ID: 1105762330

View in Genome Browser
Species Human (GRCh38)
Location 13:23526254-23526276
Sequence TGTCCTCCTGGACCACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 2, 1: 41, 2: 157, 3: 120, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105762330_1105762340 15 Left 1105762330 13:23526254-23526276 CCCCCTTGTGGTCCAGGAGGACA 0: 2
1: 41
2: 157
3: 120
4: 270
Right 1105762340 13:23526292-23526314 TTTTGAGAATGCATCAGTAAGGG 0: 31
1: 44
2: 109
3: 118
4: 387
1105762330_1105762339 14 Left 1105762330 13:23526254-23526276 CCCCCTTGTGGTCCAGGAGGACA 0: 2
1: 41
2: 157
3: 120
4: 270
Right 1105762339 13:23526291-23526313 TTTTTGAGAATGCATCAGTAAGG 0: 30
1: 54
2: 116
3: 144
4: 1886
1105762330_1105762338 -9 Left 1105762330 13:23526254-23526276 CCCCCTTGTGGTCCAGGAGGACA 0: 2
1: 41
2: 157
3: 120
4: 270
Right 1105762338 13:23526268-23526290 AGGAGGACAGGCAAGGGTTTAGG 0: 1
1: 0
2: 92
3: 83
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105762330 Original CRISPR TGTCCTCCTGGACCACAAGG GGG (reversed) Intergenic
901646282 1:10718484-10718506 TGTCCACCTGCTCCCCAAGGAGG + Intronic
901865585 1:12104713-12104735 TCTGCACCTGGAACACAAGGTGG - Intronic
902528046 1:17071932-17071954 TTTCCTCCTGTACCACACGATGG + Intronic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
904381192 1:30112180-30112202 TTTCCTGCAGGACCACAAAGAGG + Intergenic
904391992 1:30192065-30192087 TCTCCTTCTGTAACACAAGGTGG - Intergenic
904583682 1:31566738-31566760 TGTCCTCCGGGAGCCCAGGGAGG + Intergenic
907842179 1:58168931-58168953 TGTCCTCCTAGACCACAAAGAGG - Intronic
907842191 1:58169016-58169038 TTTCCTCCTAGACTGCAAGGAGG - Intronic
908300264 1:62755765-62755787 TGTCCTCCTAGACCACAAGGAGG - Intergenic
908646379 1:66282494-66282516 TGTCTTGCTTGAACACAAGGAGG + Intronic
909437411 1:75658511-75658533 TGTGCTCCTGGACAACAAATGGG + Intergenic
909504408 1:76371921-76371943 TGTGCTCCTTAACCAAAAGGAGG - Intronic
910097932 1:83545612-83545634 TCTGCTCCTTGACCAGAAGGGGG + Intergenic
910397664 1:86808268-86808290 TGTCCTCCTAGATCACAAAGAGG + Intergenic
911298812 1:96149333-96149355 TGTCCTCCTAGACCACAAGGAGG - Intergenic
911298825 1:96149418-96149440 TTTCCTTCTAGACCACAAGGAGG - Intergenic
911751276 1:101500458-101500480 TTTCCTCCTAGACCACAAAGAGG - Intergenic
911845762 1:102748597-102748619 TTTCCTCCTAGACCACAAGGAGG + Intergenic
911845776 1:102748682-102748704 TGTCCTCCTAGATCACAAAGAGG + Intergenic
912021145 1:105110528-105110550 TGTCCTCCTAGACCACAAAGAGG - Intergenic
912021160 1:105110612-105110634 TTTCCTCCTAGACCACAAGGAGG - Intergenic
913382480 1:118227044-118227066 TTTCCTCTTAGACCACAAAGAGG - Intergenic
913382493 1:118227129-118227151 TTTCCTCCTAGACCACAAAGAGG - Intergenic
913469345 1:119173728-119173750 TGTCCTCCTAGACCACAAGGAGG - Intergenic
913469362 1:119173813-119173835 TTTCCTCCCAGACCACATGGAGG - Intergenic
915099631 1:153490061-153490083 TTTCCTCCTGAACCCCGAGGTGG + Intergenic
915260414 1:154672993-154673015 TGTCCTCCTAGACCACAGGGAGG - Intergenic
915260429 1:154673078-154673100 TTTCCTCCCAGACCACACGGAGG - Intergenic
916083461 1:161251558-161251580 TTTCCTCTTAGACCACAAAGAGG - Intergenic
916083475 1:161251643-161251665 TTTCCTCCTAGACCACAAAGAGG - Intergenic
916114302 1:161474156-161474178 TTTCCTCCCAGACCACAAGGAGG - Intergenic
916939359 1:169663434-169663456 TGTCCTCCTAGACCACAAGGAGG - Intronic
917227406 1:172799742-172799764 TGTCCTCCTAGACCACAAAGAGG - Intergenic
917227419 1:172799827-172799849 TTTCCTCCTAGACCACAGGGAGG - Intergenic
917279742 1:173369355-173369377 TTTCCTCTTAGACCACAAAGAGG - Intergenic
917279755 1:173369440-173369462 TTTCCTCCTAGACCACAAAGAGG - Intergenic
917280978 1:173378042-173378064 TGTCCTCCTAGACCACAAAGAGG - Intergenic
917280992 1:173378127-173378149 TTTCCTCCTAGACCACAAGGAGG - Intergenic
917445952 1:175106007-175106029 TTTCCTCCCAGACCACATGGAGG + Intronic
917445968 1:175106092-175106114 TGTCCTCCTAGACCACAAGGAGG + Intronic
917676132 1:177321128-177321150 TTTCCTCCTAGACCACAAGGAGG - Intergenic
918750304 1:188262141-188262163 TTTCCTCCTAGACCACAAGGAGG + Intergenic
918750314 1:188262226-188262248 TGTCCTCCTAGACCACAAGGAGG + Intergenic
919206152 1:194423577-194423599 TTTCATCCTAGACCACAATGAGG - Intergenic
919558509 1:199091759-199091781 TTTCCTCTTAGACCACAAAGAGG - Intergenic
919558523 1:199091844-199091866 TTTCCTCCTAGACCACAATGAGG - Intergenic
919917955 1:202150671-202150693 TGTCCACAGGGACCAAAAGGTGG - Intronic
921019549 1:211223688-211223710 TGTCCTCCTAGACCACAAAGAGG - Intergenic
923558552 1:235021240-235021262 TGTCTTCCTGGAGGACAAAGAGG - Intergenic
1062905039 10:1174150-1174172 TGTGCTCCTGGTCTACAAAGGGG + Intergenic
1063321853 10:5058728-5058750 TTTCCTCCCAGACCACATGGAGG + Intronic
1063321868 10:5058813-5058835 TGTCCTCCTAGACCACAAGGAGG + Intronic
1063358928 10:5432023-5432045 TGTCATCCTAGAAGACAAGGAGG - Intronic
1063859223 10:10290131-10290153 TTTCCTCCTAGACCATGAGGAGG + Intergenic
1063889525 10:10615362-10615384 TGGCCTCCTGGACCTCAGCGGGG - Intergenic
1064603698 10:17017256-17017278 TTTCCTCCTAGACCACAAGGAGG + Intronic
1064603713 10:17017341-17017363 TGTCCTCCTAGACCACAAGGAGG + Intronic
1065082281 10:22140384-22140406 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1066614704 10:37283042-37283064 TTTCCTCCCAGACCACAAGGAGG + Intronic
1066614719 10:37283127-37283149 TGTCCTCCTAGACCACAAGGAGG + Intronic
1067263166 10:44712452-44712474 TGTCCTCTGGGCTCACAAGGTGG - Intergenic
1068240505 10:54296984-54297006 TTTCCTCCTAGACCACAAGGAGG - Intronic
1068500160 10:57834106-57834128 TGTCTTCCTAGACCACAAAGAGG - Intergenic
1068500174 10:57834191-57834213 TTTCCTCCTAGACCACAAAGAGG - Intergenic
1068790918 10:61030202-61030224 TGTCCTCATGGACACCAAAGAGG - Intergenic
1069137469 10:64783304-64783326 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1069137484 10:64783389-64783411 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1069322321 10:67187480-67187502 TGTCTTCCTTGAAGACAAGGAGG - Intronic
1069365236 10:67689005-67689027 TGTCCTCTTAGACCACAAAGAGG + Intronic
1071220998 10:83464305-83464327 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1071221015 10:83464390-83464412 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1071411709 10:85403242-85403264 GGTCTTCCTGGATCACAATGGGG - Intergenic
1071834704 10:89407789-89407811 TGTCCTCCTAGACCACAAAGAGG - Intronic
1071834719 10:89407874-89407896 TTTCCTCCTAGACCACAAGGAGG - Intronic
1072371783 10:94771865-94771887 TTTCCTCCTAGACCAGAAGGAGG + Intronic
1072371798 10:94771950-94771972 TGTCCTCGTAGACCACAAAGAGG + Intronic
1073468046 10:103705684-103705706 TGTCCTTCTTAGCCACAAGGTGG - Intronic
1073970605 10:109042696-109042718 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1073970618 10:109042781-109042803 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1074157712 10:110812730-110812752 TTTCCTCCTGGACCTCCCGGGGG - Exonic
1074612873 10:115038464-115038486 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1074612887 10:115038549-115038571 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1074742775 10:116500912-116500934 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1074764129 10:116687911-116687933 AGTCGTCCTGGGCCACAATGTGG - Intronic
1075146199 10:119885026-119885048 TTTCCTCTTAGACCACAAAGAGG - Intronic
1076556230 10:131322987-131323009 TTTTCTCCTGGCCCACAACGAGG - Intergenic
1076600242 10:131652666-131652688 TGTCGTCCCCCACCACAAGGCGG + Intergenic
1077201021 11:1307614-1307636 TGTCCTCCTGGAGAGCAGGGGGG - Intronic
1077407459 11:2388997-2389019 TGTCCTCCTGGAGCAGCAGGGGG + Intronic
1079731382 11:23940165-23940187 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1079811785 11:25005715-25005737 TTTCCTCCTAGAACACAAAGAGG + Intronic
1081033277 11:38112906-38112928 TGTCCTCCTAGACCACAAAAAGG - Intergenic
1081033288 11:38112991-38113013 TTTCCTCCTAGACTACAAGGAGG - Intergenic
1081145869 11:39562194-39562216 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1081421286 11:42876474-42876496 TTTCCTCCCAGACCACATGGAGG - Intergenic
1082906265 11:58311182-58311204 TTTCCTCCTAGACCACAAAGAGG + Intergenic
1082906278 11:58311267-58311289 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1083486701 11:62987593-62987615 TGTCCTCCAGCAGAACAAGGAGG - Intergenic
1084210836 11:67621445-67621467 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1084210853 11:67621530-67621552 TTTCCTCCCAGACCACATGGAGG - Intergenic
1084269332 11:68020767-68020789 TTTAATCCTTGACCACAAGGGGG + Intronic
1085442068 11:76574580-76574602 TGTACTCCTGTACCACATAGGGG + Intergenic
1085707360 11:78798750-78798772 TCTCCTCCTTGGCCACCAGGGGG + Intronic
1086317248 11:85607987-85608009 TGTCCTCCTAGACCACAAAGAGG - Intronic
1086317263 11:85608072-85608094 TTTCCTCCTAGACCACAAGGAGG - Intronic
1087074869 11:94119680-94119702 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1087074884 11:94119765-94119787 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1087319129 11:96637891-96637913 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1087459137 11:98423576-98423598 TTTCCTCCTAGACTGCAAGGAGG + Intergenic
1088492409 11:110400877-110400899 TGTCCTCCTAGACCCCAAAGAGG - Intergenic
1088492422 11:110400962-110400984 TTTCCTCCTACACCACAAGGAGG - Intergenic
1089439674 11:118504920-118504942 TGCTCTACTGAACCACAAGGAGG - Exonic
1090705400 11:129331792-129331814 TGTACTCCTTGTCCACAATGAGG - Intergenic
1090873232 11:130766438-130766460 TGTCCTCCTGGCCCAGCATGAGG - Intergenic
1092472150 12:8789689-8789711 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1092472165 12:8789774-8789796 TTTCCTCCCAGACCACATGGAGG - Intergenic
1093580688 12:20781791-20781813 TTTCCTCCCAGACCACAAGGAGG + Intergenic
1093580701 12:20781876-20781898 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1094320088 12:29173845-29173867 TTTCCTCCTAGACCACAAGGAGG + Intronic
1094320102 12:29173930-29173952 TGTCCTCTTAGACCACAAAGAGG + Intronic
1094338239 12:29384256-29384278 TTTCCTCCCAGACCACATGGAGG + Intergenic
1094338257 12:29384341-29384363 TGTCCTCCTAGGCCACAAGGGGG + Intergenic
1097161271 12:57048263-57048285 TGTCCTCCTGGAACCCTTGGTGG - Exonic
1097428186 12:59472446-59472468 TTCCCTCCTAGACCACAAAGAGG - Intergenic
1099376145 12:81898002-81898024 TTTCCTCCTAGACCACAAACAGG - Intergenic
1099414869 12:82372960-82372982 TTTCCTTCTAGACCACAAGGAGG + Intronic
1099414883 12:82373045-82373067 TGTCCTCCTAGACCACAAAGAGG + Intronic
1099577014 12:84394198-84394220 TGTTCCCCTAGACCACAAAGAGG + Intergenic
1100050884 12:90446790-90446812 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1100050899 12:90446875-90446897 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1100092034 12:90984222-90984244 TTTCCTCTTAGACCACAAAGAGG - Intronic
1100209669 12:92388157-92388179 TTTCCTCCTAGGCCACAAAGAGG - Intergenic
1100530419 12:95456757-95456779 TTTCCTCCTAGACCACAAAGAGG + Intergenic
1100530432 12:95456842-95456864 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1100730179 12:97457317-97457339 TTTCCTCCTGGAGCCCAAGGTGG - Intergenic
1101704746 12:107211348-107211370 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1101779519 12:107823132-107823154 TGTCCTCCTAGACCACAGAGAGG - Intergenic
1101779532 12:107823217-107823239 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1103481842 12:121255446-121255468 TTTCTTCCTGGAGCACAGGGAGG - Intronic
1103511663 12:121479086-121479108 TGAACTCCTATACCACAAGGAGG + Intronic
1103936260 12:124478682-124478704 TCTCTGCTTGGACCACAAGGTGG - Intronic
1104574034 12:129950190-129950212 TGTCCTTCTGGCCCTCAATGGGG + Intergenic
1104766969 12:131336347-131336369 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1104766983 12:131336432-131336454 TTTCCTCCTAGACCACAGAGAGG - Intergenic
1105762330 13:23526254-23526276 TGTCCTCCTGGACCACAAGGGGG - Intergenic
1106162546 13:27214106-27214128 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1106162561 13:27214191-27214213 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1108848475 13:54701809-54701831 TTTCCTCTTAGACCACAAGGAGG - Intergenic
1108848489 13:54701894-54701916 TTTCCTCCTAGACCACAAAGAGG - Intergenic
1109424192 13:62150392-62150414 TTTCCTCCTAGACCACAAACGGG - Intergenic
1109500900 13:63235289-63235311 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1109500915 13:63235374-63235396 TTTTCCCCTAGACCACAAGGAGG - Intergenic
1111208170 13:85039913-85039935 GGGTCTCCTTGACCACAAGGCGG + Intergenic
1112518979 13:100079768-100079790 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1112518996 13:100079853-100079875 TTTCCTCCCAGACCACATGGAGG - Intergenic
1113204046 13:107895805-107895827 TTTCCTCCTAGATCACAAGGAGG + Intergenic
1113204060 13:107895890-107895912 TGTCTTCCTAGAACACAAAGAGG + Intergenic
1113551641 13:111197320-111197342 TTCCCTCCTAGACCACAAGGAGG + Intronic
1113551656 13:111197405-111197427 TGTCCTCCTAGACCACAAAGAGG + Intronic
1114566595 14:23637673-23637695 TGTCCTCCTAGACCATGAGGAGG - Intronic
1114645658 14:24254759-24254781 TGGCCCCCTGGTCCACAAGATGG + Exonic
1115285591 14:31710441-31710463 TTTTCTCCCAGACCACAAGGAGG + Intronic
1115285605 14:31710526-31710548 TGTCCTCCTAGACCACAAGGAGG + Intronic
1120198660 14:81514498-81514520 TGTCCTCCTAGACCCCAAAGAGG - Intronic
1120198672 14:81514583-81514605 TTTCCTCCTAGACCACAAAGAGG - Intronic
1122029470 14:98901901-98901923 TGTCATCCTCCACCACAGGGAGG + Intergenic
1124249726 15:28098950-28098972 TGACCTCATGGCCCACCAGGGGG + Intronic
1126072176 15:44874838-44874860 TTTCCTCCTAGACGACAAAGAGG + Intergenic
1126072189 15:44874923-44874945 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1126085996 15:45011742-45011764 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1127395619 15:58541922-58541944 CGACCTCCTTGCCCACAAGGCGG - Exonic
1131411040 15:92208627-92208649 TGTCCTCTTAAACCATAAGGAGG - Intergenic
1131411055 15:92208712-92208734 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1132500238 16:281744-281766 AGTCCTCCTGGCTGACAAGGAGG + Exonic
1135339798 16:21635883-21635905 TTTCCTCCCAGACCACAAGGAGG + Intronic
1136288269 16:29257063-29257085 TGGGCTCCTGGACCACAGCGGGG - Intergenic
1137292971 16:47064809-47064831 TGCCCTCCTGGATCAAAAGGAGG - Intergenic
1137442735 16:48510336-48510358 AGTCATCATGGACCACAATGTGG - Intergenic
1139424332 16:66869807-66869829 TGTCCTCCTGGTCCTCAACAGGG + Intronic
1142093940 16:88229818-88229840 TGGGCTCCTGGACCACAGCGGGG - Intergenic
1145200269 17:20938598-20938620 GGTCCTCCAGGAACACATGGAGG - Intergenic
1145273005 17:21414645-21414667 GGTCTTCCTGGGGCACAAGGAGG + Intronic
1145311206 17:21702089-21702111 GGTCTTCCTGGGGCACAAGGAGG + Intronic
1146310353 17:31763799-31763821 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1146310365 17:31763884-31763906 TGACCTCCTAGACCACAAGGAGG - Intergenic
1146310379 17:31763969-31763991 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1147535021 17:41315271-41315293 TGTCCCCCTGGAGCAGATGGAGG + Exonic
1149073764 17:52574656-52574678 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1149209528 17:54287720-54287742 TTTCCTCTTAGACCACAAAGGGG - Intergenic
1149213290 17:54327827-54327849 TTTCCTCCTAGACCACAAAGGGG + Intergenic
1149223406 17:54440639-54440661 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1149223422 17:54440724-54440746 TTTCCCCCTAGACCACAAAGAGG - Intergenic
1151567863 17:74909841-74909863 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1151567882 17:74909926-74909948 TTTCCTCCCAGACCACATGGAGG - Intergenic
1151802692 17:76387106-76387128 GGCCCTGCTGGACCACAACGGGG - Exonic
1152026718 17:77814464-77814486 TGTCCTCCAGCAACACATGGTGG - Intergenic
1152531523 17:80922076-80922098 TGGCCTCCTGAAGCACACGGGGG + Intronic
1152693597 17:81733050-81733072 AGACCTCCTGGGCCGCAAGGAGG - Intergenic
1153437908 18:5086861-5086883 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1153437920 18:5086947-5086969 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1155476235 18:26238040-26238062 TTTCCTCCTAGACCACAAAGAGG + Intronic
1156502491 18:37568299-37568321 TGTCCTAGGGGACCAGAAGGAGG - Intergenic
1157858057 18:51119093-51119115 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1158590428 18:58774427-58774449 TGCCCTCCTCGCCCCCAAGGTGG + Intergenic
1160715260 19:573409-573431 TGTCCTCCAAGAGCACATGGAGG + Intronic
1161241663 19:3226501-3226523 TGCCCTCCTAGGCCACATGGAGG - Intronic
1161598354 19:5164357-5164379 TTTCCTCCTAGACCACAAAGAGG + Intronic
1162338210 19:10074665-10074687 TGTTGTCCTGGTGCACAAGGAGG + Intergenic
1162835996 19:13318413-13318435 TGGCCTGGTGGACCACAAGGAGG + Intronic
1164993100 19:32698683-32698705 AGTTCTCCTAGACCACAAGGAGG + Intronic
1164993113 19:32698768-32698790 TGTCCTCCTAGACCTCAAAGAGG + Intronic
1165769609 19:38371420-38371442 GATCCTGCTGGACCACAGGGAGG - Intergenic
1166445794 19:42856537-42856559 CTTCCTCCTGCACCACCAGGGGG - Intronic
1166482738 19:43187291-43187313 CTTCCTCCTGCACCACAACGGGG - Intronic
1167128934 19:47571989-47572011 TGTCCTCCTGGAACACTGAGTGG + Intergenic
1167753487 19:51395009-51395031 TGACCTCCTGGACCTAAAAGAGG - Intergenic
925325670 2:3020164-3020186 AGTCCTCCTGGACTGCATGGAGG - Intergenic
925950043 2:8901296-8901318 TTTCCTCCTAGACCACAAGGAGG + Intronic
925950058 2:8901381-8901403 TGTCCTCCTAGACCACAAGGAGG + Intronic
926283025 2:11465822-11465844 TCTCCTCCTGGACCCGACGGAGG - Exonic
926504228 2:13691215-13691237 TGACCTCCTGTACAATAAGGAGG + Intergenic
927864505 2:26580085-26580107 TCTCCACATGGACCACAAGCAGG - Intergenic
929330212 2:40673486-40673508 TGTCCTCCTAGACCACAAAGAGG - Intergenic
929330227 2:40673571-40673593 TTTCCTCCTGGACCACAAGGAGG - Intergenic
929951356 2:46411985-46412007 TGTCCTCCTGGAACAAAAACAGG - Intergenic
930038360 2:47101982-47102004 TGTCCTCCTAGACCACAGGGAGG - Intronic
930038377 2:47102067-47102089 TTTCCTCCCAGACCACATGGAGG - Intronic
931540332 2:63323729-63323751 TGTCCTCCTAGACCACAAAGAGG - Intronic
931540347 2:63323814-63323836 TTTCCTCCCAGACCACAAGGGGG - Intronic
932283382 2:70513551-70513573 TGTCATCATGGACCACCAAGTGG + Intronic
934866973 2:97822584-97822606 TGTCCTCCTATACCACAAAGAGG - Intronic
934866989 2:97822669-97822691 TTTCCTCCTAGACCACAAGGAGG - Intronic
937982315 2:127622932-127622954 GGTCCTCCTGGACCTCCAGTGGG - Intronic
938103319 2:128512878-128512900 TGTCCTCCTGGGCAAGAATGAGG + Intergenic
938806328 2:134809911-134809933 TTTCCTCCTAGACCACAAGGAGG + Intergenic
939851715 2:147312872-147312894 TTTCCTCCTAGACCACAAGGAGG - Intergenic
940402368 2:153262354-153262376 TGTCCTCTGGGACTACAAAGAGG + Intergenic
941243274 2:163068250-163068272 GGTCCTCCAAGACCACAAGGAGG - Intergenic
941405625 2:165084032-165084054 TGTCTTCCTGACCCACAAGAAGG + Intergenic
941537690 2:166742673-166742695 TTTCCTCCTAGACCACAAGGAGG + Intergenic
942761201 2:179400175-179400197 TGTCCCCCTGAATCACAACGTGG + Intergenic
943103211 2:183511450-183511472 TTTCCTCCTAGACCACAAGGCGG + Intergenic
943103225 2:183511535-183511557 TGTCCTCCTAGACCACAAAGAGG + Intergenic
943133602 2:183886919-183886941 TGTCCTCCTAGACCACAAGGAGG - Intergenic
943133619 2:183887004-183887026 TTTCCTCCCAGACCACAAGGAGG - Intergenic
944728820 2:202498236-202498258 TGTCCTCCTAGACCACAAGGAGG - Intronic
944728837 2:202498321-202498343 TTTCCTCCCAGACCACATGGAGG - Intronic
945986948 2:216362613-216362635 TGACCTCATGCCCCACAAGGGGG - Intronic
945992040 2:216404188-216404210 TGTCCCTGAGGACCACAAGGGGG - Intergenic
946207500 2:218120447-218120469 TTTCCTCCTAGACCACAAAGAGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947359332 2:229331870-229331892 TATCATCCTGGACCTCAACGTGG + Intergenic
947450388 2:230203019-230203041 TGTCGGCCTGCACCACGAGGTGG + Intronic
948776081 2:240289780-240289802 TTTCCTCCTGGAACCCCAGGAGG - Intergenic
948801922 2:240436917-240436939 GCTCCTCCGGGACCACAGGGAGG - Intronic
1168766940 20:388223-388245 TGTCCTCCTGGAGCCCGAGGAGG + Exonic
1169051172 20:2579086-2579108 TGTCAACCTGGAGCACAAAGGGG - Intronic
1169268982 20:4184930-4184952 AGCCCTCTTGGACCACAAGATGG - Intronic
1170594294 20:17793710-17793732 GGTCCTCCTGGATCAGAAGTGGG + Intergenic
1172340501 20:34153914-34153936 TGTTCTCCTAGACCACAAAAAGG - Intergenic
1172340516 20:34153999-34154021 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1173427317 20:42954400-42954422 TGTCCTCCTGGACCAGGGGAGGG - Intronic
1173499970 20:43546025-43546047 TGCCTTCCAGGACCACCAGGGGG - Intronic
1173849751 20:46210374-46210396 CGTCCTCCTGCACCTCCAGGAGG + Exonic
1174868518 20:54161781-54161803 TCTCCTCCTGCTCCACAAGGCGG - Intronic
1174894009 20:54429495-54429517 TTTCCTCCTAGACAACAAGTAGG - Intergenic
1175017218 20:55804705-55804727 AGCCCTCCTGGAACAAAAGGAGG + Intergenic
1177134937 21:17298359-17298381 TTTCCTCCTAGACAACAAAGAGG - Intergenic
1178359236 21:31934069-31934091 TTTTCACATGGACCACAAGGAGG + Intronic
1179928540 21:44551741-44551763 TGTCCCCCGGGAACACCAGGAGG + Intronic
1181720528 22:24770974-24770996 TGTCCCCCTGGAGCACAGGTGGG - Intronic
1182445220 22:30386078-30386100 TCTCATCCTGAACCACAACGTGG - Exonic
1183387856 22:37525374-37525396 TGCCCCTCTGCACCACAAGGTGG + Intergenic
1183650270 22:39149608-39149630 TTTCCCCCTGGACCACAGGAGGG - Intronic
1184631669 22:45785841-45785863 CGTCCTCCTGGACCAAACGTGGG + Intronic
949449121 3:4166035-4166057 TTTCCTCCTAGACCACAAAGAGG + Intronic
951020339 3:17775886-17775908 TTTCCTCCTAGACCACAAGGAGG - Intronic
951239318 3:20271174-20271196 TGTCCTCCTAGATCACAAAGAGG - Intergenic
951239333 3:20271259-20271281 TTTCTTCCCAGACCACAAGGAGG - Intergenic
951912782 3:27768865-27768887 TCTCTTCCTGTACCACAGGGCGG + Intergenic
952452862 3:33448044-33448066 TGTCCTCCTGGACCACAAGGAGG - Intergenic
952452875 3:33448129-33448151 TTTCCTCCCAGACCACATGGAGG - Intergenic
952555189 3:34522812-34522834 TTTCCTCCTAGATCACAAGGAGG + Intergenic
952555201 3:34522897-34522919 TGTCCTCCTAGACCACAAAGAGG + Intergenic
952741240 3:36737219-36737241 TGTCCACCGGGACCTCAAGCCGG - Exonic
952941093 3:38444896-38444918 TTTCCTCCTAAACCACAAGGAGG + Intergenic
952959388 3:38580090-38580112 TGGCCTCTGGGACCACAGGGAGG + Intronic
953134002 3:40167179-40167201 TTACCTGCGGGACCACAAGGAGG + Exonic
953623108 3:44549513-44549535 TGTCCTCTTAGACCACAAAGAGG + Intergenic
953981407 3:47414980-47415002 TGTCCTCAGGGACCCCAGGGCGG - Exonic
954232406 3:49227501-49227523 TTTCCTCCTAGACCACAAGGAGG + Intronic
954232418 3:49227586-49227608 TGTCTTCCTAGATCACAAAGCGG + Intronic
954586825 3:51743724-51743746 TTTCCTCTTAGACCACAAAGAGG - Intergenic
954586838 3:51743809-51743831 TTTCCTCCTAGACCACAAGGAGG - Intergenic
954598765 3:51851570-51851592 TGTCTTCCTAGACCACAAAGAGG - Intergenic
954807686 3:53229912-53229934 TGGGCTCCTGGACCACCAGGAGG + Intronic
955200200 3:56845055-56845077 TGGCCTCCTGGAGCTGAAGGTGG + Intronic
956843122 3:73158092-73158114 TTTCCTCCTAGACCACAAGGAGG + Intergenic
956843136 3:73158177-73158199 TGTCCTCCTAGACCACAAAGAGG + Intergenic
958549358 3:95593999-95594021 TTTCCTCCCAGACCACAAGGAGG + Intergenic
958549373 3:95594084-95594106 TGTCCTCCTAGACCACAAGGAGG + Intergenic
958575945 3:95950076-95950098 TTTCCTCCTAGACCACAAGGAGG + Intergenic
958601229 3:96299116-96299138 TTTCCTCCTAGACCACAAGGAGG - Intergenic
959677213 3:109050046-109050068 TATCCTCCTGGGCCCCAAGCAGG + Intronic
960063524 3:113347932-113347954 TGTCCTCTTAGACCACAATGAGG - Intronic
960063536 3:113348017-113348039 TTTCCTCTTAGACCACAAGGAGG - Intronic
960627232 3:119692964-119692986 TGTCCTCCAGGAGCACACTGTGG - Intergenic
961261512 3:125605858-125605880 TTTCCTCCTAGACCACAAAGAGG - Intergenic
961544239 3:127621171-127621193 TGTCCTGCTGGGCCCCAAAGCGG - Exonic
963021113 3:140873833-140873855 TGTCCTCCTAGACCACAAAGAGG - Intergenic
963021123 3:140873918-140873940 TTTCCTCCTAGAACACAAGAAGG - Intergenic
963409350 3:144908337-144908359 TTTCCTCTTAGACCACAAGGAGG + Intergenic
963696577 3:148572257-148572279 TGTCCTCCTAGACCACAAAGAGG - Intergenic
963696593 3:148572342-148572364 TTTCCTCCTAGACCACAAGGAGG - Intergenic
963992441 3:151669470-151669492 TTTCCTCCAAGACCACAAGGAGG + Intergenic
964064342 3:152561304-152561326 TGTCCTCCTAGACCACAAGGAGG - Intergenic
964972089 3:162575933-162575955 TGTCCTCCTAGACCACAAAGAGG - Intergenic
964972101 3:162576018-162576040 TTTCCTCCTAGACCACAAGGAGG - Intergenic
965062615 3:163803173-163803195 TTTCCTCCTAGACCACAAAGAGG - Intergenic
966282690 3:178251514-178251536 TGTCATCCTTGCCCAAAAGGTGG - Intergenic
967583472 3:191186927-191186949 TGTCCTCTTAGACCACAAAGAGG - Intergenic
968746129 4:2361553-2361575 AGCCCTCCTGGGCCTCAAGGTGG - Intronic
969728666 4:8940425-8940447 TGTCCTCCCGGAGAACCAGGGGG + Intergenic
971578325 4:28304508-28304530 TGTCCTCCTAGACCACAAAGAGG - Intergenic
971578339 4:28304593-28304615 ATTCCTCCTAGACCACAAGGAGG - Intergenic
972133439 4:35863623-35863645 TTTCCTCCTAGACCACAAAGAGG + Intergenic
973045706 4:45532862-45532884 TGTCCTCCTAGACCACAAGGAGG - Intergenic
974174343 4:58305848-58305870 TGTCCTCCTAGACCATGAGGAGG - Intergenic
974187158 4:58459583-58459605 AGCCCTCCTAGACCACCAGGAGG - Intergenic
974187172 4:58459668-58459690 TTTCCTCTCAGACCACAAGGAGG - Intergenic
974526401 4:63054341-63054363 TGTCCTCCTAGACCACAAAGAGG - Intergenic
974526414 4:63054426-63054448 TTTCTTCCTAGACCACAAGGAGG - Intergenic
974839000 4:67280803-67280825 TTTCCTCCCAGACCACAAAGAGG + Intergenic
974839017 4:67280888-67280910 TGTCCTCCTAGACCACAAGGAGG + Intergenic
975009175 4:69327531-69327553 TGTCCTTCTGGTCCAAAAGAGGG - Intronic
975047843 4:69826335-69826357 TGTCCTCCTAGACCACAAAAAGG - Intronic
975047856 4:69826420-69826442 TTTCCTCCTAGACCACAAGGAGG - Intronic
975596001 4:76048685-76048707 TTTCCTCCCAGACCACATGGAGG + Intronic
975596017 4:76048770-76048792 TGTCTTCCTAGACCACAAGGAGG + Intronic
976174459 4:82337453-82337475 TTTCCTCCTAGACCACAAGGAGG + Intergenic
976174484 4:82337620-82337642 TGTCCTCCTAGACCACAAAGAGG + Intergenic
977835063 4:101636692-101636714 TTTCCTCCTAGACCACAAGGAGG + Intronic
977835076 4:101636777-101636799 TGTCCTCCTAGACCACAAAGAGG + Intronic
977883929 4:102236723-102236745 TGCCCTCCTAGACCACAAAGAGG - Intergenic
980291049 4:130847716-130847738 TTTCCTCCTAGACCACAAGGAGG + Intergenic
980291063 4:130847801-130847823 TGTCCTCCTAGACCACAAAGAGG + Intergenic
982084836 4:151823913-151823935 TGTCCTCCTGGATCAAAAGTAGG - Intergenic
982464401 4:155712501-155712523 GATCATCCTGGACCACAAGAAGG - Intronic
982700959 4:158659392-158659414 TGTCCTCCTAGACCACAAAGAGG - Intergenic
982877136 4:160663770-160663792 TTTCCTCCTAGACCACAAGGAGG - Intergenic
983835090 4:172375756-172375778 TGTCCTCCTAGACCACAAAGAGG + Intronic
984917302 4:184736024-184736046 TTTCCTCCCAGACCACATGGAGG - Intergenic
987545402 5:19305885-19305907 TTTCCTCCTAGACCACAAGGAGG + Intergenic
987929717 5:24388526-24388548 TTTCCTCCTAGACCACAAGGAGG - Intergenic
988592178 5:32558364-32558386 TTTCCTCCCAGACCACAAGGAGG + Intronic
988605667 5:32676564-32676586 TTTCCTCCCAGACCACAAGGAGG + Intergenic
988605682 5:32676649-32676671 TGTCCTCCTAGACCACAAAGAGG + Intergenic
989496087 5:42112810-42112832 TGTCCTCCTAGACCACAAAGAGG - Intergenic
989496102 5:42112895-42112917 TTTCCTCCCAGACCACAAGGAGG - Intergenic
989957181 5:50371754-50371776 TATCCTCCTAGACCACAAGGAGG - Intergenic
990116567 5:52398716-52398738 TGTCCTCCTAGACCACAAAGGGG - Intergenic
990116579 5:52398801-52398823 TGTCCTCCTAGACCACAAAGGGG - Intergenic
990368036 5:55089757-55089779 TTTCCTCCTAGACCACAAGGAGG + Intergenic
990368050 5:55089842-55089864 TGTCCTCCTAGACCACAAAGAGG + Intergenic
992006536 5:72483826-72483848 TGTGCTCCTGGCCCTCAAGCAGG + Intronic
992049192 5:72927730-72927752 TGTCCTCCTAGTCCACAAGGAGG - Intergenic
992049208 5:72927815-72927837 TTTCCTCCCAGGCCACAAGGAGG - Intergenic
992455030 5:76908912-76908934 TGTCCTCCTAGACCACAAGAAGG - Intronic
992455041 5:76908997-76909019 TTTCCTCCTAGACCACAAGGAGG - Intronic
992476039 5:77102598-77102620 TGTCCTTCTGGAACCCAAGCTGG - Intergenic
995583593 5:113624381-113624403 TTTCCTCCCAGATCACAAGGAGG + Intergenic
995583607 5:113624465-113624487 TGTCCTCCTAGACCACAAAGAGG + Intergenic
995706199 5:114991405-114991427 TGTCCTCCTAGACCACAAGGAGG - Intergenic
995706212 5:114991490-114991512 TGTCCTCCTAGACCACAAAGAGG - Intergenic
995706227 5:114991575-114991597 TTTCCTCCCAGACTACAAGGAGG - Intergenic
996099391 5:119431350-119431372 TTTCCTCCTAGACCACAAGGAGG + Intergenic
996680210 5:126222795-126222817 TGTCCTCCTAGACCACAAAGAGG - Intergenic
996680225 5:126222880-126222902 TTTCCTCCCAGACCACAAGGGGG - Intergenic
996932400 5:128905692-128905714 TTTTCTCCTGTACCACAAGATGG + Intronic
997072230 5:130635014-130635036 TGTCCTCCTAGACCACAAAGAGG - Intergenic
997072243 5:130635099-130635121 TTTCCTCCTAGACCACAAGGAGG - Intergenic
997796970 5:136820097-136820119 TGTCCTCTGTGACCACATGGTGG + Intergenic
998111296 5:139504754-139504776 TGTCCTCCTAGACCACAAAGAGG - Intergenic
998111310 5:139504839-139504861 TTTCCTCCTAGACCACAAGGAGG - Intergenic
998914905 5:147002652-147002674 TTTCCTCCTAGACCACAAGGAGG - Intronic
1000085054 5:157881439-157881461 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1003805614 6:9723640-9723662 TATCCTCCTAGACCACAAAGAGG - Intronic
1003805627 6:9723725-9723747 TTTCCTCCTAGACCACAAGGAGG - Intronic
1004531220 6:16457274-16457296 TTTCCTCCTAGACCACAAAAAGG - Intronic
1004812077 6:19272723-19272745 TGTCGTCCTAGACCACAAAGAGG - Intergenic
1006221613 6:32496445-32496467 TGTTCTCCTAGACCACAAAGAGG - Intergenic
1006221628 6:32496530-32496552 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1006433483 6:34013314-34013336 TGTTCTCCTGGCACATAAGGAGG + Intergenic
1007029862 6:38617908-38617930 TTTCCTCTTAGACCACAAAGAGG - Intronic
1007029876 6:38617994-38618016 TTTCCTCCTAGACCACAAAGAGG - Intronic
1007244344 6:40449561-40449583 AGTCATCTTGGACCATAAGGTGG + Intronic
1007702478 6:43772981-43773003 ACTCCTCCTGGGCCCCAAGGAGG - Intronic
1007708424 6:43805875-43805897 TGTGGTCCTGGTTCACAAGGAGG + Intergenic
1007963978 6:45986539-45986561 TGTCCTTCTTGACCCCAAAGTGG - Intronic
1008587162 6:52960546-52960568 TTTCCTCCCAGACCACATGGAGG + Intergenic
1008587179 6:52960631-52960653 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1009386086 6:63085213-63085235 TTTCCTCGTAGACCACAAAGAGG + Intergenic
1009407870 6:63331726-63331748 TTTCCTCCCAGACCACATGGAGG + Intergenic
1009407888 6:63331811-63331833 TGTCCTCCTAGACCACAGGGAGG + Intergenic
1009470624 6:64026047-64026069 TTTCCTCCCGGACCACATGGAGG - Intronic
1009872614 6:69469636-69469658 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1010074789 6:71787060-71787082 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1010269656 6:73905300-73905322 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1010269669 6:73905385-73905407 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1011375201 6:86679883-86679905 TTTGCTCCTAGACCACAAGGAGG + Intergenic
1013908010 6:115239641-115239663 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1013908025 6:115239726-115239748 TGTCATCCTAGACCACAAAAAGG + Intergenic
1013977247 6:116092509-116092531 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1013977261 6:116092594-116092616 TTTCCTCCTACACCACAGGGAGG - Intergenic
1014258637 6:119189796-119189818 GGGCCTCCTGGAGCACAAGATGG - Exonic
1015780859 6:136863944-136863966 TGTCGTCCAGCAACACAAGGAGG + Intronic
1016183846 6:141177580-141177602 TGGCCTCCTAGACCACAAAGAGG - Intergenic
1016183863 6:141177665-141177687 TTTCCTCCCAGACCACAGGGAGG - Intergenic
1018587491 6:165377904-165377926 CCTCTTCCTGGACCACAAAGAGG - Intronic
1018633028 6:165836697-165836719 TGTCCTCCTGGAGCTGAAAGTGG + Intronic
1018913012 6:168115040-168115062 TGGTCTCCTGGATCACAAGGTGG - Intergenic
1019602906 7:1894216-1894238 TGTCTTCTTGGAACCCAAGGGGG + Intronic
1021356754 7:19659601-19659623 TTTCCTCCTAGACCACAAAGAGG + Intergenic
1021756899 7:23860659-23860681 TTTCCTCCTAGACCCCAAGGAGG + Intergenic
1023078122 7:36503253-36503275 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1023151213 7:37203099-37203121 TTTCCTCCCAGACCACAAGGAGG + Intronic
1023151227 7:37203183-37203205 TGTCCTCCTAGACCACAAAGAGG + Intronic
1024735114 7:52296311-52296333 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1024870946 7:53961262-53961284 TTTCCTCTGAGACCACAAGGAGG + Intergenic
1025209342 7:57011897-57011919 TGCCCACCTGGACCCCAGGGAGG + Intergenic
1025535767 7:61946287-61946309 TTTCCTCCTAGACCACAATGAGG - Intergenic
1025662603 7:63564957-63564979 TGCCCACCTGGACCCCAGGGAGG - Intergenic
1026152262 7:67798204-67798226 TCTTCTCCTTGACCAGAAGGGGG - Intergenic
1026287036 7:68972371-68972393 TGGCCTCCTCGACAACAGGGAGG + Intergenic
1027790944 7:82638508-82638530 TGTCTTCCTAGACCACAAAGAGG - Intergenic
1027790957 7:82638593-82638615 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1028495397 7:91454908-91454930 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1028495406 7:91454993-91455015 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1030420338 7:109300614-109300636 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1030627419 7:111859256-111859278 TATCCTACTGGTCCACAGGGTGG - Intronic
1033759409 7:144423338-144423360 TTTCCTCCCAGACCACATGGAGG + Intergenic
1033759425 7:144423423-144423445 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1034580152 7:152034781-152034803 TTTCCTCCTAGACCACAAGGAGG + Intronic
1034580167 7:152034866-152034888 TGTCCTCCTAGACCACAAAGAGG + Intronic
1034759480 7:153657985-153658007 TGTCCTCCTGGCCCAGCAGACGG + Intergenic
1035036983 7:155901930-155901952 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035037000 7:155902007-155902029 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035037017 7:155902084-155902106 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035130887 7:156651976-156651998 TGTCTCCCTGGACCTCATGGCGG + Intronic
1035721493 8:1796642-1796664 TGTCCTCCTGGACCAGGTGTTGG + Intergenic
1035731944 8:1859819-1859841 TGCCCTCCTGGAGCGCAAGTGGG - Intronic
1036437023 8:8743845-8743867 TGTCCTTCTGGCCCACAGTGAGG - Intergenic
1037897477 8:22667682-22667704 TGGCCTCCTGGAGCAAATGGTGG + Intronic
1038638615 8:29306476-29306498 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1038638629 8:29306561-29306583 TTTCCTCCCAGACCACATGGAGG - Intergenic
1039275828 8:35933470-35933492 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1039275840 8:35933555-35933577 TTTCCTCCTAGACTACAAAGAGG - Intergenic
1039693335 8:39883908-39883930 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1039693352 8:39883993-39884015 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1039766554 8:40634275-40634297 TTTCTTCCTGGTCCACAAGTAGG + Intronic
1039821589 8:41140029-41140051 TGCTCTCCCTGACCACAAGGAGG + Intergenic
1039999863 8:42566725-42566747 TTTCCTCCTAGACTATAAGGAGG + Intergenic
1040527006 8:48234379-48234401 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1040648894 8:49428520-49428542 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1040648906 8:49428605-49428627 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1040668023 8:49655422-49655444 TTTCCTCCCAGACCACAAGGAGG + Intergenic
1040668040 8:49655507-49655529 TATTCTTCTAGACCACAAGGAGG + Intergenic
1040796947 8:51297682-51297704 TTTCCTCCTAGACCACAAAGAGG + Intergenic
1040796963 8:51297767-51297789 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1040953216 8:52956137-52956159 TGTCCTCCTATACCACATGGAGG - Intergenic
1040953231 8:52956222-52956244 TTTCCTCCCAGACCACATGGAGG - Intergenic
1040965225 8:53075594-53075616 TTTCCTCCCAGACCACAAGGAGG + Intergenic
1040965242 8:53075679-53075701 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1040971626 8:53141983-53142005 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1040971641 8:53142068-53142090 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1041000097 8:53441357-53441379 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1041001724 8:53461002-53461024 TGTCCTCCTAGACCACAAAAAGG - Intergenic
1041001741 8:53461087-53461109 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1042678386 8:71349155-71349177 TGTGCACCTGGACCACAGGAAGG + Intronic
1042771742 8:72389454-72389476 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1042771757 8:72389539-72389561 TTTCCTCCTAGACCACAAAGAGG - Intergenic
1043256902 8:78149195-78149217 TTTCCTCCTAGACAACAAGGAGG - Intergenic
1044005593 8:86932929-86932951 TTTCCTCCTAGATCACAAAGAGG + Intronic
1044005607 8:86933014-86933036 TTTCCTCTTAGACCACAAAGAGG + Intronic
1044011471 8:86999221-86999243 TCTCCTTCTGGACCCCAAGAGGG - Intronic
1044456792 8:92399385-92399407 TTTCCTCCCAGACCACAAAGAGG + Intergenic
1044456808 8:92399470-92399492 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1045858381 8:106790067-106790089 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1048337083 8:133510807-133510829 GGTCCTCCTGTACCCCATGGTGG + Intronic
1050935150 9:11386859-11386881 AGTCCTCCTGGACAACTAGCTGG - Intergenic
1051935082 9:22435955-22435977 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1051935095 9:22436040-22436062 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1051935111 9:22436125-22436147 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1052057947 9:23924370-23924392 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1052057962 9:23924455-23924477 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG + Exonic
1053532513 9:38896638-38896660 TTTCCTCCTATACCACAAAGAGG + Intergenic
1054204738 9:62121059-62121081 TTTCCTCCTATACCACAAAGAGG + Intergenic
1054633621 9:67467299-67467321 TTTCCTCCTATACCACAAAGAGG - Intergenic
1055458459 9:76494243-76494265 TATTCTCCTGGGCCACAAAGAGG + Intronic
1056331846 9:85527808-85527830 TGTCTTCCTGAAACACAATGTGG + Intergenic
1056392962 9:86155767-86155789 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1056392977 9:86155852-86155874 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1056832292 9:89927046-89927068 TGCCCTCCTGGTTCCCAAGGTGG + Intergenic
1061761390 9:132854390-132854412 CGGCCTCCTGGGGCACAAGGAGG - Intronic
1061958131 9:133974191-133974213 TGTCCTCCTGGGCCGCAAGCAGG + Intronic
1062537563 9:137027642-137027664 TCTCCTCCGGGACCCCAGGGAGG + Exonic
1062567984 9:137171702-137171724 TGCCCGCCAGCACCACAAGGAGG + Exonic
1062598164 9:137308348-137308370 TGGCCTCCTGGGCTTCAAGGAGG - Intronic
1185941294 X:4322620-4322642 TGTATTCCTGGACCACAATGAGG - Intergenic
1186522126 X:10214967-10214989 AGTCCTGCTGGGCCTCAAGGTGG + Intronic
1187245119 X:17547014-17547036 ACTCCTCCTGGACCCCAGGGAGG - Intronic
1188136328 X:26498892-26498914 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1189322834 X:40096937-40096959 TCTCCTCCTGGCCCACCGGGAGG + Intronic
1190541263 X:51481044-51481066 TGTCCTGCTAGACCACAAAGAGG - Intergenic
1190541278 X:51481129-51481151 TTTCCTCTTAGACCACAAGGAGG - Intergenic
1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG + Intronic
1191206117 X:57835499-57835521 TTTCCTCCTAGACCACAAGAAGG + Intergenic
1192482948 X:71500634-71500656 TTTCCTCTTAGACCACAAAGAGG + Intronic
1192870208 X:75177331-75177353 TTTCCTCCCAGACCACATGGAGG + Intergenic
1192870225 X:75177416-75177438 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1195439373 X:104884085-104884107 TGTCCTCCTAGACCACAAAGAGG - Intronic
1195439386 X:104884170-104884192 TGTCCTCCTAGACCACAAAGAGG - Intronic
1195439398 X:104884255-104884277 TTTCCTCCTAGACCACAAGGAGG - Intronic
1195491919 X:105480610-105480632 TTTTATCCTGGACCTCAAGGGGG - Intronic
1195552561 X:106185515-106185537 TTTCCTCCTAGACCACAAGGAGG + Intronic
1195552575 X:106185600-106185622 TGTCCTCATAGAACACAAAGAGG + Intronic
1196419589 X:115508229-115508251 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1196488798 X:116244917-116244939 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1196488811 X:116245002-116245024 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1196662128 X:118280418-118280440 TTTCCTCCCAGACCACATGGAGG + Intergenic
1196662145 X:118280503-118280525 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1197513230 X:127396526-127396548 TTCCCTCCTAGACCACAAGGAGG - Intergenic
1199832577 X:151560629-151560651 TTTCCTCCCAGACCACATGGAGG + Intergenic
1199832593 X:151560714-151560736 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1200695128 Y:6351939-6351961 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1200711094 Y:6485698-6485720 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1200711107 Y:6485783-6485805 TTCCTTCCTAGACCACAAGGAGG - Intergenic
1200801182 Y:7388372-7388394 TTTCCTCCTAGACCACAAGGTGG + Intergenic
1200880963 Y:8210886-8210908 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1200959179 Y:8981567-8981589 TTTCCTCCCAGACCACAAGGAGG - Intergenic
1200966597 Y:9044743-9044765 TTTCCTCCTAGACCACAAACAGG - Intergenic
1201022828 Y:9676203-9676225 TTCCTTCCTAGACCACAAGGAGG + Intergenic
1201022840 Y:9676288-9676310 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1201040149 Y:9822771-9822793 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201272097 Y:12265278-12265300 TTTCCTCCTAGACCACAAGATGG + Intergenic
1201272108 Y:12265363-12265385 TGTCCTCTTAGACCACAAAGAGG + Intergenic
1201312216 Y:12607201-12607223 TTTCCTCCTAGACCACAAAGAGG + Intergenic
1201312228 Y:12607286-12607308 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1201403595 Y:13629230-13629252 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201403607 Y:13629315-13629337 TTTCCTCCCAGACCACATGGAGG - Intergenic
1201407668 Y:13664839-13664861 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1201429509 Y:13890367-13890389 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1201487391 Y:14507737-14507759 TGTCCTCCAAGACCACAAGGAGG - Intergenic
1201487404 Y:14507822-14507844 TTTCCTCCCAGACCACAGGGAGG - Intergenic
1201496566 Y:14595819-14595841 TTTCCTCCCAGACCACATGGAGG + Intronic
1201496581 Y:14595904-14595926 TGTCCTCCTAGACCACAAGGAGG + Intronic
1201516119 Y:14820121-14820143 TTTCCTCCTAGATCATAAGGAGG + Intronic
1201516130 Y:14820206-14820228 TTTCCTCTTAGACCACAAAGAGG + Intronic
1201555561 Y:15262224-15262246 TGTTCTCCTAGACCACAAGGAGG - Intergenic
1201555576 Y:15262309-15262331 TTTCCTCCCAGACCACATGGAGG - Intergenic
1201568727 Y:15392240-15392262 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1201568741 Y:15392325-15392347 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1201631086 Y:16072674-16072696 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201631098 Y:16072758-16072780 TTTGCTCCTAGACCACAAGGAGG - Intergenic
1201649077 Y:16265480-16265502 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1201653732 Y:16319820-16319842 TTTCCTCCTAGACCACAAGGAGG - Intergenic
1201729738 Y:17191065-17191087 TTTCCTCCCAGAACACAAGGAGG + Intergenic
1201744153 Y:17352435-17352457 TGTCCTGCTAGACCACAAAGAGG + Intergenic
1201908375 Y:19107767-19107789 TTTCCTCCTAGAACACAAAGAGG + Intergenic
1201989684 Y:20009989-20010011 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1202074861 Y:21027542-21027564 TTTCCTCCCAGATCACAAGGAGG + Intergenic
1202074874 Y:21027627-21027649 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1202146857 Y:21807433-21807455 TTTCCTCCTAGACCACAAAGAGG + Intergenic
1202146874 Y:21807518-21807540 TGTCCTCCTTGACCACAAAGGGG + Intergenic
1202192780 Y:22261353-22261375 TTTCCTCCTAGACCACAAGGAGG + Intergenic
1202242699 Y:22787570-22787592 TGTCCTCCTAGCCCACAAGGAGG - Intergenic
1202242713 Y:22787655-22787677 TTTCCTCCAAGACCACAAGGAGG - Intergenic
1202257669 Y:22938553-22938575 TGTCCACCCAGACCACAAAGAGG - Intergenic
1202272258 Y:23083505-23083527 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1202293768 Y:23337177-23337199 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1202395686 Y:24421320-24421342 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1202395700 Y:24421405-24421427 TTTCCTCCAAGACCACAAGGAGG - Intergenic
1202410659 Y:24572300-24572322 TGTCCACCCAGACCACAAAGAGG - Intergenic
1202425255 Y:24717249-24717271 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1202445534 Y:24952836-24952858 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1202460122 Y:25097772-25097794 TGTCCACCCAGACCACAAAGAGG + Intergenic
1202475085 Y:25248687-25248709 TTTCCTCCAAGACCACAAGGAGG + Intergenic
1202475099 Y:25248772-25248794 TGTCCTCCTAGACCACAAGGAGG + Intergenic