ID: 1105768148

View in Genome Browser
Species Human (GRCh38)
Location 13:23580642-23580664
Sequence TGAAAGGTATAGAACTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105768143_1105768148 0 Left 1105768143 13:23580619-23580641 CCAGGCAGTGCTTATTATCTAAT 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG 0: 1
1: 0
2: 0
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105768148 Original CRISPR TGAAAGGTATAGAACTGGAG GGG Intronic
902233260 1:15041771-15041793 TGAGAGGTCTGGAACTGGAAGGG - Intronic
902756904 1:18554985-18555007 TGAAGGGGACAGAACTGAAGAGG + Intergenic
904835239 1:33331464-33331486 TGAAAAGTATAGAAATGGGTAGG + Intronic
906721237 1:48006445-48006467 TAAAGGGTAAAGAAATGGAGTGG + Intergenic
906739276 1:48165869-48165891 TGAACGGCAGAGAAATGGAGGGG - Intergenic
907359067 1:53900274-53900296 TGGGAGGTGTAGAACAGGAGGGG - Intronic
908198319 1:61767964-61767986 TGAAAGAGATAGAACTGGCCCGG - Intronic
908339779 1:63164954-63164976 TGACAGGTAAAGAGCTGGAGAGG - Intergenic
908967182 1:69779872-69779894 GGACAGGTATAGTACTGGACAGG - Intronic
910694065 1:89994042-89994064 TGAAATGTGAAGAACTGCAGGGG + Intergenic
911034859 1:93531612-93531634 TGAGAGATAATGAACTGGAGTGG + Intronic
911180167 1:94853384-94853406 TAAAAGGAACAGAAATGGAGAGG + Intronic
913434201 1:118830267-118830289 GGAATGGTGTAGAAATGGAGTGG - Intergenic
914334305 1:146700926-146700948 TGAGAGGTACAAAACTGGTGAGG - Intergenic
914349647 1:146829870-146829892 TGAAAGGCAGAGTGCTGGAGAGG - Intergenic
914954965 1:152153765-152153787 AGAAAGGTATTGAATTGGAATGG + Exonic
916101532 1:161397325-161397347 AGAACGGAATAGAACTGGACAGG - Intergenic
916504073 1:165411853-165411875 TGAAGAGCATAGAATTGGAGGGG - Intronic
916879834 1:169009808-169009830 TGAAAGGGAAAGAACCAGAGAGG - Intergenic
917804438 1:178600695-178600717 TCAAAGATATAGAATAGGAGAGG + Intergenic
918148664 1:181780070-181780092 TGAAAGCTATAGGACAGAAGGGG + Intronic
918357072 1:183714909-183714931 GGAAAGGCATTGAACTGGGGTGG + Intronic
919725127 1:200877406-200877428 TTAAAAGTAAAGAAATGGAGGGG - Intergenic
919942922 1:202300791-202300813 AGAAAGGTATAGAGAGGGAGAGG - Intronic
920002515 1:202809467-202809489 TGAAGGGTATAAATCTGAAGGGG + Exonic
921041375 1:211436050-211436072 TGAAATGTATAGAGCTGGCCGGG + Intergenic
923618171 1:235554891-235554913 TGAAAACTAGAAAACTGGAGAGG - Intronic
924593425 1:245424652-245424674 TGATAAGTATAGAAATGGAGAGG + Intronic
1063761449 10:9083110-9083132 TGAAAGGTTTAGAAAGGGAAAGG + Intergenic
1064691807 10:17926389-17926411 TGAAAGGTATTAAATTGAAGAGG - Intergenic
1065054700 10:21833001-21833023 TGAAAGATTTAGAAGTGGGGTGG - Intronic
1065797774 10:29322930-29322952 TAAAAGGTAGAGAAGTGGAGTGG + Intergenic
1066769231 10:38830551-38830573 TGAAGGGGAAAGAAATGGAGTGG + Intergenic
1066939505 10:41870262-41870284 TGAAAAGGATAGGATTGGAGTGG + Intergenic
1067856621 10:49799198-49799220 TGAAAGGGAAAGAACAAGAGAGG - Intergenic
1074558650 10:114515326-114515348 TGAATGGTCTAGAGCTGGAGAGG + Intronic
1076043963 10:127275655-127275677 TGAAAGGGATGGTACAGGAGGGG + Intronic
1078325191 11:10374965-10374987 TTAGAGGTATAAAACTGGAGTGG + Intronic
1079584952 11:22114368-22114390 GGAAAGGTGTAGAAAGGGAGGGG - Intergenic
1082737135 11:56868664-56868686 AGAAAGTTATAGAAATGAAGAGG + Intergenic
1083877059 11:65529782-65529804 TGAAGGGTACAGCACAGGAGAGG + Intronic
1084057426 11:66644866-66644888 TGAAAGATATAGCAATGGAGTGG - Intronic
1085416855 11:76324282-76324304 TAATAGGTAAAGAACTGGTGGGG + Intergenic
1087370541 11:97278736-97278758 TGAAAAGGATACAAATGGAGGGG + Intergenic
1091574701 12:1722298-1722320 TGAAATGGATAAGACTGGAGGGG + Intronic
1091621979 12:2095806-2095828 TGGAAGGTTTAGGAGTGGAGAGG + Intronic
1091764313 12:3108422-3108444 TCAAAGGAATAAAACTGGAATGG - Intronic
1093893180 12:24547553-24547575 TGAAAGCAGTAGAAATGGAGTGG + Intergenic
1095938784 12:47712305-47712327 TGAAGGCTCTAGAACTGCAGGGG - Intronic
1096258885 12:50078759-50078781 TAGAAGGTATGGACCTGGAGTGG + Intronic
1097397409 12:59092440-59092462 TGAAAGGTATGCAAAAGGAGGGG + Intergenic
1099136557 12:78911042-78911064 TGAAAGGTGTTGAACAAGAGAGG + Intronic
1100379547 12:94048853-94048875 TGAGAGGTTTAGAGCTGGTGTGG - Intergenic
1101120255 12:101571754-101571776 TGAAAGGGAAAGAAGAGGAGGGG - Intronic
1103175357 12:118858698-118858720 TGAAAGCTATGGGACTGGATGGG + Intergenic
1105768148 13:23580642-23580664 TGAAAGGTATAGAACTGGAGGGG + Intronic
1106440810 13:29767337-29767359 TAAAAATTCTAGAACTGGAGGGG + Intronic
1107196654 13:37660507-37660529 TGAAAGGAATGAAACAGGAGTGG + Intronic
1107611440 13:42117835-42117857 TCAAAGGTATACCTCTGGAGGGG - Intronic
1107748438 13:43538025-43538047 TGACAGTCATAGATCTGGAGAGG - Intronic
1108523041 13:51261912-51261934 AGACAGGTACAGTACTGGAGGGG + Intronic
1109689770 13:65870625-65870647 TGAAAGGCTTAGAGCAGGAGTGG - Intergenic
1111813172 13:93118044-93118066 AGAGAGGTATAGAAATAGAGTGG + Intergenic
1112221356 13:97494462-97494484 AGAAAGGTATATATGTGGAGAGG + Intergenic
1113005666 13:105699440-105699462 TGAAAGATGTAGTGCTGGAGAGG - Intergenic
1114712622 14:24793941-24793963 GGAAAAGTATAGAACTGCTGAGG - Intergenic
1116760322 14:49005120-49005142 TGAATGGTCTAGAACTAGTGGGG - Intergenic
1117386370 14:55217912-55217934 GGAAAGGAATGGAATTGGAGAGG - Intergenic
1117661977 14:58016023-58016045 TCAAAGGTAAAGAGGTGGAGGGG + Intronic
1117919280 14:60711444-60711466 TGACATGTAGAGAACTAGAGTGG + Exonic
1118108769 14:62692770-62692792 TGAAAGTTATAGCATTGGACTGG + Intergenic
1119383921 14:74245561-74245583 TGAGAGGTGGAGTACTGGAGGGG + Intronic
1120664094 14:87285395-87285417 TGATAGGTAGAGATTTGGAGTGG + Intergenic
1121965681 14:98302310-98302332 TGAAAGATATAGAACTCTAGCGG + Intergenic
1121994914 14:98594181-98594203 TGAAAGCTAGAGAAATGGAGTGG + Intergenic
1122017197 14:98806098-98806120 TTAAAGTAAAAGAACTGGAGGGG - Intergenic
1122155343 14:99747267-99747289 GGAAATGTATAGAAATGGCGAGG + Intronic
1125792696 15:42381209-42381231 AGAAAGGAAGAGCACTGGAGAGG - Intronic
1126534638 15:49748180-49748202 TTAAAGTTATAGAACTGGATGGG + Intergenic
1127239675 15:57098891-57098913 TGAAAGAATAAGAACTGGAGAGG + Intronic
1127385250 15:58461783-58461805 TGAAAGGCAGAGGTCTGGAGGGG - Intronic
1127680664 15:61294299-61294321 AGAAAGGAATAGAACGGAAGTGG + Intergenic
1127698024 15:61470753-61470775 TGCAAGGTCTAGGAGTGGAGTGG + Intergenic
1128027911 15:64454362-64454384 TGAAAGGTATATTACTGATGTGG - Intronic
1128700931 15:69803770-69803792 TGAAATGTAAAGAACTGCACGGG + Intergenic
1129244335 15:74270552-74270574 GGAAAGGAACAGAAGTGGAGAGG + Intronic
1129760157 15:78124578-78124600 TGAAAAGTATAGAGGTGAAGAGG + Intronic
1131915073 15:97256196-97256218 TGAGAGGTTAAGAACTGGTGAGG + Intergenic
1136529804 16:30860390-30860412 AGAAAGGTAGAGACATGGAGTGG - Intronic
1137844186 16:51671012-51671034 TGAAAGGTATGGAAATAGAAAGG + Intergenic
1139203711 16:65005083-65005105 TGAAAGGAATGGAAATGAAGTGG - Intronic
1139984388 16:70885676-70885698 TGAAAGGCAGAGTGCTGGAGAGG + Intronic
1140494619 16:75373955-75373977 TGAAAATTATAGAACTGGCCAGG + Intronic
1142056843 16:88003039-88003061 TCAGAGATGTAGAACTGGAGAGG - Intronic
1142814454 17:2414399-2414421 TGCAAGGAATGGAACTGGACGGG + Intronic
1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG + Intergenic
1144659279 17:17058009-17058031 TGAAAGGGATACCACTGGGGAGG - Intronic
1145703861 17:26854261-26854283 GGAAAGGAATAGAAATGGAAAGG + Intergenic
1150029553 17:61718581-61718603 TGCAAGGTAGAGTACTAGAGAGG - Intronic
1150543292 17:66126023-66126045 TTATAGGTATAGAAATGGATGGG - Intronic
1154142010 18:11832565-11832587 TGAAAGGAATTGACCTGGCGCGG + Intronic
1155631221 18:27895836-27895858 AGAAAGTTAAAGAACTGGACTGG - Intergenic
1155640251 18:28005287-28005309 TTGAAGGGATAGAACTGCAGGGG + Intronic
1156223756 18:35081593-35081615 TGAAAGCTAGAGGACTGGACTGG + Intronic
1157310089 18:46546322-46546344 TGAAATGTATTGGAATGGAGTGG - Intronic
1157590578 18:48834045-48834067 GGAAAGGAAGAGAACGGGAGGGG - Intronic
1161126187 19:2559093-2559115 TGAAAGGAATATAACTGGCTGGG - Intronic
1162366686 19:10253914-10253936 GGAATGGTATAGAACTAGAGAGG + Intronic
1165217732 19:34288567-34288589 TGAGAGGTAGAGAAATGTAGGGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167044490 19:47041633-47041655 AGAAAGCTTTAGAGCTGGAGAGG + Intronic
930601323 2:53446752-53446774 TGAAAGGTATTGAAATCAAGAGG - Intergenic
930674967 2:54190693-54190715 TGAAAGCCATGGAACTGTAGAGG - Intronic
932097600 2:68865458-68865480 TGAAAGGGACTTAACTGGAGAGG + Intergenic
932140699 2:69274947-69274969 AGAAATGTAGAGAAGTGGAGAGG + Intergenic
932600668 2:73123019-73123041 TGAGAGGTACAGAAATGAAGGGG - Intronic
936811839 2:116412356-116412378 TGAAGCTTATACAACTGGAGGGG + Intergenic
936934794 2:117828726-117828748 TGAAAGGCAAGGAACTGGATAGG - Intronic
936989874 2:118351688-118351710 TGAAAGGCATACAGTTGGAGGGG + Intergenic
937170493 2:119861171-119861193 TAAAAGGGATAGAACTCCAGGGG + Intronic
939406580 2:141766029-141766051 GGCATGGTATAGAAATGGAGAGG - Intronic
939445211 2:142301478-142301500 AGTAAGGTATAGCCCTGGAGAGG - Intergenic
940030713 2:149258714-149258736 TGACAGGAATTGAACTAGAGTGG + Intergenic
940321311 2:152379907-152379929 AGAAAGCTGTAGAAATGGAGAGG + Intronic
940592062 2:155742175-155742197 TGAAAAAAAGAGAACTGGAGAGG + Intergenic
941237771 2:162996335-162996357 TTAAAGGTTCAGAACTGGAAAGG + Intergenic
942246193 2:174011303-174011325 TAAAAAGTATAAAACAGGAGGGG + Intergenic
943502293 2:188707008-188707030 GGAAAGGCATAGAAGTGGATAGG + Intergenic
944630918 2:201623171-201623193 TGAATGTTATAGAACAGAAGAGG - Exonic
946238599 2:218340585-218340607 GGAAAGGGATGGAGCTGGAGGGG - Intronic
946474091 2:219991237-219991259 TGAAATTTCTGGAACTGGAGCGG + Intergenic
947633763 2:231669912-231669934 TGAATGGCACAGAAGTGGAGTGG + Intergenic
947926161 2:233924330-233924352 TGAAAGAGATAGAACGGGAAAGG - Intronic
1171914552 20:31053262-31053284 TGGAATGTAAAGAAATGGAGTGG + Intergenic
1171915233 20:31057621-31057643 TGGAATGTAAAGAAATGGAGTGG + Intergenic
1171923295 20:31168265-31168287 TCAAAGGCATAGGAATGGAGAGG + Intergenic
1171930934 20:31228504-31228526 TCAAACGTAAAGAACTAGAGTGG + Intergenic
1173610456 20:44363578-44363600 TGAGAGGCATAGAAAGGGAGGGG + Intronic
1176530903 21:7957141-7957163 TGTAATGTAAAGGACTGGAGTGG - Intergenic
1176698691 21:10015008-10015030 GGAAAGGTATTGATCTGGTGAGG - Intergenic
1176755293 21:10721332-10721354 TGGAATGTAAAGAAATGGAGTGG - Intergenic
1179309237 21:40182186-40182208 TGAAAGGTTTAACAATGGAGAGG + Intronic
1184108664 22:42383005-42383027 TGCAAGGTATAGAGCAGGGGAGG + Exonic
1203298857 22_KI270736v1_random:63052-63074 TGAAATGGATAGGAGTGGAGTGG + Intergenic
1203299962 22_KI270736v1_random:70165-70187 TGGAAAGTATAGGAGTGGAGAGG + Intergenic
1203305460 22_KI270736v1_random:105963-105985 TGAAAGGAAGAGGAATGGAGTGG + Intergenic
950182181 3:10921980-10922002 TAAAACTGATAGAACTGGAGGGG + Intronic
951772394 3:26273132-26273154 AGAAATGTATAGAACTGAAGTGG - Intergenic
952419033 3:33114640-33114662 AGCCAGGTCTAGAACTGGAGGGG - Intronic
953544291 3:43852462-43852484 TGCAAGGCAGAGTACTGGAGAGG - Intergenic
956059594 3:65336080-65336102 TGGGAGGTTTGGAACTGGAGTGG + Intergenic
959003556 3:100993121-100993143 TGAAAAGTAAATAACAGGAGGGG + Intronic
959574809 3:107923476-107923498 TGAAAATTTTAGAATTGGAGTGG - Intergenic
960058610 3:113295871-113295893 TGACAGTTTTAGAAATGGAGTGG - Intronic
960506202 3:118497754-118497776 GTAAAGATTTAGAACTGGAGAGG + Intergenic
962186278 3:133263214-133263236 TTAAAGGGAAGGAACTGGAGTGG + Intronic
962387107 3:134940468-134940490 TGAAAGATATGAAGCTGGAGAGG - Intronic
966022632 3:175234530-175234552 AGAAAGGGAAAGAAATGGAGAGG + Intronic
966549477 3:181188125-181188147 TGACAGGTAGAGAACAGGAAAGG + Intergenic
966922803 3:184625087-184625109 TGAGAGGTATAGAAATTGAATGG + Intronic
970879903 4:20916918-20916940 TGAAAGGGAAAGGACAGGAGGGG - Intronic
971397274 4:26240387-26240409 TGAATGTTATTGATCTGGAGAGG - Intronic
975384523 4:73740241-73740263 TGACAGATATAGTACTAGAGTGG - Intergenic
975640974 4:76500154-76500176 AGGAGGGTATAGATCTGGAGCGG - Intronic
976517768 4:85989971-85989993 TAAAAGGTATAAAATTGGAAAGG + Intronic
976878604 4:89889892-89889914 TCCAAGGTATAGAAATGCAGGGG - Intronic
977441531 4:97073941-97073963 TTAAAAGTATAGATCTAGAGAGG + Intergenic
978198466 4:105997672-105997694 TGAAAGATAAAGGACTTGAGAGG + Intronic
978295623 4:107201468-107201490 AGAAAGATATAGAACTATAGGGG - Intronic
979353401 4:119673080-119673102 TGTAAGGTATAGAAGTGGCAAGG + Intergenic
981031053 4:140126317-140126339 TGAAACGTATGGAAGAGGAGGGG - Intronic
981595501 4:146416991-146417013 GGAAAGGGATAAAACTAGAGGGG - Intronic
982940151 4:161540319-161540341 TGAAAGGTACCTAACTGGAAAGG - Intronic
987390200 5:17368290-17368312 TGAAAGGACTGGACCTGGAGTGG - Intergenic
989262200 5:39430767-39430789 TGAAAGATCTAGAACTGCACAGG + Intronic
990285670 5:54298554-54298576 AGAAAGGGCTGGAACTGGAGGGG - Intronic
990839960 5:60067171-60067193 TGAAAGATATAGAACTGCTCAGG - Intronic
991942801 5:71869495-71869517 TTTAAGGTATAAAAATGGAGAGG - Intergenic
993966214 5:94364213-94364235 TGAGAGCTACAGAACTGGAGAGG + Intronic
995680289 5:114710063-114710085 TGATAGGTATAGAACTGGCTTGG - Intergenic
998525446 5:142838851-142838873 TCAAAGCTGTAGAACTGGATAGG + Intronic
999004149 5:147957521-147957543 TAAGAGGGATAGAACTGGATGGG + Intergenic
1000807623 5:165816000-165816022 TAAATGGTATAGTATTGGAGTGG - Intergenic
1003721967 6:8713537-8713559 TGAAAGGTATTGAACTGCACAGG - Intergenic
1004191594 6:13468812-13468834 TGAAAAGCAGAGAACTGGAAGGG - Intronic
1004455501 6:15788072-15788094 TAAAAAGCATAGAGCTGGAGAGG - Intergenic
1004633116 6:17440466-17440488 TGAAAGGTATAAAAAGGAAGAGG - Intronic
1004967350 6:20868832-20868854 TGAATGCTATGGAACTGCAGAGG + Intronic
1005992400 6:30911513-30911535 TGAAAGGTATAGAGATGGGAAGG + Intronic
1007059354 6:38923441-38923463 TGAAGCATAGAGAACTGGAGTGG - Intronic
1011865229 6:91817141-91817163 TGAAAGGTAAAAATCTGGAAAGG - Intergenic
1013051434 6:106539300-106539322 TGAGAGGAAAAGAACAGGAGAGG - Intronic
1013711118 6:112900316-112900338 TGAAAGGAATAGAAAGGGAAGGG - Intergenic
1014239584 6:119000770-119000792 AGACAGGAATAGAATTGGAGTGG - Intronic
1014600130 6:123401154-123401176 TGACATCTATAGAACTGTAGAGG - Intronic
1014729246 6:125011753-125011775 TGAAAAGTAAAGAACTAGATGGG - Intronic
1016427998 6:143954755-143954777 TGAAAGGCATAAAATTGGAATGG + Intronic
1016718654 6:147266163-147266185 GGTAAGGGATGGAACTGGAGAGG + Intronic
1019967851 7:4514626-4514648 GGCAAGGTATGGAACTGGAGTGG - Intergenic
1020702990 7:11506724-11506746 GGAAAGTGTTAGAACTGGAGGGG - Intronic
1021054037 7:16024883-16024905 TGAAAGGAAAAGAATGGGAGAGG - Intergenic
1021861336 7:24909032-24909054 AGAAAAGTAGAGAACTTGAGGGG - Intronic
1023277713 7:38538425-38538447 TGGGAGGTGTGGAACTGGAGTGG + Intronic
1023613940 7:41999530-41999552 TGAAAGGTGTAAAAGAGGAGTGG - Intronic
1027222392 7:76222466-76222488 TGAAGGGTATTGAGCTGGGGAGG - Intronic
1027690527 7:81339011-81339033 TGAACGGTATTGACCTTGAGTGG + Intergenic
1029311346 7:99668276-99668298 TAAAAGCTAAAGAAATGGAGAGG + Intronic
1029427266 7:100503647-100503669 TGAAAAGATTAGAACTAGAGGGG + Intergenic
1032006476 7:128305867-128305889 TGAGAGGAATAAAACTGGACAGG + Exonic
1032545951 7:132742764-132742786 TGAAGGGTATTAAACAGGAGAGG - Intergenic
1033575894 7:142684549-142684571 TGCAAAGTATAGAACAGTAGGGG + Intergenic
1034626209 7:152494770-152494792 TATAAGGCAGAGAACTGGAGAGG + Intergenic
1037211573 8:16394560-16394582 TGTATGGTATAGGACAGGAGAGG - Intronic
1038049848 8:23798349-23798371 AGAGAGGGAGAGAACTGGAGAGG - Intergenic
1039009011 8:33072826-33072848 TAAAAAGTATAAAACTGCAGTGG - Intergenic
1039092763 8:33849923-33849945 AAAAAGGTATAAAACTGGAGGGG + Intergenic
1043083008 8:75789715-75789737 TGAAAGTTACAGAACTGAAAAGG - Intergenic
1043934793 8:86130857-86130879 TGAAAGGGGAAGAACTGGGGTGG - Intronic
1044693660 8:94902126-94902148 TGAAAGGTATAGCCCGGGCGTGG + Intronic
1044997446 8:97850439-97850461 TGAAGTGTGTAGAGCTGGAGAGG + Intronic
1046322161 8:112593990-112594012 TGAAAGGAATAGTACAGGGGAGG + Intronic
1046350251 8:113000034-113000056 TTAAAGCTATGGAACTGCAGGGG + Intronic
1047104152 8:121714864-121714886 TGAAAAGGACAGAACTGCAGAGG - Intergenic
1048018221 8:130516288-130516310 GGAAAGGCATAGAGATGGAGTGG - Intergenic
1048545624 8:135384532-135384554 TCAAATTTATAGAACTGGAAGGG - Intergenic
1049242399 8:141544692-141544714 TGAAAGGGAGAGAAATGAAGAGG + Intergenic
1052803761 9:32994013-32994035 TGAAAGATATAGAGCTGGGCCGG - Intronic
1060766272 9:126296807-126296829 AGAGAGGCTTAGAACTGGAGTGG - Intergenic
1060889021 9:127176615-127176637 TGAAGGCTATTGAACTGAAGAGG - Intronic
1203386521 Un_KI270438v1:60516-60538 TGGAAAGTATAGGAGTGGAGTGG + Intergenic
1203342915 Un_KI270442v1:10707-10729 TGAAATGTGTTGAAGTGGAGTGG + Intergenic
1203347976 Un_KI270442v1:48745-48767 TGGAAGGTAAAGGAGTGGAGTGG + Intergenic
1186897626 X:14020270-14020292 TGAAATGTGAAGAACTGCAGGGG + Exonic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188088434 X:25931900-25931922 TTATGGGTATAGAACTGGAGAGG - Intergenic
1190484519 X:50911139-50911161 TGGAAGGGAGAGAAGTGGAGAGG + Intronic
1191996468 X:67101088-67101110 TAAAAGTTATAGAACTGTAGTGG + Intergenic
1193087199 X:77457453-77457475 TTAAAGTCATAGAACTGGAAAGG - Intergenic
1197536606 X:127696516-127696538 TGAAAAGTATATGACTGGACAGG + Intergenic
1198239746 X:134772810-134772832 TAAATGGCATAGAATTGGAGGGG - Intronic
1201099812 Y:10662949-10662971 TGGATGGTAAAGAAGTGGAGTGG - Intergenic
1201104669 Y:10754649-10754671 TGGAATGTATTGAAATGGAGTGG - Intergenic
1201110382 Y:10794903-10794925 TGAAATGTAATGAAATGGAGTGG - Intergenic
1201129495 Y:10941885-10941907 TGAAAGGAATAGAATTGAATGGG - Intergenic
1201130615 Y:10949212-10949234 TGAAAGGGATAGGAGTAGAGTGG - Intergenic
1201136999 Y:10997566-10997588 TGAAATGGAGTGAACTGGAGTGG - Intergenic
1201138671 Y:11010032-11010054 TGAAATGGATTGAAGTGGAGTGG - Intergenic
1201140955 Y:11027575-11027597 TGGAAGGGAAAGAAGTGGAGTGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic