ID: 1105775145

View in Genome Browser
Species Human (GRCh38)
Location 13:23653080-23653102
Sequence TAGCACAGGGGGCAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105775145_1105775154 16 Left 1105775145 13:23653080-23653102 CCAGCTTCCTGCCCCCTGTGCTA 0: 1
1: 0
2: 2
3: 30
4: 369
Right 1105775154 13:23653119-23653141 CTGCTTCCCACAGAGGATCAAGG 0: 1
1: 0
2: 1
3: 20
4: 264
1105775145_1105775155 21 Left 1105775145 13:23653080-23653102 CCAGCTTCCTGCCCCCTGTGCTA 0: 1
1: 0
2: 2
3: 30
4: 369
Right 1105775155 13:23653124-23653146 TCCCACAGAGGATCAAGGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 169
1105775145_1105775153 9 Left 1105775145 13:23653080-23653102 CCAGCTTCCTGCCCCCTGTGCTA 0: 1
1: 0
2: 2
3: 30
4: 369
Right 1105775153 13:23653112-23653134 TAGACATCTGCTTCCCACAGAGG 0: 1
1: 0
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105775145 Original CRISPR TAGCACAGGGGGCAGGAAGC TGG (reversed) Intronic
900314339 1:2049698-2049720 GAGCCCAGGAGGCAGGGAGCTGG + Intergenic
900415057 1:2530990-2531012 GAGGACAGGGTGCAGGAAGCGGG - Intergenic
900734918 1:4293450-4293472 TAGCTCAGGGGGCAGTAAGAGGG - Intergenic
901232966 1:7651461-7651483 GAGCAGAGGGGACAGGTAGCTGG + Intronic
901807963 1:11749726-11749748 TGGCACAGGGGCCAGGAGCCTGG + Intronic
901822711 1:11840442-11840464 GAACACAGGGAGCAGGAAGTGGG - Exonic
902434074 1:16385919-16385941 AAGCACAGTGGGGAGGAAGGTGG - Intronic
903227645 1:21902763-21902785 AGGCCCAGAGGGCAGGAAGCTGG + Intronic
903466292 1:23554665-23554687 TCGCGGACGGGGCAGGAAGCGGG + Intergenic
903661989 1:24984037-24984059 TAGGTCAGAGGGCAGGAAGCTGG + Intergenic
904332764 1:29773649-29773671 TAGCACAAGGGACAGGAGGAAGG - Intergenic
904858316 1:33516548-33516570 TTCCCCAGGGGGCAGGAAGTAGG - Exonic
905172935 1:36119688-36119710 CAGCACAGTGGGAAGGAAGGAGG + Intronic
905474875 1:38219031-38219053 TATCACAGAGGGAAAGAAGCTGG - Intergenic
905903214 1:41596024-41596046 AAGCACAGGGGGCTGGAATGTGG + Intronic
906267851 1:44447835-44447857 CAGCACAGGCAGCATGAAGCAGG - Intronic
907391861 1:54163393-54163415 CAGCAAAGGGGGTAGGAAGAGGG - Intronic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
910035190 1:82780134-82780156 TGGCCCAGGGGCCAGCAAGCTGG - Intergenic
910427077 1:87129062-87129084 TAGCACAGGGGTCAGGAGATGGG + Intronic
912525771 1:110281479-110281501 TAGCAATGGGGGCGGGAAGGGGG + Intronic
913346423 1:117815385-117815407 GTGGACTGGGGGCAGGAAGCTGG + Intergenic
914706070 1:150170884-150170906 TATGAGAGGGGACAGGAAGCAGG - Intergenic
916242122 1:162650673-162650695 TAGCACAGGAGGGAAGAAGGAGG - Intronic
917631426 1:176894662-176894684 TGACACAGGGGGCAGGACGAGGG + Exonic
918150797 1:181796687-181796709 CCGCTCAGGGGGCAGGGAGCGGG + Exonic
918434373 1:184496104-184496126 TAGAAAAGGGGGCAGGTAACAGG + Intronic
919198766 1:194324002-194324024 TATCACAAGGGGCAGGAGGGAGG + Intergenic
919231160 1:194776295-194776317 TGGCTCAGGGGACAGGCAGCAGG - Intergenic
919767431 1:201136332-201136354 TTGCCCAGGGGACAGGAAGAAGG + Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919883218 1:201914671-201914693 TAGAAGAGGTGGCAGGAAGTTGG - Intronic
920227919 1:204451254-204451276 TAGCAAAGGGGAGAGGGAGCTGG + Intronic
920839024 1:209538238-209538260 TAGCACAGGGCACTGGAATCAGG - Intergenic
920997630 1:211010477-211010499 TAGCACTGGGGGAGGGAAGAAGG - Intronic
921408517 1:214809161-214809183 TATCTCAGGAAGCAGGAAGCAGG - Intergenic
921434674 1:215104514-215104536 ATGCACAGGAGGCAGCAAGCAGG - Intronic
922075436 1:222238998-222239020 CAGGACATGGGGCAGGTAGCTGG - Intergenic
922673851 1:227538247-227538269 AAGCAGAGGTGGCAGGAAGGAGG + Intergenic
922794620 1:228333912-228333934 TGGCACAGGCGGCCGGAAGTTGG + Intronic
924380759 1:243462115-243462137 TAGCACAGAGGGAATGAAGGGGG + Intronic
924458437 1:244236965-244236987 AAGCAGAGTGGGTAGGAAGCAGG + Intergenic
924632549 1:245754484-245754506 GGGCACAGGGAGGAGGAAGCTGG + Intronic
924691104 1:246351736-246351758 TAGAAGCGGGGGAAGGAAGCTGG + Intronic
1062906588 10:1183681-1183703 CATCACAGTGGGCAGGGAGCAGG + Intronic
1064013678 10:11756627-11756649 TAGGACAGTGGGCTGGAAGTGGG + Intronic
1066065023 10:31755667-31755689 TAGGACAGGAGGCGGGGAGCAGG - Intergenic
1067441416 10:46311020-46311042 GAGCACAGGGGCCAGGAGTCCGG + Intronic
1069714601 10:70512616-70512638 TAGGACAGTGGCCAAGAAGCGGG + Intronic
1070159247 10:73855667-73855689 GAGCCCAGGTGGGAGGAAGCCGG + Intronic
1070547777 10:77466006-77466028 GAGCTCAGTGGGCAGGAAGTAGG + Intronic
1071404538 10:85317564-85317586 TAGAGAAGGGGGCAGGAAGAGGG - Intergenic
1071964419 10:90837590-90837612 TAGCACAGTGTTCTGGAAGCTGG - Intronic
1072692469 10:97581013-97581035 TGGCACAGGTGGCAGGGAGAGGG - Intronic
1073412105 10:103350875-103350897 CAGCTCAGGGGGCCGGGAGCCGG + Exonic
1073575303 10:104618086-104618108 GACCAGAGGAGGCAGGAAGCAGG - Intergenic
1074163870 10:110857969-110857991 AGGCACATGGGGCAGGAGGCCGG - Intergenic
1074771538 10:116738032-116738054 TAGAACAGCGGGGAGGAATCAGG - Intronic
1075094544 10:119462219-119462241 TGGCACGGGGAGCAGGAACCTGG - Intergenic
1075311931 10:121421687-121421709 GGTCACAGGGGGCAGAAAGCGGG - Intergenic
1075539477 10:123300115-123300137 CAGCCCAGGGGACAGAAAGCTGG + Intergenic
1075922037 10:126221707-126221729 TGTCACAGGGGGCAAGAAGCAGG + Intronic
1075951582 10:126482308-126482330 TGGAACAGGTGGCAGGATGCAGG + Intronic
1077407612 11:2389624-2389646 CAGCAGCTGGGGCAGGAAGCAGG - Intronic
1077501941 11:2913273-2913295 TCCCACAGTGGGCAGGCAGCAGG + Intronic
1079392703 11:20036217-20036239 GAGCAGAGGCGGCAGGAGGCTGG - Intronic
1080035293 11:27703161-27703183 AAGGACAGAGGGCATGAAGCTGG + Intronic
1081462104 11:43281419-43281441 TAGAGCAGGAGGCAGGAAGATGG - Intergenic
1084176413 11:67424599-67424621 TAGCACTGGGGTCAGGGGGCAGG + Exonic
1084230001 11:67744704-67744726 GGGCACAGGGGTAAGGAAGCTGG - Intergenic
1084548047 11:69824153-69824175 TTGGACAGTGGGCAGGAGGCAGG + Intergenic
1085468167 11:76738232-76738254 TAGGACTGGGAGCAGGGAGCTGG - Intergenic
1085472813 11:76769019-76769041 AGGTACAGTGGGCAGGAAGCAGG + Intergenic
1087022280 11:93615498-93615520 AAGCCCAGGGGGCAGAGAGCAGG - Intergenic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089645296 11:119874878-119874900 CAGCAGAAGGGGCCGGAAGCTGG - Intergenic
1090386074 11:126358178-126358200 GAACTGAGGGGGCAGGAAGCAGG - Intronic
1090418854 11:126559540-126559562 GAGCACAGGGTGCAGGGAGAGGG + Intronic
1091088884 11:132750382-132750404 AACCACAGGAGGCAGGAAACAGG + Intronic
1091217904 11:133914733-133914755 CAGAACAGGAGGGAGGAAGCAGG + Intronic
1091401206 12:181871-181893 TAGAGCAGGGGGCAGCAGGCGGG + Intergenic
1092282330 12:7108019-7108041 GAGCAAAGAGGGCAGCAAGCAGG - Intronic
1092767262 12:11863787-11863809 TAACAGAGGCGGCAGGCAGCAGG + Intronic
1094479705 12:30871882-30871904 TAGCAGAGAGGGCACCAAGCTGG - Intergenic
1095509146 12:42930276-42930298 GAGCACAGGTGGGAGGCAGCTGG + Intergenic
1095633590 12:44405593-44405615 CAGCAGAGTGGGCAGGCAGCAGG + Intergenic
1095651924 12:44621140-44621162 TAGCACATGTGGCAGCAAGGAGG - Intronic
1096211829 12:49772385-49772407 TTGCACAGTTGGCAGGTAGCTGG - Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096785358 12:54014263-54014285 AAGCACAGGCTGCAGGCAGCTGG + Intronic
1097274339 12:57802087-57802109 CAGCTCAGTGGGCAGGAAGGTGG - Intronic
1099975767 12:89544174-89544196 TAACACATGGTTCAGGAAGCTGG - Intergenic
1100225313 12:92550416-92550438 TTGCACATGGGGCAGGAGACTGG - Intergenic
1102001539 12:109560908-109560930 CTGCACAGCGGGCAGGAGGCAGG - Intronic
1103256373 12:119544826-119544848 TAGCAGAGGGGGCTGGAGGTCGG - Intergenic
1103794614 12:123494695-123494717 TATGACAGTGGGAAGGAAGCTGG - Intronic
1104015332 12:124958065-124958087 GGGCACAGGGGCCAGGGAGCTGG + Intronic
1104062784 12:125282237-125282259 CATCGCAGGGGGCAGGGAGCTGG - Intronic
1105227209 13:18447256-18447278 TCACACAGGGGTCAGGAAGCAGG + Intergenic
1105308991 13:19189706-19189728 CAGGACATGGGCCAGGAAGCTGG + Intergenic
1105328954 13:19396547-19396569 CAACACAGGGAGCAGAAAGCAGG - Intergenic
1105439409 13:20402899-20402921 GGGCACATGGGGCAGGCAGCTGG + Intergenic
1105528611 13:21198445-21198467 CAGGACATGGGCCAGGAAGCTGG - Intergenic
1105775145 13:23653080-23653102 TAGCACAGGGGGCAGGAAGCTGG - Intronic
1107769582 13:43775680-43775702 AAGCAGAGAGAGCAGGAAGCTGG - Intronic
1109311167 13:60695328-60695350 GAGCACAGGGGGCAGGGGGATGG + Intergenic
1109417959 13:62068636-62068658 TGGCACGGGGTGGAGGAAGCAGG + Intergenic
1112043882 13:95575975-95575997 TAGCCAGGGGAGCAGGAAGCAGG - Intronic
1112088239 13:96053642-96053664 TAGGACACGGGGCGGGAAGCTGG + Intergenic
1113534248 13:111051608-111051630 TAGCGCAGCTGGCAGGCAGCTGG + Intergenic
1113593956 13:111518319-111518341 TACCACAGGGAGCAGGAAGCCGG - Intergenic
1114829638 14:26124975-26124997 AAGCACAGGGGCCAGCTAGCTGG - Intergenic
1115832507 14:37357987-37358009 CCTCTCAGGGGGCAGGAAGCTGG - Intronic
1116336563 14:43665300-43665322 TAGCTGAAGGGGAAGGAAGCTGG + Intergenic
1117100457 14:52340817-52340839 CAGCACTGAGGGGAGGAAGCAGG - Intergenic
1117149551 14:52871747-52871769 TAGCCCAGGCTGTAGGAAGCAGG + Intronic
1118891807 14:69916298-69916320 CAGCAGAGGTGGCAAGAAGCGGG - Intronic
1119872390 14:78028721-78028743 TGGCACAGATGACAGGAAGCTGG - Intergenic
1119897438 14:78232062-78232084 GATGCCAGGGGGCAGGAAGCAGG - Intergenic
1120122692 14:80701091-80701113 TAGAACAAGGGCCAAGAAGCTGG - Intronic
1122531639 14:102431970-102431992 GAGCCCAGGGGGCAGGAGCCCGG - Exonic
1122815530 14:104310293-104310315 ATGCACAGTTGGCAGGAAGCTGG + Intergenic
1125501568 15:40242892-40242914 AAGCACTGGTGGCAGGAAGAGGG + Intronic
1126583660 15:50262856-50262878 TAAGACAGGGGAGAGGAAGCTGG - Intronic
1127168698 15:56275615-56275637 TAGCACAAAGGGCAAGAGGCTGG - Intronic
1127233127 15:57018387-57018409 TAGCTCAAGAGGCAGGAAGTAGG + Intronic
1128247149 15:66140808-66140830 GTGCACAGCTGGCAGGAAGCGGG + Intronic
1128805569 15:70528491-70528513 GGGCACAGGGTGCATGAAGCCGG + Intergenic
1129276942 15:74451978-74452000 TAGGTCAAGGGGCAGTAAGCAGG + Intronic
1129605447 15:77022823-77022845 CAGCCCAGGGGACAGGAAGAGGG + Intronic
1129732684 15:77941000-77941022 TAGCATGGAGGGCAGGAGGCTGG - Intergenic
1130462088 15:84167282-84167304 TAGCATAGGAGCGAGGAAGCAGG + Intergenic
1130490589 15:84427491-84427513 TAGCATAGGAGTGAGGAAGCAGG - Intergenic
1130502177 15:84506261-84506283 TAGCATAGGAGCGAGGAAGCAGG - Intergenic
1130520458 15:84657561-84657583 TGGCACAGCTGGCAGGAAGGTGG + Intronic
1130856201 15:87841748-87841770 TGGCCAAGGTGGCAGGAAGCTGG + Intergenic
1132752451 16:1465048-1465070 GAGTGCAGGGCGCAGGAAGCCGG - Intronic
1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG + Intronic
1133222293 16:4323960-4323982 TGGCACAGGGGGCTGTAACCAGG + Intronic
1133265799 16:4582915-4582937 TAGCACAAGAGCCAGGAAGCTGG - Intronic
1133271587 16:4613251-4613273 GGGCACAGGGGGCAGTAAGCTGG + Intronic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1135461378 16:22646388-22646410 AAGCACAGTGGGCAGGGAACTGG - Intergenic
1137035695 16:35567986-35568008 AATCCCAGTGGGCAGGAAGCAGG + Intergenic
1137536389 16:49329948-49329970 AATCACAGGGGCCAGGGAGCAGG - Intergenic
1137646546 16:50080071-50080093 GAGCACAGGGGCCTGGCAGCAGG + Intronic
1140199005 16:72879396-72879418 AAGCACAGTGGGCAGCAAGGAGG + Intronic
1140746308 16:77983323-77983345 AAGCACAGAGGGCAGGAGGTAGG + Intergenic
1141289385 16:82703745-82703767 TAGCAGAGGGGGCAGCCAGAAGG - Intronic
1141952283 16:87346731-87346753 GGGCACAGGGGGCGGGAGGCAGG + Intronic
1142104375 16:88294477-88294499 GAGCCCAGAGGGCAGGAGGCAGG - Intergenic
1143163523 17:4886254-4886276 GAGCACAGAGGGCATGAAGGTGG - Intronic
1143778954 17:9219415-9219437 GATCATAGGGAGCAGGAAGCAGG + Intronic
1144930410 17:18854438-18854460 GAGGACAGGAGGCAGGAAGCAGG + Intronic
1145871220 17:28275056-28275078 GGGAACAGGGGACAGGAAGCAGG + Intergenic
1146683246 17:34823625-34823647 TAGCACAGAGGTCAAGATGCAGG - Intergenic
1147566239 17:41537971-41537993 TTGCACTGAGGTCAGGAAGCTGG + Intergenic
1148349719 17:46931782-46931804 GAGAACAGGGGACAGGAAGCAGG - Intronic
1148720573 17:49749898-49749920 TAGCACATTGGGGTGGAAGCAGG - Intronic
1148739943 17:49887185-49887207 AAGCACATGGGGGAGGAAGCAGG - Intergenic
1151596571 17:75081752-75081774 TTTCACAGGCGGGAGGAAGCAGG + Intergenic
1151684757 17:75639967-75639989 CAGCTCAGGGTGGAGGAAGCCGG - Exonic
1152468104 17:80476850-80476872 GAGCTCAGGGGGAAGGAAGTCGG + Intronic
1152520685 17:80854402-80854424 CAGCTCAGGCAGCAGGAAGCTGG + Intronic
1152913433 17:83018982-83019004 AACGTCAGGGGGCAGGAAGCAGG - Intronic
1203163280 17_GL000205v2_random:71269-71291 TAGCCCAGGGGGCAGGGCACAGG - Intergenic
1153476867 18:5506529-5506551 GAGAAAAGGGGGCAGGAAACGGG - Intronic
1154526169 18:15292219-15292241 TCACACAGGGGTCAGGAAGCAGG - Intergenic
1155142055 18:23052606-23052628 TCTCAGAGGGGGCAGGAAGGAGG - Intergenic
1156856884 18:41792367-41792389 TAGCACATGGAGCAGGAAGTGGG - Intergenic
1157493718 18:48140859-48140881 TGGCAGAGGTGGCAGGAAGAGGG - Intronic
1157807009 18:50665644-50665666 CATCACAGGGGGCAGGGAGCAGG + Intronic
1157847551 18:51017743-51017765 CAGCACAGAGGGAAGGAAGGGGG + Intronic
1158559244 18:58499698-58499720 GAGCACAGGAGGCAGGACCCAGG - Intronic
1160393751 18:78557427-78557449 TAGAACAGCTGGCAGGAAGCAGG + Intergenic
1160871162 19:1278608-1278630 TTGCACAGGGCCCAGGAGGCCGG + Intronic
1161349767 19:3785230-3785252 TGGCACAGGAGGTAGGGAGCTGG + Intronic
1161355452 19:3816899-3816921 TAGCTCAGGAGGGAGGCAGCTGG - Intronic
1161428003 19:4215077-4215099 TGGCACATAGGCCAGGAAGCTGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1163440410 19:17319958-17319980 GAGAACTGGGGGCAGGAATCGGG - Exonic
1164109135 19:22138100-22138122 CAGCTCAGGGGGCCGGGAGCCGG - Intergenic
1164595511 19:29528836-29528858 GGGCAGAGGGGGCGGGAAGCTGG - Intronic
1165364025 19:35352888-35352910 TAGGAGAGGAGGCAGGAGGCAGG + Exonic
1165424194 19:35736999-35737021 CCCCACAGGGGGCAGGGAGCTGG + Intronic
1166051555 19:40263792-40263814 TCAAAGAGGGGGCAGGAAGCTGG - Intronic
1166309986 19:41957382-41957404 TAGTCTAGGGAGCAGGAAGCCGG - Intronic
1167681195 19:50922542-50922564 GAGCAGAGGTGGCAGGAAGCAGG + Intergenic
1168294098 19:55370335-55370357 CAGGGCAGGGGGCAGGGAGCCGG + Exonic
925058113 2:871115-871137 TGACACAGGCGGCAGGAAGACGG + Intergenic
925058153 2:871334-871356 TGACACAGGTGGCAGGAAGACGG + Intergenic
925324527 2:3007566-3007588 CAGCCCAGGGCGCAGGAAGATGG + Intergenic
925549264 2:5052627-5052649 GATTACAGGGGGCTGGAAGCAGG + Intergenic
925716083 2:6785670-6785692 AAGCACAGTGAGGAGGAAGCAGG + Intergenic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926096585 2:10085032-10085054 TAGCTGAGCAGGCAGGAAGCTGG + Intronic
926357876 2:12057609-12057631 AACCACAGGGGGCCGGCAGCAGG + Intergenic
927201016 2:20578122-20578144 TGGCAAGGGGTGCAGGAAGCAGG + Intronic
927519496 2:23690380-23690402 AAGAGCAGGGGGCAGGGAGCTGG - Intronic
928435896 2:31254211-31254233 GAGCACAGGGGGTAGGAATGAGG + Intronic
929792337 2:45032825-45032847 TAGGACTGGGGGCTGGAGGCAGG - Intergenic
931227395 2:60343472-60343494 TAGCATAAAGGGCAAGAAGCAGG + Intergenic
931767689 2:65471335-65471357 TATCTCTGGGGGCATGAAGCAGG - Intergenic
932183806 2:69673995-69674017 AAGCACAGTGGGCAGCCAGCTGG - Intronic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
932477171 2:72013525-72013547 TAGCCCAGGGGTCAGACAGCAGG - Intergenic
932576167 2:72963524-72963546 TAGGACAGGGGGAAGGGAGGGGG + Intronic
932744821 2:74325377-74325399 TAGCACAGAGGACATGAAGCAGG - Intronic
933327381 2:80855370-80855392 AAGCACATGGGGCAGGATCCAGG - Intergenic
934572941 2:95383658-95383680 CACCTCAGGGGGCAGGATGCTGG + Intronic
935175132 2:100642617-100642639 GAGCACTGTGGGCAGGCAGCCGG - Intergenic
937013284 2:118580997-118581019 CAGAACAGGGGGCAGGATGGAGG - Intergenic
937983243 2:127627102-127627124 TCTGACAGGGGGCAGGGAGCAGG + Intronic
938180338 2:129176595-129176617 GAGTACAGAGGGCAGGAATCAGG - Intergenic
938525272 2:132123584-132123606 TCACACAGGGGTCAGGAAGCAGG - Intergenic
943082032 2:183267185-183267207 GAGAAAAGGGGGCAGGAACCAGG + Intergenic
944144836 2:196495791-196495813 TAGCACAGGGCACAGGCAGCTGG + Intronic
945419261 2:209614778-209614800 TAGCACAGTGGGGACTAAGCTGG - Intronic
946289428 2:218732705-218732727 TAGGGCAGTGGGCAGGATGCGGG + Intronic
947008166 2:225536325-225536347 AATGACAAGGGGCAGGAAGCAGG - Intronic
948044855 2:234935784-234935806 TGGCAGTGGGGGCAGGAAGCAGG - Intergenic
948193976 2:236081230-236081252 AAGGACAGTGGGCAGGAGGCCGG + Intronic
1168897024 20:1330845-1330867 TAGAAGAGGGAGGAGGAAGCAGG + Intronic
1169265131 20:4162819-4162841 GAGGACAGGAGCCAGGAAGCAGG - Intronic
1171490270 20:25511939-25511961 GAGCACAGAGAGCAGGAACCAGG + Intronic
1171724482 20:28603303-28603325 AAGCTCAGGGGTCAGGAAGAAGG + Intergenic
1171785150 20:29457211-29457233 GAGCACAGGGTGCGGGAGGCAGG + Intergenic
1172094781 20:32455308-32455330 TAGCACAGGTGGCTGGGAGCAGG - Intronic
1172096013 20:32460873-32460895 TGGCTCAGGGGCCAGAAAGCTGG - Intronic
1172606943 20:36220442-36220464 TTGCACTGGGGGCAGGGAGGTGG + Intronic
1172837716 20:37883609-37883631 TAGCATCACGGGCAGGAAGCTGG + Intergenic
1173007370 20:39150657-39150679 CAGTACAGGGGGCAGGCAGAGGG + Intergenic
1173615885 20:44402715-44402737 GAGGAGAGGGGGCAGGCAGCTGG + Intronic
1173729224 20:45317040-45317062 CAGCAAAGGGGCAAGGAAGCAGG - Exonic
1174100864 20:48125240-48125262 TAGTTCAAGGGTCAGGAAGCTGG - Intergenic
1175158678 20:56991943-56991965 TAGCATGGTGGGAAGGAAGCAGG - Intergenic
1175287458 20:57846496-57846518 GGGCACAGGGAGAAGGAAGCAGG - Intergenic
1175547128 20:59785567-59785589 AAGCGCAGAGGGGAGGAAGCGGG + Intronic
1175961910 20:62641790-62641812 CAGGACAGACGGCAGGAAGCCGG + Exonic
1176083314 20:63284718-63284740 AAGCGCAGGGAGCAGGAAACGGG - Intronic
1176771253 21:13076270-13076292 TCACACAGGGGTCAGGAAGCAGG + Intergenic
1178891131 21:36522127-36522149 AAGCACAGGGGCCAGGGAGTGGG - Intronic
1179725124 21:43337707-43337729 CAGTACAGGTGGCAGGAAGAGGG - Intergenic
1180595133 22:16968034-16968056 TAGCAGAGGGTGCAGAATGCTGG - Intronic
1181011451 22:20043229-20043251 TCTCAGAGAGGGCAGGAAGCCGG - Intronic
1181274942 22:21682370-21682392 TGGCACAGGGGACTGCAAGCAGG - Intronic
1182401008 22:30078033-30078055 TAGCACAGGGGCCAGGCACAGGG + Intergenic
1182936291 22:34225225-34225247 TAGCAGAGGAGGCGGGAACCTGG + Intergenic
1183064185 22:35352433-35352455 TAGGGCAGGGGGCAGGGGGCAGG - Intergenic
1183200086 22:36380009-36380031 AAGCACAAGGGACAGGGAGCTGG + Intronic
1184279648 22:43429709-43429731 TAGCACAGGGAATAGGAAGCAGG + Intronic
1184392762 22:44214424-44214446 CAGCACAGGGGCCAAGAAGATGG - Intronic
1185047550 22:48536683-48536705 CAGCACAGGGCACAGGGAGCCGG - Intronic
1185078193 22:48694585-48694607 CAGCACATGGGGCAGGGAGGAGG - Intronic
1185421285 22:50735670-50735692 CAGCACAGGGGGCAGGATGGGGG - Intergenic
949641755 3:6043839-6043861 AAGCAAAGGGAGCAGGAAGAAGG + Intergenic
949802361 3:7917566-7917588 TGGCATAGGGGGCAGGTATCAGG + Intergenic
952314685 3:32222357-32222379 TAGGCAAGGGGGCAGGAGGCAGG - Intergenic
953292191 3:41676826-41676848 CAGCATACTGGGCAGGAAGCAGG - Intronic
954460959 3:50626635-50626657 TGGCACAGGGGGCAGGGGGATGG + Intronic
955142730 3:56285592-56285614 TTGCCCTGGGGGCAGGAAGAAGG + Intronic
955232441 3:57110977-57110999 GAGCTCAGGTGGCAGGAGGCTGG - Intronic
959932480 3:111999291-111999313 CAGCAAAGAGGGCAGAAAGCCGG - Exonic
960452088 3:117822619-117822641 AAGCATAGGGGGAAGAAAGCTGG - Intergenic
961455681 3:127022821-127022843 AAGCAGAGGCGGGAGGAAGCAGG + Intronic
961603721 3:128078462-128078484 TAGCACAGGAGACAGGGCGCTGG + Intronic
961878634 3:130043797-130043819 GGGCACAGGGGTAAGGAAGCTGG - Intergenic
964637283 3:158871417-158871439 TAGCACCGATGGGAGGAAGCTGG - Intergenic
965870296 3:173256330-173256352 TAGCACAGGAGGAAGAGAGCTGG - Intergenic
966471073 3:180289535-180289557 TGGCACAGGGAGCAGTAACCTGG + Intergenic
966758543 3:183393852-183393874 TACAACAGAGGGCAGGAAACAGG + Intronic
966884988 3:184372587-184372609 GAGCAGAAGGGTCAGGAAGCAGG + Exonic
967529601 3:190533485-190533507 AAGCACAGGGGGGAGGGAGGAGG - Intronic
968735704 4:2295624-2295646 GAGCAGAGGGGACAGGGAGCAGG - Intronic
969110545 4:4841458-4841480 GAGCACAGAGGCCAGGAAGTGGG - Intergenic
969488979 4:7488069-7488091 TAGCACAGGGCTCAGGTACCGGG - Intronic
969703213 4:8779050-8779072 GAACACAGGGGGCAGGGGGCAGG - Intergenic
969824476 4:9746678-9746700 GGGCACAGGGGTAAGGAAGCTGG + Intergenic
972697824 4:41465194-41465216 CAGCACAGGGGGAAGAAAGTTGG - Intronic
973177074 4:47220355-47220377 TGGAACAGGGAGAAGGAAGCAGG - Intronic
975705626 4:77109512-77109534 TACCAGAGGGTGGAGGAAGCAGG - Intergenic
979548868 4:121967662-121967684 TATTCCTGGGGGCAGGAAGCGGG + Intergenic
980798469 4:137715785-137715807 AGGGACAGGAGGCAGGAAGCAGG + Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
986440685 5:7779037-7779059 TGGCATAGGGTGCAGGAAACAGG - Intronic
987292578 5:16522647-16522669 TAGAAGAGGGGGCTGGATGCTGG - Intronic
988504215 5:31807771-31807793 TAGAAGAGGGGCCAGGATGCTGG + Intronic
988816573 5:34840185-34840207 TAGTACAGGGGTCACGAGGCGGG - Intronic
991031139 5:62083522-62083544 TAGCAGAGACAGCAGGAAGCAGG + Intergenic
991124772 5:63057310-63057332 ATGCAGAGGGGGCAGGAAGGAGG - Intergenic
993299495 5:86189750-86189772 TAGCACAGGGCCCAGATAGCAGG - Intergenic
996451388 5:123629239-123629261 TAGCACAGGGGGCAGGGTGCTGG - Intergenic
996597146 5:125218210-125218232 TAGCCAAGGGGGAAGAAAGCAGG + Intergenic
996662450 5:126020469-126020491 TGGAACAGGAGGAAGGAAGCAGG - Intergenic
998232325 5:140368634-140368656 GAGCACAGGTGCCAGGAAGATGG - Exonic
998447657 5:142211086-142211108 TACCACAGCAGGCAGGCAGCTGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999248600 5:150168200-150168222 TAGCCTTGGGGGCGGGAAGCTGG + Intronic
999720926 5:154398721-154398743 TGGAACAGGGGGCAGGAATGGGG - Intronic
1000830633 5:166096986-166097008 TTGCACAGCAGGCAAGAAGCAGG - Intergenic
1001684515 5:173583528-173583550 TAGCCCAGGAGGAAGGCAGCTGG + Intergenic
1003535262 6:6970603-6970625 GCACACAGGGGGCAGGAAGAAGG - Intergenic
1003918226 6:10807264-10807286 TAGGAAAGGGGGCAGGGAGTTGG - Intronic
1004025919 6:11818480-11818502 TTCCACAGGTAGCAGGAAGCTGG - Intergenic
1007006504 6:38368686-38368708 TTGGACAGGGGGCAAGAAGGGGG - Intronic
1007782896 6:44264419-44264441 TAGCAGAGGAGGAAGTAAGCTGG + Intronic
1008031922 6:46706483-46706505 TAGCCAAGGGAGCAGGAAGAGGG + Intronic
1008680000 6:53861923-53861945 CAGCACAGAGGGATGGAAGCTGG + Intronic
1009293451 6:61913371-61913393 CAGCACTGGGGGCAGAAAACTGG + Intronic
1009315812 6:62219002-62219024 AAGCACAGGGGGGAAGAAGTGGG + Intronic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1012992237 6:105938027-105938049 TATCATAGAGGGCATGAAGCGGG - Intergenic
1013606711 6:111756957-111756979 TAGCACAGGGGATAGGAAGTAGG - Intronic
1015780189 6:136857583-136857605 TAGCACAGTGGTCAGGAACAAGG + Intronic
1015957462 6:138613636-138613658 TAGCACTGAAGGCAGGATGCAGG - Intronic
1016356120 6:143220083-143220105 TAGCTTAGGGGGCAGGGGGCAGG + Intronic
1018235297 6:161717838-161717860 GAGCACAGCGGGATGGAAGCGGG - Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018789128 6:167132469-167132491 TTAAACAGGGGGCTGGAAGCTGG - Intronic
1020313689 7:6888782-6888804 GGGCACAGGGGTAAGGAAGCTGG - Intergenic
1020652785 7:10895217-10895239 TGGCAGAGGGAGCATGAAGCAGG + Intergenic
1020797800 7:12697620-12697642 TATCACAGGGGGAAGCAAGTGGG - Intergenic
1021786390 7:24156815-24156837 GAGAAGAGGGGGAAGGAAGCAGG - Intergenic
1022311515 7:29200622-29200644 TGGCCCATGGGGAAGGAAGCTGG + Intronic
1022391803 7:29950170-29950192 GAGGTCAGGGAGCAGGAAGCAGG - Intronic
1025201905 7:56967383-56967405 GAGCAGAGGGGGCGGGAGGCAGG - Intergenic
1025212836 7:57030780-57030802 GAGCACAGGGGGCGGCAAGGAGG - Intergenic
1025659117 7:63546044-63546066 GAGCACAGGGGGCGGCAAGGAGG + Intergenic
1025670041 7:63609545-63609567 GAGCAGAGGGGGCGGGAGGCAGG + Intergenic
1026103526 7:67402356-67402378 TGGCAGAGGGGTAAGGAAGCAGG - Intergenic
1026456519 7:70577280-70577302 TAACAGATGGGCCAGGAAGCTGG - Intronic
1027400309 7:77799289-77799311 AAGGACAGGGGCCTGGAAGCGGG - Intronic
1028187527 7:87805102-87805124 TACCCCAGAGGGCTGGAAGCAGG + Intronic
1028659747 7:93255855-93255877 TAGCACATGAGGCATGAAGCAGG - Intronic
1032023153 7:128421323-128421345 TAGAACAGAGGGCAGGGGGCAGG + Intergenic
1032482595 7:132258593-132258615 GATCACAGGGGACAGGAAGGAGG - Intronic
1034898647 7:154893752-154893774 TAGCACTGGCGGGAGGAGGCTGG - Intronic
1035305495 7:157928867-157928889 TGGGACAGGGGGCAGGAGGGAGG + Intronic
1035724122 8:1813955-1813977 AAGGACAGGGGGCAGGATGGAGG + Intergenic
1038210492 8:25515022-25515044 CTACACAGGGGGCAGGAAGAAGG - Intergenic
1039659691 8:39448781-39448803 TGGCACAATGGGCAGGTAGCTGG - Intergenic
1041053069 8:53956269-53956291 TAGGGCTGGGGGCAGGCAGCAGG + Intronic
1041084719 8:54246075-54246097 TAGCCCAGTGGCCAGGCAGCCGG - Intergenic
1042174673 8:66027262-66027284 GAGGAGAGGAGGCAGGAAGCTGG - Intronic
1042747559 8:72123415-72123437 AAGAACACAGGGCAGGAAGCTGG + Intergenic
1044537898 8:93378483-93378505 TAGCACAGTGGGTAGGGAGTGGG + Intergenic
1045146043 8:99346003-99346025 TAGCAGAGTGGGCAGGCAGGTGG + Intronic
1045242708 8:100416461-100416483 AAGTACAGGAGGCAGGCAGCTGG - Intergenic
1045437813 8:102182077-102182099 TAGCACAGTGGGAAGGAAAAGGG - Intergenic
1045543142 8:103105118-103105140 TAGGCCAGGAGGCAGGAAACTGG + Intergenic
1045546324 8:103132129-103132151 TATCACAGAGGCCAGAAAGCAGG - Intergenic
1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG + Intronic
1048356471 8:133657913-133657935 GAGCTGAGGGTGCAGGAAGCTGG - Intergenic
1048871652 8:138804091-138804113 TAGGCCAGGGGGAAGGGAGCAGG - Intronic
1048977590 8:139681636-139681658 CAGCACAGCGGGCAGCAAGCTGG + Intronic
1049010269 8:139882646-139882668 CAGCACAGGGGGTAGGAGGGTGG + Intronic
1049589042 8:143447277-143447299 TTGGACAGTGGGAAGGAAGCTGG - Intronic
1049674733 8:143884394-143884416 GAGCAGAGGCTGCAGGAAGCCGG - Intergenic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1051346302 9:16153810-16153832 TGGGAAATGGGGCAGGAAGCTGG + Intergenic
1051671684 9:19516765-19516787 TTGCACAGGGTGAAGGGAGCAGG + Intronic
1053111859 9:35467845-35467867 AACCACACTGGGCAGGAAGCAGG - Intergenic
1053802321 9:41772234-41772256 CAGGACAGGTGGAAGGAAGCTGG - Intergenic
1054142964 9:61543106-61543128 CAGGACAGGTGGAAGGAAGCTGG + Intergenic
1054190554 9:61983220-61983242 CAGGACAGGTGGAAGGAAGCTGG - Intergenic
1054647759 9:67604197-67604219 CAGGACAGGTGGAAGGAAGCTGG + Intergenic
1054720944 9:68603184-68603206 TAGCACAGGGTGCAGACAGTGGG + Intergenic
1056172175 9:83996984-83997006 TAGGACATGGGGCGGGATGCAGG + Intronic
1056544942 9:87605821-87605843 CAGCACAGCAGGCAGGAAGCTGG - Intronic
1057042119 9:91855544-91855566 TGCCACTGGGGGCAGGAAACTGG - Intronic
1057210207 9:93197018-93197040 TGGCACAGAGGGTAGGGAGCTGG - Intronic
1057810264 9:98251972-98251994 TGGCACTGGGTGCAGGAAGAGGG + Intronic
1058915103 9:109557941-109557963 GAGAACAGGGGGCAGGAATTTGG + Intergenic
1060224063 9:121780778-121780800 AAGCTCAGTGGGCAGGAGGCCGG - Intronic
1060547417 9:124469439-124469461 TACCACACGGGCCAGGATGCAGG - Exonic
1061204135 9:129153234-129153256 TGGCACAGTGGGGAGGAAGAAGG + Intergenic
1061416495 9:130450103-130450125 TGGAGCAGGGGGCAGGAGGCAGG + Intronic
1061487053 9:130925292-130925314 TGGCACTGGGGGCAGGGACCAGG + Intronic
1062110314 9:134778663-134778685 CAGCACAGGGCGGAGGCAGCCGG - Intronic
1062522475 9:136964014-136964036 CAGCTCAGGGAGCAGCAAGCAGG + Intergenic
1062538337 9:137030582-137030604 GGGCACAGAGGTCAGGAAGCAGG - Exonic
1062619291 9:137412134-137412156 AAGGACAGGGGGCTGGAGGCCGG + Intronic
1203423461 Un_GL000195v1:16322-16344 TAGCCCAGGGGGCAGGGCACAGG - Intergenic
1203445936 Un_GL000219v1:56443-56465 GAGCACAGGGTGCGGGAGGCAGG + Intergenic
1185683236 X:1906216-1906238 TAGCAGAGGGGTGAGGGAGCTGG + Intergenic
1185875333 X:3697426-3697448 TAACAGAGTGTGCAGGAAGCAGG - Intronic
1186144364 X:6610264-6610286 CAGCCCAGGGGAAAGGAAGCTGG - Intergenic
1186991737 X:15076942-15076964 TATCCCAGAGGGTAGGAAGCAGG + Intergenic
1187318745 X:18221560-18221582 TACTAGAGGGGGCAGGAAGGAGG - Intergenic
1187705797 X:22008180-22008202 TAGCCCAGGAGGCAGTAAGGTGG + Intergenic
1192214653 X:69150138-69150160 CAGCTCCGGGGGCAGGAAGGGGG + Intergenic
1192360520 X:70435853-70435875 TAACACAGGGGGCACAGAGCTGG + Intergenic
1192436998 X:71149004-71149026 AGGCTCAGGGGGCAGTAAGCAGG + Intronic
1195747301 X:108131672-108131694 TAACAAAGGGAGCAGGAAGAAGG + Intronic
1198305981 X:135383496-135383518 ATGCACAGGGGACAGGAAGAGGG + Intergenic
1200257026 X:154588212-154588234 TCCCACTGGGGGCAGAAAGCAGG + Intergenic
1200260743 X:154616190-154616212 TCCCACTGGGGGCAGAAAGCAGG - Intergenic
1200845902 Y:7831966-7831988 TAGCTCAGGGCCCAGGAGGCGGG + Intergenic
1202094985 Y:21240372-21240394 CAGTACACGAGGCAGGAAGCAGG + Intergenic
1202096134 Y:21249660-21249682 CAGTACATGAGGCAGGAAGCAGG + Intergenic
1202133772 Y:21639108-21639130 AAGCACTGGAGGCAGAAAGCAGG - Intergenic
1202602940 Y:26613052-26613074 CAACACAGGGAGCAGAAAGCAGG + Intergenic