - Intergenic
1170988620 20:21281733-21281755 AAAAAAAAGGAGGAATGGTCAGG - Intergenic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1171472650 20:25384309-25384331 AAAAACAAAAAAAACTGGTTTGG + Intronic
1171943726 20:31356025-31356047 AAAAAGAAAGAAAACTGGAGTGG + Intergenic
1172399781 20:34639998-34640020 AAAAACAAGGCCACCTGGAGTGG + Intronic
1172482430 20:35278704-35278726 AGAAAAAAGGAGAACTGTAGTGG + Intergenic
1174527118 20:51181557-51181579 AACAGCAAGGACAACAGGTGTGG + Intergenic
1174702358 20:52621694-52621716 AATAACAAGAAGAAGTGGTTTGG - Intergenic
1174817216 20:53697304-53697326 AAAAAAAAGGAGGCCGGGTGCGG + Intergenic
1176202432 20:63867931-63867953 AAAAAAAAGAAAAACTGGTCGGG - Intronic
1177239721 21:18441314-18441336 AAAAACAAAGAGACCGGGCGTGG + Intronic
1177648018 21:23924209-23924231 GAAAACTAGAAGATCTGGTGTGG + Intergenic
1178124188 21:29499571-29499593 AAAAACAGGAAACACTGGTGTGG + Intronic
1178318368 21:31585945-31585967 AAAAAAAAGGAGAGGTGGGGAGG + Intergenic
1179391835 21:41000457-41000479 AAAAATAAGGATAATTGGCGGGG - Intergenic
1180077039 21:45468215-45468237 AAAAAGAAAGACAGCTGGTGAGG - Intronic
1180179892 21:46113330-46113352 AAGAGCAAGGGGCACTGGTGAGG - Intronic
1180959112 22:19754735-19754757 AACACCAAGGAGAACACGTGGGG + Intergenic
1181185873 22:21103269-21103291 AAAACCAGGGAGAACAGGAGAGG - Intergenic
1181694046 22:24584197-24584219 TAAAACAAGGAGAGCTGGGAGGG + Intronic
1183862938 22:40682564-40682586 GAAAACAAGGAGACCTGGGGTGG + Exonic
1183887976 22:40900961-40900983 AAAAACAAAGGGAATGGGTGTGG + Intronic
1183964604 22:41434310-41434332 AGAAACAAGCCGACCTGGTGTGG + Exonic
949281393 3:2352098-2352120 AAAAACAAACAGGTCTGGTGCGG + Intronic
949494621 3:4619872-4619894 AAAAACAAAGAGAAATGGAAGGG - Intronic
950014122 3:9744188-9744210 AGAAAGAAGGAGAGTTGGTGAGG - Intronic
950036155 3:9887376-9887398 AAAAACGATGAGAACTAATGTGG + Intergenic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951297890 3:20961555-20961577 AGAAAAAAGGAGATCTGGTGGGG + Intergenic
951563148 3:23987973-23987995 AAAAACAAAAAGAACTGGCCGGG - Intergenic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
952039306 3:29242137-29242159 AAAGGCTAGGAAAACTGGTGTGG + Intergenic
952415744 3:33090271-33090293 AAAAATAAAGAGTACAGGTGGGG + Intronic
952614539 3:35254085-35254107 AGAAACAAGAGGTACTGGTGAGG + Intergenic
952624552 3:35388640-35388662 AATAAAAAGGAAAAATGGTGGGG + Intergenic
952793851 3:37221752-37221774 AATGTCAAAGAGAACTGGTGGGG + Intergenic
953230407 3:41059594-41059616 AAAAACAATGAATACTGGCGAGG - Intergenic
953300115 3:41765562-41765584 TAAAAAAAGGAAAACTGTTGTGG + Intronic
954204013 3:49044161-49044183 AGGAACAAGCAGAACTAGTGGGG - Intronic
954838146 3:53489387-53489409 AAAAAAAATCAGAACTGCTGGGG + Intergenic
956829707 3:73034049-73034071 AAAAATAACAAGCACTGGTGAGG - Intronic
956985355 3:74692953-74692975 AAACACAAAGAGATATGGTGGGG + Intergenic
957030990 3:75241351-75241373 AAAACACAGGAGAACAGGTGTGG - Intergenic
957788903 3:84915554-84915576 AAAAAAAAGAAGAAGTGATGAGG + Intergenic
958063497 3:88512930-88512952 AAAAATAATGAGCGCTGGTGAGG + Intergenic
959031570 3:101305553-101305575 AATAACAGGGAAAAGTGGTGGGG + Intronic
959287383 3:104433430-104433452 AGAAACAACGAACACTGGTGAGG + Intergenic
960242911 3:115366444-115366466 GAAAACATGGACAAATGGTGGGG + Intergenic
960379994 3:116948172-116948194 AAAAATGAGGAGAAATGCTGTGG - Intronic
960573202 3:119205566-119205588 AAAGACAAGGAGGATTGGAGGGG + Intergenic
961798618 3:129427587-129427609 AGAAACAGGGAGAGCTGGAGAGG - Intronic
962026618 3:131554537-131554559 AGAAAGAAGGAGAACAGGTCAGG + Intronic
962348322 3:134638628-134638650 AAAAGCAAGGAGAGCTGGCGGGG - Intronic
962764015 3:138544360-138544382 AAAAAAAAAAAGTACTGGTGAGG + Intronic
962829694 3:139129128-139129150 TTACACAAGGAGAGCTGGTGAGG + Intronic
963052642 3:141154979-141155001 AAAAACCAAGAGTACAGGTGGGG + Intergenic
964367179 3:155962539-155962561 AGAAACAGGGAGAAATAGTGAGG - Intergenic
964526249 3:157617814-157617836 AGAAACAAGGGGATCTGATGTGG - Intronic
965075734 3:163973467-163973489 AAAAAAAAAAAGAACTGTTGTGG - Intergenic
966189999 3:177263538-177263560 AAAAGCAAGGAGAGATGGAGAGG - Intergenic
966514533 3:180803661-180803683 AAAAACAAAGAGACCTAGAGAGG + Intronic
966600049 3:181765929-181765951 TATAACATGTAGAACTGGTGCGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967052016 3:185793659-185793681 GAAAACAAGGAAAACTTGAGAGG + Intronic
967113825 3:186318861-186318883 AAAACCAAGGGAAACTGGTATGG - Intronic
967782314 3:193453590-193453612 AAAAACAAGGAAAACTTCTGAGG - Intronic
969288649 4:6224296-6224318 AGCAACAAGGAGCAGTGGTGGGG - Intergenic
969399114 4:6941946-6941968 GAAATGCAGGAGAACTGGTGTGG + Intronic
970204293 4:13640669-13640691 AAAAACAAGGAGAACCTGCAAGG - Intergenic
971502641 4:27333278-27333300 AAAAACAGGAACAAATGGTGTGG - Intergenic
972068568 4:34984254-34984276 AAAGACAAGGATAAATGGAGGGG + Intergenic
972158753 4:36197943-36197965 GAAAACAAGGAGAAGAGCTGCGG - Intronic
973645668 4:52949086-52949108 GAGAACATGGAGCACTGGTGAGG - Intronic
975130915 4:70831902-70831924 AAAAAAAAAAAAAACTGGTGGGG - Intronic
976683348 4:87782834-87782856 AATTACAAGGAGAACTTGTCTGG + Intergenic
977327244 4:95591194-95591216 TAAAGCAATGAGAAGTGGTGTGG - Intergenic
978358581 4:107904337-107904359 AAGAACAAGGAGGACAGGGGAGG - Intronic
978672912 4:111272720-111272742 AACAACAAGCAAAATTGGTGAGG - Intergenic
978774973 4:112496670-112496692 AAAAAGAAGAAGAGCTGGTTGGG - Intergenic
979218893 4:118198086-118198108 AAAAACAATGAGGCCAGGTGTGG - Intronic
979982041 4:127268940-127268962 AAAGACAAGTAGTGCTGGTGAGG + Intergenic
980057643 4:128094213-128094235 AAAAACAAGTAGGCCAGGTGTGG - Intronic
981648990 4:147034603-147034625 AATAACAGGGAGAACTGGAAGGG - Intergenic
981959503 4:150519246-150519268 AAATACAAAGATAACAGGTGTGG + Intronic
982235776 4:153249730-153249752 TTAAACAAGGTAAACTGGTGAGG + Intronic
983691525 4:170474938-170474960 AAAAATTAGGAGAACTTATGGGG + Intergenic
984962473 4:185111102-185111124 AAAAGCATGGAGAAGGGGTGAGG + Intergenic
985326688 4:188778519-188778541 AAGAACAGTGAGAAATGGTGCGG + Intergenic
986730748 5:10633081-10633103 AAAAAAGAGGAGAACTGGCTGGG - Intronic
987256112 5:16153322-16153344 GAAAACAAGGACAACTGGTTTGG + Intronic
987418508 5:17690667-17690689 GAAAATAGGGAGAGCTGGTGTGG - Intergenic
987722858 5:21661416-21661438 AAAAACAATAATTACTGGTGAGG + Intergenic
987757745 5:22118866-22118888 AAAAACAAGGAGTATAGTTGGGG + Intronic
988861359 5:35283597-35283619 AAAAACAAGGAAAAGTGGCTAGG + Intergenic
989022808 5:37029701-37029723 GACAATAATGAGAACTGGTGAGG - Intronic
990716342 5:58641479-58641501 AAAAACCAGGAGAAATGCTAAGG + Intronic
991924299 5:71689044-71689066 AAAAACAAGGATAAATAGTTGGG + Intergenic
992018584 5:72599927-72599949 GAAAACCATGAGAACTGGAGAGG - Intergenic
992306741 5:75447762-75447784 AAAAAAAAGGAGGCCGGGTGTGG - Intronic
992381159 5:76239206-76239228 AAGAACAAAGAAAACTGGAGAGG - Intronic
993114402 5:83702733-83702755 AAAAAAAAGGAAAACTGTTGGGG - Intronic
993227097 5:85181315-85181337 ATAATCAAGGAGAGCTGGGGTGG + Intergenic
993286604 5:86007243-86007265 AAAAACAACAGGTACTGGTGCGG - Intergenic
993966128 5:94363161-94363183 AAAAAAAAAGAAAACTGGTTTGG - Intronic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
995445050 5:112233558-112233580 AAAAAAAAGGAGCACTATTGAGG - Intronic
995490969 5:112691416-112691438 ACATACAAGGAGAACTAGAGTGG + Intergenic
995541595 5:113191237-113191259 AAAAATGTGGAGTACTGGTGCGG - Intronic
995668297 5:114569685-114569707 AAAAACAAAGATAACTAGTTGGG - Intergenic
996206977 5:120751426-120751448 AAAAATAGGGAGTGCTGGTGAGG - Intergenic
996308162 5:122074789-122074811 AAAAACAATGAGGACTGGCTTGG + Intronic
996574001 5:124962650-124962672 AGAAACAAAGAGAACTGGAGAGG - Intergenic
997447989 5:133955890-133955912 AAAAACAAAGAAAACAAGTGTGG + Exonic
998034442 5:138902402-138902424 AAAAACAAAGATCCCTGGTGAGG - Intronic
998404344 5:141865444-141865466 AAAAACAAGGAGAACAGAGATGG + Intronic
998819911 5:146049048-146049070 GAAGACACAGAGAACTGGTGAGG - Intronic
1000948857 5:167455700-167455722 AAACCCAAGGAGAATTGGGGAGG - Intronic
1001272825 5:170328421-170328443 AAATACAAGGAGAACAGTTTGGG - Intergenic
1001326932 5:170735615-170735637 AAAAACAAGAAGTAAGGGTGGGG - Intronic
1002045283 5:176537917-176537939 ATAAACAAGGAGAAGTGGGGCGG - Intronic
1002095780 5:176829867-176829889 AAAAAAAAGGAGCAGTGATGTGG - Intronic
1002490556 5:179573483-179573505 AAACACAAGGTAAACTGGAGTGG - Intronic
1002820336 6:718959-718981 AAAAACAAGAAGCATTTGTGAGG - Intergenic
1003011950 6:2434672-2434694 AAAAACACGGAGGTCTGGGGAGG - Intergenic
1003104398 6:3203757-3203779 AAAAACAACCAGAAATGATGGGG + Intergenic
1003222713 6:4175801-4175823 AAAAAAAAGGAAAACTGGCCAGG + Intergenic
1003321199 6:5053469-5053491 AAAGAGAAAGAAAACTGGTGAGG + Intergenic
1003534344 6:6963138-6963160 AAAAAAAAGCAGAAATGGTGGGG - Intergenic
1004442096 6:15663164-15663186 AAAAACGAGAAGGCCTGGTGCGG - Intergenic
1004836845 6:19540088-19540110 AAAGACACGGAGAAGGGGTGGGG - Intergenic
1005615988 6:27573810-27573832 AAAAAGAAGAAGGTCTGGTGAGG + Intergenic
1005852232 6:29830224-29830246 AAAAACAAGGAAAGCAGATGTGG - Intronic
1005875849 6:30008991-30009013 AAAAACAAGGAAAGCAGATGTGG - Intergenic
1006174306 6:32112711-32112733 AAGAGGATGGAGAACTGGTGTGG + Intronic
1007360604 6:41352755-41352777 AAACACCAGGAAAGCTGGTGTGG - Intergenic
1007954138 6:45901190-45901212 TTTAACAAGGAGAACTGGTGAGG - Exonic
1008247111 6:49190328-49190350 GAAAACAAAGAGAACTAGAGTGG + Intergenic
1008439490 6:51516302-51516324 AAAAACAAGGAGAACCAGGAAGG - Intergenic
1008537702 6:52519486-52519508 AAAAACAACAAGTATTGGTGAGG + Intronic
1009449547 6:63785321-63785343 AGAAACAAGTAAAACTGGTTAGG - Intronic
1009817337 6:68753084-68753106 AAAAACAAGAAGAGCTGCTATGG + Intronic
1010200328 6:73276194-73276216 AAAAAAAAAGAGGCCTGGTGTGG + Intronic
1010205285 6:73316889-73316911 AAAAAAAATGAGGACTGGGGAGG + Intergenic
1010676196 6:78746544-78746566 AAAAAAAAAGAGCATTGGTGAGG + Intergenic
1010691110 6:78911462-78911484 AAAATCCAGAAAAACTGGTGAGG - Intronic
1011059265 6:83245070-83245092 AAGAACAGGGAGAGCAGGTGTGG + Intronic
1011910215 6:92426442-92426464 AAATACAAGGAGGCCGGGTGCGG - Intergenic
1012317022 6:97793198-97793220 AAAAGCAAGAGGACCTGGTGTGG - Intergenic
1012603833 6:101132430-101132452 GAAAACATGAAGACCTGGTGTGG - Intergenic
1013211898 6:107994466-107994488 AAAAACAAAAAGTAGTGGTGGGG - Intergenic
1013724071 6:113070920-113070942 AAAATCACAGAGAACTGGTTGGG + Intergenic
1014004712 6:116404922-116404944 GGAAATCAGGAGAACTGGTGAGG + Intronic
1014269401 6:119319950-119319972 AAAAGCCAGGAGAACTGCAGTGG + Intronic
1014585635 6:123194572-123194594 AAAAACAAGGAGATGTGGAAAGG - Intergenic
1015016237 6:128416655-128416677 AAAAAAAAAAAGAACTGGAGAGG + Intronic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1015363265 6:132366424-132366446 AAAAACAATGAGAACTAGACGGG + Intronic
1016510353 6:144835887-144835909 AAGAACGTGGAGAACTGGAGAGG + Exonic
1016851816 6:148627268-148627290 AGAAACAAAGAGAACTCGTGTGG - Intergenic
1017878284 6:158541767-158541789 GAAAACAAGGAGAAAAGATGAGG - Intronic
1018260332 6:161964056-161964078 AAAAGCAAGGCTATCTGGTGAGG - Intronic
1018555213 6:165042488-165042510 AGAAAGAGGAAGAACTGGTGAGG + Intergenic
1018919723 6:168163133-168163155 AAAAACAAGCAGGCCAGGTGTGG - Intergenic
1019207444 6:170374386-170374408 AAGAACAGGGTGAACTGGTGTGG + Intronic
1019304170 7:324867-324889 AAAAACAAGGAGCACCGAAGTGG + Intergenic
1019391624 7:790721-790743 AAAAACAAGGAGCACAGGCTGGG + Intergenic
1020703730 7:11515850-11515872 AGAAACAAGGAGTACTGCTTTGG + Intronic
1021704207 7:23350965-23350987 AAAAACAATGAGGGCAGGTGGGG + Intronic
1022142151 7:27501719-27501741 AAAAAAAAGAAGAATTGGTTAGG - Intergenic
1022294249 7:29034955-29034977 AAAAAAAATGAGAGCTGGTATGG - Intronic
1022610880 7:31871699-31871721 AAAAAAAAGATGCACTGGTGAGG + Intronic
1024777923 7:52809715-52809737 AAAAACAGGGAGGAGTGGTGGGG + Intergenic
1025152747 7:56573027-56573049 AAAAAAAAAAAGAGCTGGTGTGG - Intergenic
1025993603 7:66514049-66514071 AAAAGAAAGGAGGTCTGGTGCGG - Intergenic
1026020153 7:66699695-66699717 AAAAAAAAACAAAACTGGTGTGG + Intronic
1027259767 7:76456552-76456574 AAAAAAAAGGACAACACGTGGGG - Intergenic
1027282707 7:76620340-76620362 AAAAAAAAGGACAACACGTGGGG + Intronic
1027311137 7:76954652-76954674 AAAAAAAAGGACAACACGTGGGG - Intergenic
1027550203 7:79583509-79583531 AAAAACAACAAGCAGTGGTGAGG - Intergenic
1028055826 7:86241328-86241350 AAAAAGAAGGAGAAGGGGAGAGG + Intergenic
1028625264 7:92870479-92870501 AAAAAAAAGGAGGCCGGGTGTGG + Intergenic
1029723926 7:102389583-102389605 AAAAAAAAGGGGACCAGGTGTGG - Intronic
1030982585 7:116204252-116204274 AAAAACAAGGAGGCCAGGTGTGG - Intergenic
1031837228 7:126692074-126692096 GAAAAGAAAGAGAACTGGAGGGG + Intronic
1033446910 7:141431157-141431179 AAAAAAAAACAGAAATGGTGAGG - Intronic
1035901787 8:3464889-3464911 AAAAACAAAGAGAGCTCTTGAGG - Intronic
1036774629 8:11601875-11601897 AAAAAGAAGAAGAAGAGGTGGGG - Intergenic
1038971977 8:32646696-32646718 AAAAAGGAGGAAAACGGGTGGGG + Intronic
1039813848 8:41074523-41074545 AGAAGAATGGAGAACTGGTGAGG - Intergenic
1039954366 8:42195777-42195799 AACATCAAGGAGAAATGGGGAGG - Intronic
1041720016 8:60967338-60967360 AAAAACAAAGATGGCTGGTGAGG + Intergenic
1041815881 8:61970462-61970484 AAAAGCCAGGAGAACTGGAAAGG + Intergenic
1042161244 8:65897907-65897929 AAAAATAAGGAGGCCGGGTGCGG - Intergenic
1042843342 8:73146881-73146903 AAAAATAAAGAGAACAGCTGGGG + Intergenic
1043321292 8:78989646-78989668 AAAAACAAGAAAAACTGATGGGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043629116 8:82306167-82306189 AAAAAGAAGGTGAATTGGTGAGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1043815966 8:84801756-84801778 AATGACATGGAAAACTGGTGAGG + Intronic
1043965644 8:86471890-86471912 AAAAAGATGGGGAACTGTTGTGG + Intronic
1044309379 8:90676099-90676121 AAAAAGCAGGAAAACTGGTTAGG + Intronic
1044564994 8:93653158-93653180 AGAAAGAGGGAGAGCTGGTGGGG - Intergenic
1044745574 8:95367442-95367464 AAAAAAAAAAAAAACTGGTGAGG - Intergenic
1044843927 8:96361552-96361574 AAAACCAAGGAGACCTGCTGTGG + Intergenic
1045313226 8:101021628-101021650 AAGAACAAAGAAAACTGGAGGGG + Intergenic
1045966885 8:108035420-108035442 AACAAAAAAAAGAACTGGTGAGG - Intronic
1046478264 8:114778549-114778571 AATAACAAGGAGAATTTGGGTGG + Intergenic
1046705953 8:117451941-117451963 AAAAATAAGGAATAGTGGTGAGG + Intergenic
1047107417 8:121748325-121748347 AAAAAGAAGGGGAACTGATGGGG + Intergenic
1047152605 8:122281502-122281524 AAAACCATGGAGAGGTGGTGTGG + Intergenic
1048188949 8:132271002-132271024 AAAGACAAGGAGGAGTGATGTGG + Intronic
1048584077 8:135756495-135756517 AAACACTGGGAAAACTGGTGAGG + Intergenic
1050077336 9:1878537-1878559 AAAAAAAAGAAGGCCTGGTGTGG - Intergenic
1051138021 9:13945611-13945633 AGAAACAAGGAGAAATGGTCAGG - Intergenic
1051216060 9:14798962-14798984 TAAAACATGGAGACCGGGTGTGG - Intronic
1051502392 9:17792164-17792186 GAAAACAACGAAAACAGGTGTGG - Intronic
1051777011 9:20645840-20645862 AAAAAAAAGGAAAATTGGTGAGG - Intergenic
1051872534 9:21755108-21755130 AAAACCAAGGAGGAGGGGTGGGG - Intergenic
1052887511 9:33664507-33664529 AGAAGCATGGAGAAATGGTGAGG - Intergenic
1052936674 9:34099058-34099080 AAAAAAAAGCAGACCAGGTGTGG - Intronic
1053592706 9:39530661-39530683 AAAAAAAAAGAAATCTGGTGTGG - Intergenic
1054573596 9:66834615-66834637 AAAAAAAAAGAAATCTGGTGTGG + Intergenic
1054875704 9:70094258-70094280 CAATACATGGAGAAATGGTGAGG - Intronic
1055601850 9:77927641-77927663 AAAAAAAAGTAGAAGTGGTATGG - Intronic
1057254586 9:93534618-93534640 AAAAAGAAGGAGAAGAGGAGAGG - Intronic
1057574378 9:96230142-96230164 AAAAAGAACAAGTACTGGTGAGG + Intergenic
1057695459 9:97319992-97320014 AAGAACAAAGGGAACTGCTGGGG - Intronic
1057774953 9:98000348-98000370 AAATGCATGGAGCACTGGTGAGG - Intronic
1060072677 9:120563973-120563995 AAAGATAAGGAGACCAGGTGTGG + Intronic
1060861622 9:126959582-126959604 AAAAAAAAAAAGAACTGGTCAGG - Intronic
1060864926 9:126988126-126988148 AAATACAAGGACCAGTGGTGAGG + Intronic
1061501397 9:131004800-131004822 AAAAAAAAAAAGACCTGGTGGGG - Intergenic
1062376649 9:136264747-136264769 AAAAAAAAGGTGAGCTGGGGTGG - Intergenic
1062701061 9:137903520-137903542 AAAAGCAAGGAGAACGGGACTGG - Intronic
1203770805 EBV:49137-49159 AAACAGGAGGAGAACAGGTGAGG - Intergenic
1185468722 X:370209-370231 GCAAAGAGGGAGAACTGGTGTGG + Intronic
1185769204 X:2752269-2752291 CAAACCATGGAGAGCTGGTGGGG + Exonic
1186573280 X:10738333-10738355 AAAGGCAATGAGAACTGCTGTGG - Intronic
1186710707 X:12193153-12193175 AAAAACAAGAAGAGCTGATTTGG - Intronic
1186911465 X:14172634-14172656 AAAAAAAAAAAGAATTGGTGAGG - Intergenic
1187679126 X:21749053-21749075 AAGAACAATGACAACTAGTGGGG + Intronic
1187785116 X:22875914-22875936 AATAACGAGGAAAACTGTTGAGG + Intergenic
1188409055 X:29849055-29849077 AAAAACATGGAGACAGGGTGTGG - Intronic
1188458382 X:30393763-30393785 AAATACAAGGAAAACTAGAGAGG + Intergenic
1188745499 X:33836830-33836852 AAAAAAAAGGAGAAATGGAAAGG + Intergenic
1189055977 X:37700105-37700127 AACAACCAGGAAAACAGGTGTGG - Intronic
1189161098 X:38809785-38809807 AAAAATAAGGGGAAATGATGAGG - Intergenic
1190492256 X:50993840-50993862 GAAATCAAGGTGAACTGATGTGG + Intergenic
1190900840 X:54671719-54671741 AAAAACAAGTTGAAGTAGTGAGG - Intergenic
1191706035 X:64095383-64095405 TAAAACATGGAGAACATGTGGGG + Intergenic
1191941002 X:66481949-66481971 AAAAAAAAGGTGACCTGCTGAGG - Intergenic
1192313049 X:70032274-70032296 AAAAAGAAGAAGAAGTGATGGGG + Intronic
1192342996 X:70279686-70279708 AGAAGCCAGGAGAGCTGGTGAGG + Intronic
1192405893 X:70885933-70885955 AAAAATAAGAAGTATTGGTGAGG + Intronic
1193087951 X:77464335-77464357 AAAGACAATGAGTATTGGTGAGG - Intergenic
1193282317 X:79668089-79668111 AAAAACAAGGGATACTGGTGAGG + Intergenic
1194032120 X:88830740-88830762 AAAAACAAAGAGAAATAGTGGGG - Intergenic
1194077529 X:89415518-89415540 AAAAACAATGAATTCTGGTGAGG - Intergenic
1194081311 X:89468162-89468184 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1194723655 X:97369526-97369548 CAAAAAAAGGAGCACTGATGAGG - Intronic
1194769647 X:97886043-97886065 AAAAAGAAGGAGAAATAGAGGGG + Intergenic
1195374494 X:104213681-104213703 AAAAACAATGGGGCCTGGTGTGG - Intergenic
1195778184 X:108431256-108431278 AAGTATAAGGAGAACTAGTGAGG + Intronic
1196594989 X:117534850-117534872 AGAAACCAGGAGACCTGTTGTGG + Intergenic
1196738611 X:119004108-119004130 AAAAAAAATGAGAACTGGAGAGG - Intronic
1197227656 X:123969935-123969957 AAAAACAGGAAGACCGGGTGCGG - Intronic
1197549793 X:127876315-127876337 AAAAAAAAAGACAAGTGGTGAGG - Intergenic
1198379080 X:136067457-136067479 CAAATCCAGGAGAACTGGGGAGG - Intergenic
1198749345 X:139923079-139923101 AAAAAAAAGTATAACAGGTGGGG - Intronic
1199237066 X:145504419-145504441 AAAAGCAAGGAGAAGAGATGAGG + Intergenic
1199473418 X:148220129-148220151 CAAAACCAGGAGAATTAGTGTGG + Intergenic
1199857296 X:151770565-151770587 AAAAACAACAACTACTGGTGAGG + Intergenic
1200430176 Y:3071055-3071077 AAAAACAATGAATTCTGGTGAGG - Intergenic
1200433983 Y:3124359-3124381 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1200914046 Y:8555852-8555874 AAAAACAAGAAGCACTGCAGTGG - Intergenic
1201301302 Y:12507353-12507375 CAAACCATGGAGAGCTGGTGGGG - Intergenic