ID: 1105764664

View in Genome Browser
Species Human (GRCh38)
Location 13:23547203-23547225
Sequence TGCAGGAACGGAGGCACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105764661_1105764664 -7 Left 1105764661 13:23547187-23547209 CCTGGCGCTCAGCAAGTGCAGGA 0: 1
1: 0
2: 1
3: 8
4: 162
Right 1105764664 13:23547203-23547225 TGCAGGAACGGAGGCACCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105764664 Original CRISPR TGCAGGAACGGAGGCACCGC AGG Intergenic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901955019 1:12777713-12777735 TGCAGGAAGGGAGGGACTGGGGG + Exonic
902238825 1:15074796-15074818 TGAAGAAACGAAGGCACAGCAGG - Intronic
902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG + Intergenic
903848011 1:26289958-26289980 TGCAGGAAAGGAGGCCCTGCAGG + Intronic
906822744 1:48946513-48946535 TGCAGAAACTGAGGCACAGAGGG - Intronic
907318975 1:53590920-53590942 TGCCGGAGCAGAGGCTCCGCTGG + Intronic
910930509 1:92438627-92438649 TGAAGAAACTGAGGCACGGCCGG - Intergenic
913454676 1:119019069-119019091 TGCAGGACAGGAGGCATGGCGGG - Intergenic
913461538 1:119091355-119091377 TGAAGGAACTGAGGCACAGAAGG + Intronic
916455584 1:164968285-164968307 TGCAGGAAGGGAGGAAATGCAGG - Intergenic
918250400 1:182698393-182698415 TGCAGAAACTGAGGCACGGCAGG - Intergenic
918344295 1:183592866-183592888 TGCAGGAATGAAGGCATAGCGGG - Intronic
920228225 1:204453290-204453312 TGCTTGAATGGGGGCACCGCAGG - Intronic
923054763 1:230417690-230417712 TGGAGGAAGTGAGGCACCTCTGG + Intronic
1068745913 10:60530528-60530550 TGCAGCAAATGAGGCACCTCAGG + Intronic
1069900416 10:71703683-71703705 TGAAGAAACTGAGGCACAGCGGG - Intronic
1076217790 10:128710373-128710395 TGCAGCTCCGGAGGCCCCGCCGG + Intergenic
1077210650 11:1369659-1369681 TGCAGGAAGGGAGGCAATGGTGG + Intergenic
1077373298 11:2193679-2193701 GGCAGGAATGGAGGCACCATCGG + Intergenic
1081669519 11:44935215-44935237 GGCAGGAACTGGGGCACAGCAGG + Intronic
1083340458 11:61955628-61955650 TGGAGGAGCCGAGGCATCGCCGG + Intronic
1083744069 11:64725668-64725690 TGCAGGGATGGAGGCAGCACAGG + Intergenic
1083935120 11:65865962-65865984 TGCAGGAAGAGAGGCAGCGAGGG - Intronic
1084680044 11:70661807-70661829 TGGAGGAAAGGAGGCAGCGAGGG + Exonic
1085561528 11:77476307-77476329 TGCGGGAACTGAGGCACAGAGGG + Intergenic
1087131263 11:94671476-94671498 TGCAGCAGGGGAGGCACAGCAGG + Intergenic
1089013041 11:115145902-115145924 TGCAGGCACTGAGGCAGCGGTGG - Intergenic
1089360182 11:117880383-117880405 GGCAGGAAAGGAGGCACTGGGGG - Intergenic
1092431217 12:8410431-8410453 TGCAGGACTGGAGGCACAGACGG + Intergenic
1103210950 12:119166014-119166036 TGCAGAAACTGAGGCACAGACGG + Intergenic
1105764664 13:23547203-23547225 TGCAGGAACGGAGGCACCGCAGG + Intergenic
1105776672 13:23668687-23668709 TGCAGAAACGCAGGCCCAGCCGG + Exonic
1106199190 13:27522264-27522286 TGCAGGAAAGGACGCTCAGCTGG + Intergenic
1106406142 13:29475972-29475994 TGCAGGACTGGAGGCTCCTCTGG - Intronic
1107116531 13:36753202-36753224 TCCAGGAAAGGAGGCACTGAGGG - Intergenic
1107421664 13:40253473-40253495 TGCAGGAACTGAGGCTCCATTGG - Intergenic
1108449041 13:50541829-50541851 TGCAGGAACTGAGGCACAAGAGG + Intronic
1109683654 13:65784665-65784687 TGCAGCAGGGGAGGCACGGCAGG - Intergenic
1113175801 13:107562449-107562471 AGCAGGAGAGGAGGCACAGCAGG - Intronic
1114367647 14:22046988-22047010 TTCAGGAAAGGAGGCATAGCTGG - Intergenic
1116790114 14:49330488-49330510 TGCAGCAGGGGAGGCACAGCTGG - Intergenic
1122425014 14:101600879-101600901 TGCAGGAAAGGAGGCATCACAGG - Intergenic
1123100135 14:105792045-105792067 TGCAGGAACAGAGGCTCCTTGGG - Intergenic
1128335578 15:66783832-66783854 GGCAGGACGGGAGGCACCTCAGG + Intergenic
1132089393 15:98935657-98935679 TGCAGGAACAAAGGCACAGAGGG - Intronic
1132682131 16:1146756-1146778 TGCAGAGACGGCTGCACCGCTGG - Intergenic
1135415905 16:22267752-22267774 TGCAGGAGCTGAGGCAGAGCTGG + Intronic
1138537900 16:57669442-57669464 TGAATGAACGGAGCCACCGATGG + Intronic
1142200773 16:88760148-88760170 TGAGGGCACGGAGGCCCCGCCGG - Intronic
1142200995 16:88761113-88761135 TGCAGGAACAGAGGGTCAGCAGG + Intronic
1143171996 17:4935747-4935769 TGGAGGAGAGGAGGCACCCCAGG - Intergenic
1145264863 17:21374906-21374928 TGAAGGAACTGAGGCACAGAGGG - Intergenic
1146398333 17:32486183-32486205 TGAGGGAACGGAGGCCCCGGAGG + Intergenic
1148147076 17:45372778-45372800 TGCGGGAACTGAGGCACAGAAGG - Intergenic
1148725737 17:49788764-49788786 AGCAGGAACGGTGGCTCCGGCGG - Exonic
1148837194 17:50471630-50471652 AGCAGGAAAGGAGGCATGGCTGG - Intronic
1150135065 17:62690925-62690947 TGCAGGAAAGAAGGCACTGAGGG - Intronic
1151906870 17:77054512-77054534 TGCAGGAACGAAGCCCCTGCAGG - Intergenic
1153818662 18:8813229-8813251 AGCAGGTAAGGAGGCACCCCGGG + Exonic
1154214846 18:12408256-12408278 TGCAGGCACAGAGGCCCCGCTGG + Intronic
1160083704 18:75754358-75754380 TGCAGCAGGGGAGGCACAGCTGG - Intergenic
1160585539 18:79911573-79911595 TGCAGGCACGGAGCCATCACTGG + Intronic
1162004272 19:7767308-7767330 TGCAGGCACGCATGCACAGCTGG - Intronic
1162572830 19:11482596-11482618 AGCAGGAACTGAGGCATAGCTGG + Intronic
1162757839 19:12870952-12870974 TGCAGGGAAGGAGGCACCCTGGG + Intronic
1163008345 19:14410084-14410106 GGGAGGAAAGGAGGCTCCGCCGG + Intronic
1164702655 19:30296765-30296787 TGGAGGAAGGGAGGCACAGATGG + Intronic
1165351232 19:35277097-35277119 TCCAGGCCTGGAGGCACCGCTGG - Intronic
1165525014 19:36347072-36347094 TGCAGGCAAGGAGGAACTGCTGG + Intronic
1166856695 19:45785891-45785913 TGCAGGAGCGGCGGGACCGGGGG - Exonic
1167214998 19:48158658-48158680 TGCATGACTGGAGGCACAGCCGG + Intronic
1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG + Intergenic
925169692 2:1743531-1743553 TGCGGGAACTGAGGCTCCTCTGG + Intronic
926394023 2:12423318-12423340 TGCAGGATAGGAGGCATGGCTGG - Intergenic
928561043 2:32485488-32485510 TGCAGTATCGGAGCCACAGCAGG - Intronic
930105202 2:47633781-47633803 TGCTGGAATGGAGGCAGCTCTGG - Intergenic
932617117 2:73239826-73239848 TGCAGGAAAGGAGGCTCCTGAGG + Intronic
933811895 2:86037860-86037882 TGCAGGAATGGAGGCCCGGGGGG - Intronic
935616089 2:105083355-105083377 TGCAGGAAAGGAGGTAACCCTGG - Intronic
935645487 2:105330200-105330222 TGGAGGATCGGACGTACCGCCGG + Intergenic
940068470 2:149656029-149656051 TGCAGCAACGCAGGTGCCGCTGG - Intergenic
943345782 2:186735134-186735156 TGCAGCAGGGGAGGCACAGCTGG - Intronic
947077992 2:226365120-226365142 GGCAGGAACTGAGGCACCACTGG - Intergenic
948862019 2:240757235-240757257 TGCGGGCACAGAGGAACCGCTGG - Intronic
1168911231 20:1448749-1448771 TGAAGAAACTGAGGCACAGCAGG + Intronic
1174068110 20:47880049-47880071 TGCAGGAACTGACTCAGCGCAGG - Intergenic
1176139627 20:63539288-63539310 TCCGAGAACGGAGGCAGCGCGGG - Intergenic
1179785423 21:43727355-43727377 GGCAGGAAGGGAGGCGCTGCCGG - Intronic
1180059130 21:45375634-45375656 GGCAGGAGCAGAGGCACTGCAGG + Intergenic
1180059141 21:45375673-45375695 GGGAGGAGCAGAGGCACCGCAGG + Intergenic
1180677583 22:17598392-17598414 TAAAAGAACAGAGGCACCGCTGG + Intronic
1180932905 22:19605693-19605715 CGCAGGAAGGGAGGGAACGCAGG - Intergenic
1181853575 22:25767155-25767177 TGCAGAGATGGAGGCACAGCTGG + Intronic
949895684 3:8766326-8766348 TGGAGGAACAGAGGCACCCTAGG - Intronic
953774794 3:45807256-45807278 TCCAGGATCGGAGGAACTGCTGG + Intergenic
954450165 3:50567415-50567437 TGCAAGAAGGGAGGCATCACAGG - Intronic
957776008 3:84757541-84757563 TGCAGGGAGGGAGGCACAGCTGG - Intergenic
965206284 3:165721395-165721417 TGCAGCAGGGGAGGCACAGCTGG - Intergenic
968045973 3:195624161-195624183 TGCAGGAACGGAGGGGGGGCGGG - Intergenic
968236836 3:197036865-197036887 TGCAGGAACTCAGGCACCAAGGG + Intergenic
968308681 3:197665926-197665948 TGCAGGAACGGAGGGGGGGCGGG + Intergenic
968879560 4:3292301-3292323 GGCGGGACCGGAGGCACCGCTGG - Intergenic
969114093 4:4860450-4860472 TGCAGGTACGCAGGCGCCGGAGG - Intronic
969716292 4:8869853-8869875 TGCAGGAGGGGATGCACCCCAGG + Intronic
975671576 4:76786193-76786215 TGTAGGAAGGGAGGTACAGCAGG + Intergenic
978873358 4:113607441-113607463 TGGAGCAACTGAGGAACCGCAGG + Intronic
981835712 4:149050984-149051006 TGCAGCAAGGGAGGCAGAGCAGG - Intergenic
982802733 4:159723629-159723651 TGCAGCAGGGGAGGCACCGCTGG - Intergenic
985493371 5:191834-191856 TGCAGGACCGGAGCCGCCGGCGG + Exonic
985749776 5:1667458-1667480 TGCAGGACCGCGGGCGCCGCCGG + Intergenic
986130278 5:4923656-4923678 TGCAGGAAGGGAGACCCCACAGG + Intergenic
988563112 5:32298542-32298564 TGCAGGAAGGGAGGCCCTCCAGG + Intronic
991473020 5:66989496-66989518 TTCAGGAATGGAGGCACAGCAGG + Intronic
993901765 5:93588646-93588668 TGCGGGAACCGAGGCGGCGCGGG + Intronic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1004170156 6:13289354-13289376 TGCTGGAAAGGAGGCCCTGCAGG - Exonic
1006375093 6:33667648-33667670 TCCAGGAAAGGAAGCATCGCTGG - Intronic
1006932997 6:37698675-37698697 TGCAGGACCCCAGGAACCGCAGG - Intronic
1007859997 6:44898660-44898682 TGCAAGAATGCAGGCACCTCAGG - Intronic
1015881573 6:137875237-137875259 TACAGGAACGGATCCACAGCTGG - Intronic
1018646450 6:165953135-165953157 TGCAAGAACAGAGGCACTGAGGG - Intronic
1019194490 6:170273241-170273263 TGCAGCAAGGGAGGCAGAGCTGG - Intergenic
1022526911 7:31044134-31044156 TGAAGGAACTGAAGCACAGCAGG + Intergenic
1024254294 7:47528297-47528319 TGCAGGGAAGGAGGCACTGAGGG + Intronic
1032256287 7:130299682-130299704 TGAAGAAACGGAGGCTCAGCGGG - Intronic
1034969897 7:155412448-155412470 TGGAGAAACAGAGGCACAGCAGG + Intergenic
1035023079 7:155810033-155810055 CGCGGGAGCGCAGGCACCGCAGG - Intronic
1035222451 7:157414233-157414255 TGCTGAAGCGGAGGAACCGCAGG + Intronic
1035758442 8:2051473-2051495 TGAAGGGAGGGAGGGACCGCGGG + Intronic
1036996396 8:13662164-13662186 TGCAGAAAAGCAGGCACCGTAGG - Intergenic
1038055593 8:23854692-23854714 AGCAGCAGCGGAGGCACCGGTGG - Exonic
1038446902 8:27610803-27610825 TGCAGGGAGGGAGGGACTGCAGG + Intronic
1039882469 8:41633494-41633516 TGCTGGAAAGAAGGCAACGCTGG - Intergenic
1039914722 8:41851490-41851512 TGCAGGAAGTGAGGCCCAGCAGG - Intronic
1041203339 8:55472811-55472833 TGAGGAAACGGAGGCACCACAGG + Intronic
1044248967 8:89984428-89984450 GGCAGGAACGGACGCGACGCAGG + Intronic
1049358671 8:142201396-142201418 TGCAGCCACGGAGGCCTCGCCGG - Intergenic
1049789957 8:144467998-144468020 TGCAGGAACGGCTGCAGCTCGGG - Intronic
1050282555 9:4066312-4066334 TCCAGGCAGGGAGGCACCGTGGG + Intronic
1053614048 9:39745124-39745146 TGCAGCAGGGGAGGCGCCGCAGG - Intergenic
1053872077 9:42503062-42503084 TGCAGCAGGGGAGGCGCCGCAGG - Intergenic
1054239468 9:62597269-62597291 TGCAGCAGGGGAGGCGCCGCAGG + Intergenic
1054260972 9:62864644-62864666 TGCAGCAGGGGAGGCGCCGCAGG - Intergenic
1054553600 9:66631796-66631818 TGCAGCAGGGGAGGCGCCGCAGG + Intergenic
1055275070 9:74606046-74606068 TGAAGAAACTGAGGCACAGCAGG - Intronic
1056515277 9:87343899-87343921 CCCAGGAAAGGAGTCACCGCTGG - Intergenic
1057171600 9:92966327-92966349 TGTGGGGACGGAGGCACCACGGG - Intronic
1060670674 9:125466695-125466717 TGCAGGGTCGGAGGCCTCGCTGG + Intronic
1061289362 9:129641986-129642008 TGCAGGAACGGCATCGCCGCGGG + Exonic
1061744693 9:132730895-132730917 TGCAGGATCGGGGGCAGCCCCGG - Intronic
1062554110 9:137106343-137106365 TGCGGGAACGGGGGAGCCGCGGG - Intronic