ID: 1105767321

View in Genome Browser
Species Human (GRCh38)
Location 13:23574734-23574756
Sequence CTCTGTGATGGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 566}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105767309_1105767321 22 Left 1105767309 13:23574689-23574711 CCCCTTTAAAGGATGGTTCTTTA 0: 1
1: 0
2: 2
3: 38
4: 258
Right 1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 46
4: 566
1105767311_1105767321 20 Left 1105767311 13:23574691-23574713 CCTTTAAAGGATGGTTCTTTAAA 0: 1
1: 0
2: 4
3: 18
4: 250
Right 1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 46
4: 566
1105767314_1105767321 -10 Left 1105767314 13:23574721-23574743 CCACCTGGGTGAGCTCTGTGATG 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 46
4: 566
1105767310_1105767321 21 Left 1105767310 13:23574690-23574712 CCCTTTAAAGGATGGTTCTTTAA 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG 0: 1
1: 0
2: 2
3: 46
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105767321 Original CRISPR CTCTGTGATGGGAGGGCAGA GGG Intronic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901408916 1:9069376-9069398 CTCTGTGTTGGGAGGGATTATGG - Intronic
901758088 1:11453554-11453576 GTGGGTGATGGGAGGGGAGAGGG + Intergenic
902084516 1:13848748-13848770 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
902801563 1:18833188-18833210 CTCTGTGATGGGGTGGCTCATGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905178168 1:36150861-36150883 CTCTGTCCTGGGAATGCAGAGGG - Intronic
905226054 1:36480079-36480101 CCCTTGGATGGGAGGGAAGATGG + Intronic
905238427 1:36566205-36566227 CACTCTGATGGGAGGGCCCAAGG - Intergenic
905409214 1:37756725-37756747 CCCTGTGATGGGGTGGCACAAGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905768249 1:40621146-40621168 TTCTCTGATGGGAGGAGAGAGGG - Exonic
905880216 1:41458178-41458200 CTCTGCGATGGGAGAGGAGGAGG + Intergenic
906040904 1:42787087-42787109 CTCTGTGATGGTAGGGACCAAGG + Intronic
906096691 1:43228887-43228909 TCATGTGATGGGAGGGCAAAAGG + Intronic
906637591 1:47419437-47419459 CTCTTTGAGGGGAGGGCAGTAGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
908646264 1:66281330-66281352 TTCTGTGCTGCGAGAGCAGAGGG + Intronic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
908967833 1:69787419-69787441 CTCTGCGAGGGCAGTGCAGAGGG - Intronic
909177624 1:72380619-72380641 CTCTGCGAGGGCAGTGCAGAAGG - Intergenic
909504870 1:76377414-76377436 AACTGTGGTGGGAGGGCAAAGGG + Intronic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
910029592 1:82702637-82702659 CTCTGAGAGGGTAGGGCAGGAGG - Intergenic
911077363 1:93890258-93890280 TTGTGTGATGGTAGGACAGAAGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912755828 1:112324286-112324308 ATCTGTGATGGGATGGGAGTAGG + Intergenic
913307805 1:117450901-117450923 CTCTGCTAGGGGAGGGCCGAAGG + Intronic
913338430 1:117732918-117732940 CTCTGTGAGGTGAAGGCAGTGGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915624515 1:157106537-157106559 CTCTGTGTTGGGGGGACAAAGGG - Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
916622106 1:166510524-166510546 CGCTGTGATAGGCAGGCAGAGGG - Intergenic
916686539 1:167152330-167152352 CTCTGCGGTGGGAAGGGAGAAGG - Intergenic
917035433 1:170742970-170742992 CTCTGCGAGGGCAGTGCAGAAGG - Intergenic
917680068 1:177356479-177356501 TTCTGTAATAGGTGGGCAGAGGG - Intergenic
918085454 1:181241042-181241064 TGCTGTGAGGGGAGAGCAGAGGG + Intergenic
918167592 1:181965278-181965300 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919376096 1:196796457-196796479 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
919385800 1:196921346-196921368 CTCTGCTATGGCAGTGCAGAAGG + Intronic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
920351790 1:205342885-205342907 CTCTGAGATTGGGAGGCAGAGGG + Intronic
920383766 1:205552384-205552406 CTATGTGGCGGAAGGGCAGAGGG + Intergenic
920687544 1:208120810-208120832 GTCTGTGAGGGGAGGTCAGAGGG + Intronic
920895911 1:210049264-210049286 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
921275071 1:213511302-213511324 CTCTCTGAGGGCAGGGGAGATGG + Intergenic
921472826 1:215568264-215568286 TTCTGTGATGGGAGTGCAGTAGG + Intronic
923000846 1:230005214-230005236 CCTCATGATGGGAGGGCAGAAGG - Intergenic
923336749 1:232977436-232977458 CACTGTGATGGGAGCAGAGATGG + Intronic
923986756 1:239390546-239390568 CTCCGTGGAGGGTGGGCAGAGGG - Intronic
1063121448 10:3107705-3107727 CTGGGTTATGGGAGGGCACAGGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064265204 10:13820385-13820407 CTCTGGGCTGGGAAGGCAGGCGG + Intronic
1066311409 10:34200565-34200587 CCATGTGATGGATGGGCAGAGGG - Intronic
1067092707 10:43277431-43277453 CTTTATGATGGGAAGGAAGAAGG - Intergenic
1067145416 10:43690221-43690243 CTCTGGGCTGGGCCGGCAGAGGG + Intergenic
1067540312 10:47146066-47146088 CTCTGTCATAGCATGGCAGAAGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067573181 10:47386458-47386480 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1067727033 10:48778276-48778298 TTATGTGATGGGAGGGCACATGG + Intronic
1068374813 10:56164895-56164917 CTCTGCGAGGGTAGTGCAGAAGG + Intergenic
1069560872 10:69428416-69428438 CTCAGTGGAGGGAGGGCAGTTGG - Intergenic
1069616833 10:69811557-69811579 CTGTGACATGGGAGGTCAGAGGG + Intronic
1070379715 10:75869750-75869772 CCCTGAGATGGAAGGGGAGATGG - Intronic
1070423821 10:76265467-76265489 CTCTGTCCTGGGAGGACACAGGG + Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1070870098 10:79743973-79743995 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1071229918 10:83573605-83573627 CTGTGTGATGGGAAGGCACCTGG - Intergenic
1071245018 10:83752735-83752757 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071327806 10:84534295-84534317 CTCTGTGAGGGCAGTGCAGAAGG + Intergenic
1071576360 10:86729636-86729658 CCCTGTGCTGGGTGGGCAGAAGG + Intronic
1071637019 10:87266193-87266215 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1071658224 10:87471761-87471783 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1072281972 10:93873881-93873903 CTCAGTCAGGGGAGGTCAGAGGG + Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073434537 10:103508226-103508248 TTCTGTCATGGGAGGGGAGAGGG - Intronic
1073702500 10:105944221-105944243 CTCTGTGAGAGGAGGTTAGAGGG + Intergenic
1073880317 10:107973436-107973458 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1073990944 10:109261607-109261629 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1074242153 10:111650219-111650241 CTCTGCTAAGGCAGGGCAGAAGG + Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074967374 10:118503308-118503330 CTCTGTTATGGGAGTCAAGAAGG - Intergenic
1075467866 10:122664931-122664953 TTCCCAGATGGGAGGGCAGAGGG - Intergenic
1075900351 10:126038072-126038094 CTCTGTGATCTGGGGCCAGAGGG - Intronic
1076674142 10:132139685-132139707 CCCTGTGAAGGGAGGACACAGGG + Intronic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1077022858 11:426939-426961 CTATGTGCTGGGAGGCCAGCTGG - Intronic
1079766853 11:24405225-24405247 CCCTGTGTTGGGATGGTAGAGGG + Intergenic
1080183041 11:29446561-29446583 CTCTGTTAGGGCAGAGCAGAAGG + Intergenic
1080717567 11:34818837-34818859 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
1081238920 11:40679796-40679818 CTCTGCTATGGCAGTGCAGAAGG + Intronic
1081533875 11:43983502-43983524 CTCTGTGCTGTAAGGGGAGATGG + Intergenic
1081781606 11:45716848-45716870 CTCTGTGATGGGGTGCCTGATGG - Intergenic
1081813237 11:45924764-45924786 GTCTGGGAGGGGAGGGCATAAGG - Exonic
1083121849 11:60520853-60520875 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
1083717217 11:64584321-64584343 CTCTGTGTTGGGAGGACAAGAGG - Intergenic
1083744930 11:64730121-64730143 CTCTGTGTTGGGGGGGCGCATGG - Exonic
1083837647 11:65282366-65282388 GTGTGTGATGGGAGGACAGTGGG - Intronic
1083904250 11:65659869-65659891 CTCTGCGCTGGGAGGGCCGCTGG + Intronic
1084618217 11:70250778-70250800 CTCTGTGATGGCAGCGCAAGAGG - Intergenic
1084780809 11:71407158-71407180 CTCCGTGATAGGAAGGCAGTAGG - Intergenic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1084956484 11:72694259-72694281 CTCGCTGATGGGTGGGGAGAGGG - Intronic
1085334311 11:75679256-75679278 CTGGGAGATGGGAGGCCAGAAGG + Intergenic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086287983 11:85271384-85271406 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086765848 11:90694080-90694102 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1086995716 11:93353537-93353559 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
1087438328 11:98151237-98151259 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1087537925 11:99475271-99475293 CTGTGTTATGACAGGGCAGATGG - Intronic
1088923469 11:114278881-114278903 CTATGGGATGGGAAGGCATAAGG + Intronic
1089134085 11:116235406-116235428 CCCTGTGCTGGGAGGGAAGGAGG + Intergenic
1089384898 11:118060958-118060980 CACTGTGATGTGAGGTCACAGGG - Intergenic
1090513321 11:127398562-127398584 CTCTGGGATGGGAAGACAGGGGG - Intergenic
1092484534 12:8891037-8891059 ATCTGGGAGGGGAGGGCAAAGGG + Intergenic
1092980516 12:13790150-13790172 GTCTGTGATGGATAGGCAGATGG - Intronic
1094706081 12:32915644-32915666 CTCTGCTATGGCAGCGCAGAAGG + Intergenic
1097152176 12:56987209-56987231 CCCTGACAGGGGAGGGCAGAGGG - Intergenic
1097480409 12:60117032-60117054 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098085830 12:66842018-66842040 CTCCATAATGGGAGGGCATAGGG - Intergenic
1098238616 12:68442960-68442982 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1098327331 12:69316315-69316337 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1100955501 12:99903455-99903477 CTCTGTAATTGGAGGGAATAAGG + Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1104068785 12:125327409-125327431 AGCTATGATGGGAGGGGAGAGGG - Intronic
1104143309 12:126008766-126008788 TACTGTGATGGTAGGGAAGATGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104777250 12:131397657-131397679 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105975075 13:25466426-25466448 CTTTGTGCTGGGAGGGCAGGTGG - Intronic
1106300509 13:28460093-28460115 CTGGGTGATGGTTGGGCAGATGG - Intronic
1109378188 13:61524740-61524762 TTCTGTAATGTGAGGACAGATGG - Intergenic
1109576310 13:64263747-64263769 CTCTGCTAGGGCAGGGCAGAAGG + Intergenic
1110370787 13:74737838-74737860 GTCTGAGGTGGCAGGGCAGATGG + Intergenic
1110487919 13:76068338-76068360 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1111050920 13:82882631-82882653 CTCTGTTAGGGCAGTGCAGAGGG + Intergenic
1112375254 13:98833810-98833832 CTATGTGATGAGAAGGCAGCAGG - Intronic
1112645401 13:101325820-101325842 CTCTGTGAAATGAGGCCAGAAGG - Intronic
1112857192 13:103786428-103786450 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1113748438 13:112762230-112762252 CGCTGTGATAGGAGGCCAGCAGG - Intronic
1114401025 14:22410816-22410838 CTCTGGAATGGGAAGACAGAGGG - Intergenic
1114909046 14:27168151-27168173 CTCTGCTATGGCAGGGCAGAGGG - Intergenic
1115326215 14:32142594-32142616 CTCTCTGAAGGGAAGGCACAAGG - Intronic
1116154465 14:41185875-41185897 CTCTGTTGTGGCAGTGCAGAAGG - Intergenic
1116312080 14:43340546-43340568 GCCTCTCATGGGAGGGCAGAGGG - Intergenic
1116343129 14:43752502-43752524 CTCTGTGAGGGGTGGGCATTGGG - Intergenic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118911986 14:70069303-70069325 TTCTGGCATGGGAGGGCCGAAGG - Intronic
1118928680 14:70219006-70219028 AGCTGTTATGGGAGGGGAGAGGG - Intergenic
1119598970 14:75961816-75961838 CTCTGTAATGGGATGTCACAAGG - Intronic
1120060701 14:79978893-79978915 CTCTATTATGGCAGTGCAGAAGG + Intergenic
1120174255 14:81276785-81276807 CTGTGTGATGGGAGTGGTGATGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120921051 14:89755732-89755754 CTCTGTGAGGGCAGTGCAGAAGG - Intergenic
1121023765 14:90599337-90599359 CTATGTGCTGTGAGGGGAGAGGG - Intronic
1121313397 14:92947103-92947125 CTCTGTGATGGCAGGCAAGTGGG - Intronic
1121455317 14:94035091-94035113 CGCTATGATGTCAGGGCAGAAGG + Intronic
1121467870 14:94127681-94127703 CCCTGTCATGGAGGGGCAGAGGG - Intergenic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1122737086 14:103848916-103848938 CTCTGTGATGGGAGAGTGTAGGG + Intergenic
1122968856 14:105144315-105144337 CTGGGTGATGGAAGGGCAGTAGG - Intronic
1123459749 15:20459112-20459134 CTTGGAGATGGGAGGGCCGATGG + Intergenic
1123658313 15:22541308-22541330 CTTGGAGATGGGAGGGCCGATGG - Intergenic
1124265979 15:28234949-28234971 CTTGGAGATGGGAGGGCCGATGG + Intronic
1124312178 15:28635800-28635822 CTTGGAGATGGGAGGGCCGATGG - Intergenic
1124605827 15:31169742-31169764 CTCTGTGCTGGGAGGGGACCTGG + Intergenic
1126100094 15:45113642-45113664 CTCTCTGATGGGGTGGCGGATGG - Intronic
1126780465 15:52135104-52135126 CCCTGTGATGGGAGGGAGGATGG + Intronic
1126942807 15:53784723-53784745 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1127293518 15:57591102-57591124 CTCTGTTAGGGGACAGCAGAGGG + Intergenic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1128599655 15:68985227-68985249 CTATGTCAGAGGAGGGCAGATGG + Intronic
1129174972 15:73833285-73833307 ATCTGTGATAGGAGTGAAGATGG - Intergenic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129702246 15:77774624-77774646 CTGTGTGGTGGGTGGGCTGATGG - Intronic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1130354789 15:83119301-83119323 TACTGTGATGCGAAGGCAGATGG - Intronic
1130409303 15:83631411-83631433 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
1130854153 15:87826195-87826217 CTCTGTGATGTGAGGCAAGATGG + Intergenic
1130908081 15:88253852-88253874 GTCTGTGATGGGAGGGGACTGGG - Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133820233 16:9229429-9229451 CTCTGGGAGGCCAGGGCAGATGG - Intergenic
1134024982 16:10946516-10946538 ATCTTAGATGGGAGGGCAGCTGG + Intronic
1134183619 16:12066366-12066388 CTCTGTGATGGGATGGAGGGTGG + Intronic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1136089796 16:27910619-27910641 GTCTGTGATGGGAAGACTGAGGG - Intronic
1136308051 16:29386045-29386067 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136321467 16:29487589-29487611 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136436147 16:30227559-30227581 CTCTGGGAGGGCGGGGCAGATGG + Intronic
1136642724 16:31580297-31580319 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1137573191 16:49579797-49579819 CTCTCCCATGGGAGGGCACAGGG + Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1138456391 16:57123495-57123517 CACTGGGATGGGGGTGCAGAGGG - Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138544438 16:57707297-57707319 TTGGGTGATGGGAGGGGAGATGG + Intronic
1139276888 16:65736064-65736086 CTCAGTCATGAGAGTGCAGATGG + Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140194586 16:72846018-72846040 ATATGTGATGGGTGGGCGGATGG - Intronic
1140341071 16:74162817-74162839 CTCTATAATGAGAGGACAGAAGG + Intergenic
1141157916 16:81609970-81609992 CAGTGTGGTGGCAGGGCAGAGGG + Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142772665 17:2110567-2110589 CTCTGTGTTGGGGGGACTGATGG + Intronic
1142959306 17:3542743-3542765 CTCTGGGCTGGGAGGGCCAAGGG - Intronic
1143176844 17:4960317-4960339 GTCTGGGATGGGATGGCAGAGGG + Exonic
1144698764 17:17323099-17323121 CCCTGTGAAGGCAGGGCAGGTGG + Intronic
1144825613 17:18104112-18104134 CACTGTGAGGGGAGGTCAGGAGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145252216 17:21302853-21302875 CTCTGCCACGGGAGGGGAGATGG + Intronic
1145366735 17:22271652-22271674 CTCTTAGATGGGAGGCCAGCAGG + Intergenic
1145931636 17:28690158-28690180 CTCTGTGTTGGGAGAGCGGTAGG - Exonic
1146000359 17:29126921-29126943 CCCTGTGCTTGGATGGCAGATGG - Intronic
1146992593 17:37288652-37288674 CTCTGGGAGGGCAAGGCAGAAGG + Intronic
1147051435 17:37797698-37797720 TTTGGTGATGGGAGGGCAGCTGG + Intergenic
1147387311 17:40090154-40090176 CTCTCTGATGTGGGGGAAGAAGG - Intronic
1148026697 17:44593688-44593710 GGCTGGGATGGGAGGGCAGGGGG - Intergenic
1148046538 17:44748398-44748420 CCCTGGGATGGGAGGGCTGATGG - Exonic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148381643 17:47203904-47203926 TTCCCTGATGGGAGGGCAAAGGG - Intronic
1148731613 17:49840136-49840158 GTTTGTGAAGGGAGAGCAGAGGG - Intronic
1148869543 17:50648302-50648324 CTCGGGGATTGGAGGGCTGAAGG + Intronic
1149422569 17:56524982-56525004 CTCTATGATGGGTTGGAAGAAGG + Intergenic
1151345430 17:73498486-73498508 CTCTGTGCCGGGCAGGCAGAAGG + Intronic
1151990849 17:77572976-77572998 GTGTGTGATGGGAGAGCCGAGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152145599 17:78566907-78566929 GGGTGTGATGGGAGGGCACACGG - Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152684856 17:81688928-81688950 CCCTGTGTTGGGAGGGAGGAGGG + Intronic
1153746756 18:8187334-8187356 GTCTGTGGTGGGAGGGAATATGG + Intronic
1153846094 18:9051118-9051140 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1154445835 18:14434829-14434851 CTCTGTGATGGGATGTCTGTGGG + Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155041373 18:22068108-22068130 CTCTGAGTTGGGAGGGGAGTAGG - Intergenic
1155371280 18:25103734-25103756 CTCTGTGATGGGAAGAGAGAAGG + Intronic
1155398780 18:25415923-25415945 CTCTGTGATAGGAGCTAAGAGGG - Intergenic
1156320508 18:36017060-36017082 CTCTGGGAGGCGAGGGCAGGTGG + Intronic
1157325876 18:46668667-46668689 CTCTCTGATGGGAGGCGAGTCGG + Intronic
1157523229 18:48359793-48359815 CTCTGGGAGGGCAGTGCAGAAGG + Intronic
1157729529 18:49991424-49991446 TTCAGTGATGGGAGGGTAAAGGG + Intronic
1158282661 18:55844416-55844438 CTCCTTGATGGTGGGGCAGATGG - Intergenic
1159022134 18:63151938-63151960 CTCCTTCATGGGAGGGAAGAAGG + Intronic
1159215593 18:65387110-65387132 CTCTGCTAGGGCAGGGCAGAAGG + Intergenic
1159461177 18:68723909-68723931 CTCTACTAGGGGAGGGCAGAAGG - Intronic
1159756352 18:72370815-72370837 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1161023964 19:2026489-2026511 CTTTATGATAGGAGGGCAGGAGG + Intronic
1161249095 19:3270871-3270893 CTCTGTGGCGGGTGGGGAGATGG + Intronic
1161581159 19:5081818-5081840 CTTTCTCATGCGAGGGCAGAAGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162292831 19:9792313-9792335 CTCAGTGAGGGGAGAGAAGAGGG - Intronic
1162292893 19:9792523-9792545 CTCGGTGAGGGGAGAGAAGAGGG - Intronic
1162831315 19:13286474-13286496 CCCAGTGATGTGAGAGCAGAGGG + Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1167538508 19:50070771-50070793 CTCTGAGATGGGAGACCTGAAGG + Intergenic
926123492 2:10257294-10257316 CAATGTGGTGGGAGGGCAGATGG - Intergenic
926217635 2:10915183-10915205 CTCTGTGCTGGGAGGGAGGTGGG + Intergenic
926344869 2:11935950-11935972 CTCTGGGATGTTAGGGCAGGTGG + Intergenic
926391972 2:12402960-12402982 CTCTGTGAGGGCAGTGCAGGAGG + Intergenic
926499902 2:13641215-13641237 ATCTGCCAGGGGAGGGCAGAGGG + Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
926952150 2:18254280-18254302 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927179424 2:20434090-20434112 GACTGTGATGGGAGGGAGGAGGG + Intergenic
927611844 2:24549038-24549060 CTCTGTTAGGGCAGTGCAGAAGG - Intronic
928609941 2:32982891-32982913 CTCTGTTACGGCAGTGCAGAAGG + Intronic
928945465 2:36768081-36768103 CTCTGCTATGGGAGCGGAGAGGG - Intronic
929122329 2:38493889-38493911 ATCTGGGATAGGAGGGGAGAGGG + Intergenic
930157131 2:48117203-48117225 CTCTGAGTTGGGAATGCAGACGG - Intergenic
930310349 2:49732160-49732182 CTCTGTGAGGGCAGTACAGAAGG - Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931186715 2:59959577-59959599 TCCAGGGATGGGAGGGCAGAGGG - Intergenic
931835166 2:66091523-66091545 CTCTTTGATTGATGGGCAGATGG - Intergenic
932040595 2:68295107-68295129 CCCTGTCATGGGAGGGGACAGGG + Intronic
932442231 2:71744787-71744809 CTCTGTGATTGCAGTGCACATGG - Intergenic
932830537 2:74985461-74985483 CCCTGTGATGGGAAGAGAGAGGG - Intergenic
932935661 2:76098417-76098439 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
933743263 2:85551725-85551747 CCATGTGGTGGGAGGGGAGAGGG - Intronic
933790782 2:85882225-85882247 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
935052635 2:99536602-99536624 CCCTGTGATGGGAGTGGAGGAGG + Intergenic
935323031 2:101906939-101906961 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
935434023 2:103008762-103008784 CTCTGCCATAGGAGGGCAGCAGG - Intergenic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
938331221 2:130449868-130449890 CTCTGTGAGGCCAGTGCAGAAGG + Intergenic
938358731 2:130671635-130671657 CTCTGTGAGGCCAGTGCAGAAGG - Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
938435116 2:131278301-131278323 CTCTGCGAGGGCAGTGCAGAAGG - Intronic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
939018922 2:136935782-136935804 CTCTGTGAAGGGGGGACAGTTGG + Intronic
939418337 2:141930598-141930620 CACTGTGGTGGGTGAGCAGAAGG + Intronic
939740729 2:145902436-145902458 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
939930923 2:148231728-148231750 GTCTTGGATGGGAGGGGAGAAGG + Intronic
940044671 2:149396889-149396911 TTTTGGTATGGGAGGGCAGAGGG - Intronic
940444817 2:153765076-153765098 CTTTGTGAGGGCAGTGCAGAAGG + Intergenic
941445235 2:165591851-165591873 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942880707 2:180857633-180857655 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
945089941 2:206169205-206169227 CTCTGTCAGGGTAGTGCAGAAGG + Intergenic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
945120780 2:206455069-206455091 CTCTATGAGGGCAGTGCAGAGGG - Intronic
945457112 2:210063320-210063342 CTCTGCTAGGGGAGTGCAGAAGG + Intronic
945724868 2:213463745-213463767 CTCTGCTAGGGGAGTGCAGAAGG + Intronic
945754884 2:213833855-213833877 CCCTGTGATGGGAGAGGAAAAGG - Intronic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
947169469 2:227296923-227296945 CACAGAGATGGGAGAGCAGAGGG + Intronic
947463095 2:230320062-230320084 GTATGTGTTGGGAGTGCAGAGGG + Intergenic
1169033768 20:2433119-2433141 CTCTGTAATGGGAGTGTTGAGGG - Intergenic
1169398763 20:5261151-5261173 TGCAGGGATGGGAGGGCAGAAGG + Intergenic
1172387930 20:34547093-34547115 CTCTGTGGAGTGAGGGCAGCAGG + Intronic
1172483255 20:35284277-35284299 CTCGGTGGTGGCGGGGCAGAGGG + Intronic
1172768574 20:37363936-37363958 CTCCCTGATGGGAGAGCCGAAGG - Intronic
1173123232 20:40313184-40313206 CTCTGTGATGTGGATGCAGAAGG - Intergenic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1174936042 20:54869882-54869904 CTGTGTGCTGGAAGGACAGAGGG + Intergenic
1175593402 20:60211809-60211831 CACTGTGTTGGGAGAGCAGTGGG + Intergenic
1175758341 20:61544438-61544460 TTCTGTGGTGGGAGCGCAGTGGG + Intronic
1176256898 20:64157702-64157724 CTCCGTGATGGGCGGGCAGATGG + Intronic
1176450143 21:6855032-6855054 CACTGTGATGGGATGGCTGTGGG - Intergenic
1176828312 21:13720050-13720072 CACTGTGATGGGATGGCTGTGGG - Intergenic
1176846507 21:13880829-13880851 CTCTATTATGGAAGTGCAGAAGG + Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1180092135 21:45538610-45538632 CACAGTGAGGGAAGGGCAGAGGG + Intronic
1180247708 21:46559402-46559424 CACTGTGATGGGGAGGCACAAGG - Intronic
1180741583 22:18056914-18056936 CCCTGTGATGGGAGGGCTGGAGG - Intergenic
1180749373 22:18113750-18113772 TTTTGTGATGGGAGGGGAGGAGG - Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182023801 22:27101701-27101723 CAGTGTGATGGGAGAGGAGATGG + Intergenic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1183343592 22:37295021-37295043 CCCTGGGATGGGCGGGGAGAAGG + Intronic
1183437182 22:37802870-37802892 CGCTGGGATGGGCGGGGAGAAGG + Intergenic
1183732116 22:39624378-39624400 CTCTGTAATTGGAGCGCAGGGGG - Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184106591 22:42370931-42370953 CCCTGTGATGGGGGTGCAGAGGG - Intergenic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184666692 22:45992992-45993014 GGCTGAGATGGGAAGGCAGAAGG - Intergenic
1184718851 22:46297299-46297321 CTCTGTGAGCCGAGGGCTGAAGG + Intronic
1184870528 22:47235075-47235097 CTAGGTGATGGGTGGACAGATGG - Intergenic
1185310613 22:50152249-50152271 GTCAGTGACAGGAGGGCAGAGGG + Intronic
950105653 3:10386684-10386706 TGATGGGATGGGAGGGCAGAGGG + Intronic
950203784 3:11062655-11062677 CTCCCTGAGGGGAGGGCAGCGGG - Intergenic
950405526 3:12801939-12801961 CTCTGAGATGGGAGTGGACAGGG + Intronic
951322785 3:21267185-21267207 CTCTGAGAAGGGATGGCTGAAGG + Intergenic
952679880 3:36079208-36079230 CTCTGTCATGTGAGGACACAGGG - Intergenic
953663495 3:44907998-44908020 CTATGCTATGGGATGGCAGATGG + Intronic
953680060 3:45032301-45032323 CCCTGTGGTGGGAGTGCAGAAGG - Intronic
953994748 3:47511189-47511211 CTCTGTGATGCCAAGACAGATGG - Exonic
954682288 3:52352209-52352231 ACATGTGATGGGCGGGCAGATGG + Intronic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
955070049 3:55565058-55565080 CTCTAGGATGGGAGAGCAGCAGG + Intronic
955387175 3:58489132-58489154 CACGGTGCTGGGAGGGCAAAGGG - Intergenic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956632065 3:71326484-71326506 TTCTGTGATGGCAGAGCTGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956820827 3:72952696-72952718 CTCTGCCATGTGAGGACAGAGGG - Intronic
956938574 3:74131785-74131807 CTCTGTTAGGGCAGGGCAGAGGG - Intergenic
959368269 3:105490959-105490981 CTCTGCGAGGGCAGTGCAGAAGG - Intronic
959851827 3:111096887-111096909 CTCTGTTAAGGCAGTGCAGAAGG + Intronic
960621117 3:119637776-119637798 CTCTGAGATGGTGGGGCAGAGGG - Intronic
960938125 3:122915740-122915762 GTCTGAGATGGGAGGACACAAGG + Intronic
961219300 3:125187272-125187294 CTCGGTCCTGGGTGGGCAGACGG - Exonic
961225023 3:125236305-125236327 CTCTGTGAGGGCAAGGCAGGAGG - Intronic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
961501918 3:127342436-127342458 TTGTGTGCTGGGAGGGCTGAGGG + Intergenic
961617433 3:128193869-128193891 CTCTGGCATGGGAGGACAGAAGG + Intronic
961691234 3:128671304-128671326 CTCTGACATGGGCAGGCAGAAGG - Intronic
961789346 3:129364685-129364707 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
962249601 3:133827756-133827778 CTCTGTGATGGGGAGGCGGGGGG - Exonic
963136767 3:141912799-141912821 CTTGGTAATGGGAGGGAAGAGGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964271358 3:154959704-154959726 CTATGGGATGGGATGGGAGAAGG + Intergenic
964307281 3:155355285-155355307 ATCTCTGAGGGTAGGGCAGATGG - Intergenic
965777031 3:172242354-172242376 CTCTGCTAGGGTAGGGCAGAAGG - Intronic
966314794 3:178633297-178633319 CTCCGTGAGGGCAGTGCAGAAGG - Intronic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
967462279 3:189760753-189760775 CTCTATTAGGGCAGGGCAGAAGG - Intronic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
968819411 4:2838237-2838259 CACTGTGAGGGGAGGGCACTTGG - Exonic
969072611 4:4551587-4551609 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
969190360 4:5513303-5513325 GTCTGTGATGGGAGGCATGAAGG + Intergenic
969460202 4:7324993-7325015 CCGTGAGATGGGAGGGCAGAAGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970176966 4:13349248-13349270 AGCTGTGGTGGGAGGGGAGAGGG + Intergenic
970357424 4:15269674-15269696 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
970560372 4:17276370-17276392 CTCTGAGATGGGAGGTCTAAAGG + Intergenic
971069944 4:23080048-23080070 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
971161685 4:24140043-24140065 CTCTGGAATGGTAGGGCTGATGG - Intergenic
971254818 4:25004652-25004674 CTATGTGGTGAAAGGGCAGAGGG - Intronic
971261683 4:25062983-25063005 GGCTGTGGTGGGAGGGCAGTTGG + Intergenic
971670237 4:29546613-29546635 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
972063454 4:34910230-34910252 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
972667418 4:41180521-41180543 CTACTTGATGGGGGGGCAGAGGG + Intronic
974485109 4:62494444-62494466 CTCTGTTATGGCAGTGCAGAAGG + Intergenic
975216518 4:71761928-71761950 CTCTGCTATGGCAGTGCAGAAGG + Intronic
975361288 4:73475036-73475058 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976813990 4:89125343-89125365 CTCTGTGTTGGGAGGGAGAAAGG + Intergenic
977435794 4:96992632-96992654 TTCTGTGATGGGAAGAAAGAGGG + Intergenic
979203081 4:118002635-118002657 CTCTGTGCTGGGAGTCCACAGGG - Intergenic
979426392 4:120572466-120572488 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
980636285 4:135508391-135508413 ATCTGTGATGGGAGGACATGGGG - Intergenic
981602024 4:146500722-146500744 CTCTGTGATGAAAGGGAAAAGGG - Intronic
981686358 4:147459058-147459080 ATCTGTGTTGGGATGGCTGAAGG + Intergenic
981730278 4:147889709-147889731 TCCTGTGTTGGGAGGGCAGCTGG + Intronic
983192450 4:164769091-164769113 CGATTTGATGGAAGGGCAGAAGG - Intergenic
983513570 4:168634009-168634031 TCCTGTGATGTGATGGCAGATGG + Intronic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
983863348 4:172735014-172735036 CTCTGCTATGGCAGTGCAGAAGG + Intronic
984151495 4:176138557-176138579 TTTGGTGATGGGAGGGAAGATGG - Intronic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985566295 5:619726-619748 ATCTGTGAAGGGGGGGCTGATGG + Intronic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
991920300 5:71650105-71650127 CTCAGTGATGGGAGGAGAGCAGG + Exonic
994277029 5:97851434-97851456 CTGTGTGATATTAGGGCAGAAGG - Intergenic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
997365705 5:133323962-133323984 CTGTGTGAAGGGAGTGCAGTGGG - Intronic
997762547 5:136463476-136463498 CACAGTGATTGGAGGTCAGAGGG - Intergenic
998348759 5:141487076-141487098 TTCTGTGGTGGGAGGTCAGCTGG - Exonic
998572990 5:143281669-143281691 TTCAGTGATGGGAGAGTAGATGG - Exonic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998823403 5:146077180-146077202 CCTTGTGAGGGGAGGGCAGGTGG - Intronic
999193237 5:149764207-149764229 GTCATTGATAGGAGGGCAGAGGG + Intronic
999919790 5:156305544-156305566 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1000674607 5:164105547-164105569 CTCTACTAAGGGAGGGCAGAGGG + Intergenic
1000728492 5:164801821-164801843 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1001375405 5:171251779-171251801 CTCTGTGATTGGGTGGAAGATGG + Intronic
1001669689 5:173463427-173463449 CTCTGTGATTGGATGAGAGATGG + Intergenic
1002026355 5:176398380-176398402 CACTCTGATGGGAGGACATAAGG + Intronic
1002096980 5:176837235-176837257 CTCTGTGATGGCAGATGAGATGG - Intronic
1002223510 5:177702603-177702625 GTCTGTGATGGGAGGGGCCATGG - Intergenic
1002258538 5:177978047-177978069 CTCTGTGATGGTGGGGCGGGAGG + Intergenic
1002501327 5:179649499-179649521 CTCTGTGATGGTGGGGCGGGGGG - Intergenic
1002636270 5:180610263-180610285 CTCTGTGATGGGAAGTGAGGGGG + Intronic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1004146957 6:13076867-13076889 CTCTGAGAGGTCAGGGCAGAGGG + Intronic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006736612 6:36278037-36278059 CTCTCTGAAAGGGGGGCAGAGGG - Intronic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1006905219 6:37528681-37528703 CTCTGTGATGGATCTGCAGAAGG - Intergenic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007724368 6:43905993-43906015 CTCTGTGATGTGAGGATGGAAGG + Intergenic
1007767939 6:44172146-44172168 CTCTTTAGTGGGAGGGCTGAGGG + Intronic
1007781017 6:44254813-44254835 CACTGTGGTGGGAGGGCTGGGGG - Exonic
1008649213 6:53546046-53546068 CTCTGTAGTGCGAGGGAAGAGGG - Intronic
1009481008 6:64157828-64157850 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1009550788 6:65089106-65089128 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1009699758 6:67161046-67161068 CTCTGGTAGGGGAGTGCAGAAGG + Intergenic
1011041175 6:83032035-83032057 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1011078419 6:83462878-83462900 CTCTTAGTTGGGAGGGCAGGAGG + Intergenic
1011088638 6:83570852-83570874 CTCTGTTAGGGCAGTGCAGAGGG + Intronic
1011093961 6:83637596-83637618 CTCAGTGATCTGAGAGCAGAAGG - Intronic
1011696510 6:89918050-89918072 CTCTGTGCTGGGGGTGCAGTTGG + Intergenic
1012683232 6:102209711-102209733 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1013286378 6:108685781-108685803 CTTTGTGATGGGCGGGCACCAGG + Intergenic
1013503022 6:110771189-110771211 CTCTGTTAGGGCAGTGCAGAAGG - Intronic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013865449 6:114690884-114690906 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1015540578 6:134309573-134309595 CTCTGTAATGGGAAAGCAGGTGG - Intronic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1016150377 6:140734235-140734257 CTTTGTTATGGGAGCCCAGATGG + Intergenic
1016537647 6:145126475-145126497 CTCTGCAATGGCAGTGCAGAAGG + Intergenic
1016611942 6:145999708-145999730 CTCTGCGAGGGCAGTGCAGAAGG - Intergenic
1016818240 6:148323561-148323583 CTCTGTGAAGGGAGGGGCCATGG - Intronic
1016984537 6:149885188-149885210 CTATGTGATGGGTGGTCTGATGG - Intronic
1017266712 6:152454413-152454435 CTCTGCCATGTGAGGGCACAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017763716 6:157590639-157590661 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1018902842 6:168059960-168059982 CTTTCTGATGGGAGGGAAGCTGG + Intronic
1019194608 6:170273794-170273816 CTCAGTGATGGGAGAGCTTAGGG - Intergenic
1019211848 6:170413041-170413063 TTCTGTGATGGAAGGACTGAGGG - Intergenic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019394238 7:808429-808451 CTCTGGGAGGGGAGCCCAGAAGG - Intergenic
1020540023 7:9450543-9450565 CTCCCATATGGGAGGGCAGATGG - Intergenic
1021529801 7:21631916-21631938 CTCTGCTATGGCAGTGCAGAAGG - Intronic
1021751564 7:23806042-23806064 ATATGTGATGTGAAGGCAGAAGG - Intronic
1022178291 7:27893629-27893651 TTCTGTGATAGGAGGGCATCCGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022289713 7:28989220-28989242 TTCTGTCATGGGAGAGTAGAAGG - Intergenic
1022494419 7:30844127-30844149 CTCTGTGATGGGGCAGCAGCCGG - Intronic
1023225989 7:37969579-37969601 CTCTGCGATAGGAGGGAACATGG + Intronic
1024112902 7:46164342-46164364 CTTGGTGATGGGAGGACAGCAGG + Intergenic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024814517 7:53253259-53253281 CACTGATGTGGGAGGGCAGAAGG + Intergenic
1027584792 7:80044682-80044704 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1028249681 7:88526192-88526214 CTCTGTTAAGGCAGTGCAGAAGG - Intergenic
1028340598 7:89715381-89715403 ATTTCTGATGGGAAGGCAGATGG - Intergenic
1028920337 7:96303727-96303749 CACTGACATGGGAGGGCAGGAGG - Intronic
1029464123 7:100714846-100714868 TTCTGTGCTGGGAGGGGAGGTGG - Intergenic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031254944 7:119435455-119435477 CTCTGTTAGGGAAGTGCAGAAGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1033537986 7:142329226-142329248 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033551527 7:142452009-142452031 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033555990 7:142488857-142488879 CTCTTTGATGGGAAGGAAGGAGG - Intergenic
1033601961 7:142894777-142894799 CTCTGTGATGACAGGGGTGATGG - Intergenic
1034521798 7:151626072-151626094 TTCTGAGATGGGAGGTCACATGG + Intronic
1034623096 7:152471479-152471501 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1035059002 7:156055374-156055396 CTCTGTGAAGTGAGGGTAGGAGG - Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035740455 8:1924242-1924264 CTCAGTGAGGGGTGAGCAGAAGG - Intronic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1035856152 8:2978489-2978511 ATTGGTGATGGGAGGACAGAAGG + Intronic
1037672280 8:21025318-21025340 CTCTGTGATGGGATCACAGCAGG - Intergenic
1037771222 8:21801272-21801294 CACTGTGTTGGGAGGCCTGAGGG - Intronic
1040787100 8:51178766-51178788 CTCTTTGTTGTTAGGGCAGATGG + Intergenic
1040797290 8:51300040-51300062 CTCTGCTAGGGCAGGGCAGAGGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042989234 8:74620401-74620423 CTCTGTGAGGGCAGTGCAGAAGG - Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1043267742 8:78287633-78287655 GTATGTGTTGGGAGGGTAGAGGG - Intergenic
1043488673 8:80725176-80725198 TACTGTGGTAGGAGGGCAGAAGG + Intronic
1044819920 8:96149017-96149039 CTCTGTGATGCCAGGTCAGCAGG - Intronic
1044839022 8:96322386-96322408 CCCCATGATGGAAGGGCAGAAGG + Intronic
1044973820 8:97644488-97644510 CCCTCTGACGGGAGGGAAGATGG + Exonic
1045007120 8:97926231-97926253 CCCTGTCATGAGAGGCCAGAAGG + Intronic
1045506018 8:102779346-102779368 ATCTGTCCTGGGAGGGCAGGCGG + Intergenic
1046735183 8:117768895-117768917 CTCTATTATGGCAGTGCAGAGGG + Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1046827185 8:118704155-118704177 CTCTGTTATGGGAAGAGAGAAGG - Intergenic
1048234656 8:132677837-132677859 TTCTGTCATGTGAGGACAGAGGG - Intergenic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1048475932 8:134742412-134742434 CTCTGAGATGGGAGAGAGGAGGG - Intergenic
1048946141 8:139449305-139449327 CTCTGTCCTTGGATGGCAGAAGG + Intergenic
1049420244 8:142513235-142513257 CTGTGAGATGGGAGGGCGGTTGG + Intronic
1049600383 8:143504787-143504809 CTCTGCGAAGGGACGGCAGTGGG - Intronic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1051372044 9:16367020-16367042 CACTGTGCTGGGATGGCTGAAGG - Intergenic
1052526878 9:29629758-29629780 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1052917366 9:33933586-33933608 CTCACAGACGGGAGGGCAGAGGG + Exonic
1052971960 9:34382018-34382040 CTTTGTGATGTGAGCACAGACGG - Intronic
1053165522 9:35841383-35841405 CTCTGTGCTGGGAGGGAGGGAGG - Intronic
1053202776 9:36164046-36164068 CTCTGTGCTGGTGGGTCAGATGG - Intergenic
1053532080 9:38892440-38892462 ATCTGTGAGGGAAGGGCAAAGGG + Intergenic
1054634058 9:67471515-67471537 ATCTGTGAGGGAAGGGCAAAGGG - Intergenic
1055794088 9:79955423-79955445 CTCTGTTAGGGGAACGCAGAAGG + Intergenic
1055839935 9:80491409-80491431 TTCTGTGATGGGAGGGAAGTGGG - Intergenic
1055885959 9:81063467-81063489 CTCTGTTATGGCAGTGCAGAGGG + Intergenic
1056087071 9:83161060-83161082 CTCTGTCAGGGGAGTGCAGAAGG + Intergenic
1056300165 9:85232120-85232142 CTGTGTGTTGGAAGGACAGAGGG + Intergenic
1056670244 9:88621677-88621699 CTCTGTAATGGAAAAGCAGAGGG + Intergenic
1057259094 9:93574366-93574388 CTCCCTGGTGAGAGGGCAGAGGG - Intergenic
1057983089 9:99681813-99681835 CTCTGCTAGGGGAGTGCAGAGGG - Intergenic
1058091380 9:100809624-100809646 GTCTGTCAGGGGAGGGCAGGGGG - Intergenic
1058274587 9:103024181-103024203 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060790581 9:126483047-126483069 CTCAGGGATGGGAGGGGAGCTGG - Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1061152714 9:128837923-128837945 CTCTAAGCTGGGAGGGCAGAGGG - Intronic
1061306396 9:129735602-129735624 CTCTGCCGTGGGAGGGCAGGGGG - Intergenic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061488568 9:130933055-130933077 CTCCCTGGTGGGAAGGCAGAGGG + Intronic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1062157869 9:135063769-135063791 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1062163301 9:135092057-135092079 CTCCGTGCTGGGGGGACAGATGG + Intronic
1062721043 9:138044208-138044230 AGGTGTGATGGGAAGGCAGATGG - Intronic
1203519039 Un_GL000213v1:29485-29507 CACTGTGATGGGATGGCTGTGGG + Intergenic
1185877855 X:3714198-3714220 CTTTTTGGGGGGAGGGCAGAGGG - Intergenic
1187214683 X:17264898-17264920 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1189286381 X:39854905-39854927 CTCTGCCATGTGAGGGCACAAGG + Intergenic
1189669733 X:43395138-43395160 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1190032096 X:46983642-46983664 ATCTTTGCTGGGAGGGAAGATGG + Intronic
1190275751 X:48898129-48898151 CGCTGGGATGGGGGAGCAGAGGG - Exonic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1193320421 X:80115005-80115027 CTCTGAGAGGGCAGTGCAGAAGG + Intergenic
1193777186 X:85657555-85657577 CTCTGCTATGGCAGTGCAGAGGG + Intergenic
1194125640 X:90012874-90012896 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1194467074 X:94246311-94246333 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1194500570 X:94676525-94676547 CTCTGCTATGGCAGTGCAGAAGG - Intergenic
1194941521 X:100016422-100016444 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1197464286 X:126784249-126784271 CTCTGCTATGGCAGTGCAGAAGG + Intergenic
1198037857 X:132819710-132819732 CTCTGGGATGGCAGGGGACATGG - Intronic
1198794210 X:140378476-140378498 CTCTGTGGTGGGAAGGCAGGGGG + Intergenic
1198852084 X:140975435-140975457 CACTGTGTTGGGAGGGCAGGTGG + Intergenic
1199147077 X:144380911-144380933 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1201990146 Y:20014920-20014942 CTCTGCTATGGGAGTGCAGAAGG + Intergenic