ID: 1105775824

View in Genome Browser
Species Human (GRCh38)
Location 13:23659208-23659230
Sequence TGAGCTCAAAACTTACAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105775824_1105775826 -2 Left 1105775824 13:23659208-23659230 CCCAGCTGTAAGTTTTGAGCTCA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1105775826 13:23659229-23659251 CATTACATTTCTTAGCATTTAGG 0: 1
1: 0
2: 2
3: 25
4: 351
1105775824_1105775830 5 Left 1105775824 13:23659208-23659230 CCCAGCTGTAAGTTTTGAGCTCA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1105775830 13:23659236-23659258 TTTCTTAGCATTTAGGGGAAGGG 0: 1
1: 0
2: 1
3: 28
4: 262
1105775824_1105775827 -1 Left 1105775824 13:23659208-23659230 CCCAGCTGTAAGTTTTGAGCTCA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1105775827 13:23659230-23659252 ATTACATTTCTTAGCATTTAGGG 0: 1
1: 0
2: 2
3: 33
4: 406
1105775824_1105775828 0 Left 1105775824 13:23659208-23659230 CCCAGCTGTAAGTTTTGAGCTCA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1105775828 13:23659231-23659253 TTACATTTCTTAGCATTTAGGGG 0: 1
1: 0
2: 3
3: 30
4: 308
1105775824_1105775829 4 Left 1105775824 13:23659208-23659230 CCCAGCTGTAAGTTTTGAGCTCA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1105775829 13:23659235-23659257 ATTTCTTAGCATTTAGGGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105775824 Original CRISPR TGAGCTCAAAACTTACAGCT GGG (reversed) Exonic
902155756 1:14484948-14484970 TGAGCCCAAAACTAAGAGATGGG + Intergenic
903163250 1:21504005-21504027 TGAGCTCAGAGCTGACTGCTAGG + Intergenic
904389134 1:30169519-30169541 TAAGCACAGAACTCACAGCTAGG - Intergenic
911571781 1:99526210-99526232 TGATATCAAAACCTAAAGCTGGG + Intergenic
918101084 1:181375401-181375423 TTGGCTCAAACCTTGCAGCTGGG - Intergenic
921588295 1:216974031-216974053 TAAGCTCAAAAGTTACACCGGGG - Intronic
922461727 1:225818573-225818595 TGAGCACAAAACTGAAAGATCGG + Intronic
924460614 1:244255333-244255355 TGAGGTCCTAACTGACAGCTGGG + Intergenic
924790899 1:247247097-247247119 TGAGCCCAAAAGTTAGAGATTGG + Intergenic
1063210335 10:3875118-3875140 TGAGCTGAAAACTCACCCCTAGG - Intergenic
1064503103 10:15996051-15996073 TGATCTCAACACTGACTGCTTGG - Intergenic
1064558036 10:16566977-16566999 TGAGCTAAATAATTACAGCAAGG - Intergenic
1069089352 10:64180690-64180712 TGAGCTCAGAAATTATAGTTCGG + Intergenic
1073794448 10:106972694-106972716 TCAACTCAAACCTTTCAGCTTGG - Intronic
1075463319 10:122632884-122632906 GGAGCTCAGAACTTACTGTTTGG - Exonic
1077650618 11:3968449-3968471 TGAACTCAAAACTCAAAGGTAGG - Intronic
1079532271 11:21468701-21468723 TTAGCTCAGAAGTTACACCTGGG + Intronic
1087501282 11:98957659-98957681 TGAGCCCAAAATTAACAGCTAGG - Intergenic
1089934189 11:122346652-122346674 TAACCTCAACACTTACAACTTGG + Intergenic
1093147618 12:15585648-15585670 TTAGCTCAAAACTGACAGCGAGG + Intronic
1093906374 12:24697140-24697162 TGAACTCAAAATATTCAGCTGGG + Intergenic
1096662609 12:53136873-53136895 TGACCTCAATACACACAGCTTGG - Intergenic
1097708155 12:62889357-62889379 TGACTTCAAGACTTATAGCTGGG + Intronic
1098488886 12:71052115-71052137 TGTGCACGAAGCTTACAGCTGGG - Intronic
1098790401 12:74815637-74815659 TGAGCTCAGGAGTTTCAGCTTGG + Intergenic
1099437624 12:82662480-82662502 TGAGTTCTAAACTTCCAGCTTGG + Intergenic
1099668610 12:85661368-85661390 TGAGTTCAAAACTCACAGAAAGG + Intergenic
1105775824 13:23659208-23659230 TGAGCTCAAAACTTACAGCTGGG - Exonic
1107190131 13:37572436-37572458 TGAGCACAAAACATAAAGCCAGG + Intronic
1109347483 13:61132613-61132635 TGAGCTCAATACTTTCACGTGGG + Intergenic
1111730335 13:92067435-92067457 TGATCCTAAAACATACAGCTTGG - Intronic
1119765842 14:77187247-77187269 TGAGCTCACCTCTTACTGCTGGG + Intronic
1121176076 14:91891701-91891723 TAATCTCAAATCTTAGAGCTGGG - Intronic
1130150598 15:81308640-81308662 GGAGATGAAATCTTACAGCTGGG + Exonic
1131395843 15:92085240-92085262 TGAAATCAAAACTTACAGCAGGG - Intronic
1132307097 15:100824090-100824112 AGAGCTGAAAACTCACACCTAGG + Intergenic
1133327042 16:4948157-4948179 TGAGCTCAAACATTCCTGCTGGG + Intronic
1134390851 16:13818775-13818797 TGAGCTAAATACTTACAGCCTGG + Intergenic
1139833372 16:69818887-69818909 TATGCCCAAAACTCACAGCTAGG + Intronic
1139910860 16:70396726-70396748 TGAGCTCATCCCTTGCAGCTTGG + Intronic
1140071252 16:71652014-71652036 TGAGATAAAAACTGACAGGTGGG + Intronic
1141443013 16:84041611-84041633 TTAGCTCAAAAACTAAAGCTGGG - Intronic
1141942221 16:87284657-87284679 GGAGATCAAAAGTAACAGCTAGG + Intronic
1142294171 16:89209487-89209509 TGAGCCCCAAAATTGCAGCTTGG - Intergenic
1203141164 16_KI270728v1_random:1767740-1767762 TGAGCTCAGAGCTTAGAGCCAGG - Intergenic
1143236155 17:5402786-5402808 GGAGCTCAGGACTTTCAGCTTGG + Intronic
1154234575 18:12592118-12592140 TGTGCTGATGACTTACAGCTCGG - Intronic
1156412067 18:36840085-36840107 TGAGTTGAAAAGATACAGCTGGG - Intronic
1157640855 18:49212906-49212928 TGACCTCTATACTTACAGCTTGG + Intronic
1159890252 18:73946279-73946301 TGAGCAGAAACCTGACAGCTGGG + Intergenic
1160458673 18:79020927-79020949 TGAGCTCATGGCTTCCAGCTTGG - Intergenic
1161918805 19:7250846-7250868 TGAGCTCCAGACTCAGAGCTAGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
926619712 2:15036679-15036701 GGAGCTTGTAACTTACAGCTTGG + Intergenic
928488922 2:31761001-31761023 TGAGCTTAAAAATCTCAGCTGGG - Intergenic
928729523 2:34215272-34215294 TGATTTCAACACTTACAACTGGG + Intergenic
929692341 2:44085351-44085373 TGAGCTCAACTCTGACAGCAAGG - Intergenic
933687472 2:85154608-85154630 AGAGCTGAGAACTTACAGCAGGG - Intronic
935814668 2:106836534-106836556 TCAGCTGAAAACTATCAGCTAGG + Intronic
935967990 2:108500755-108500777 TGAGTTGAAAACTTAGAGATGGG - Intronic
942592189 2:177558125-177558147 TGATGCCAAAGCTTACAGCTTGG - Intergenic
943117956 2:183696543-183696565 AGGGCTCAAAAATTAGAGCTGGG + Intergenic
945438608 2:209850245-209850267 TGAGTTCAAAACTCACATGTGGG - Intronic
1169030176 20:2400615-2400637 TGACCTCAGACCTTACATCTTGG - Intronic
1170610855 20:17911913-17911935 GGAGCCCAAAATTTACAGGTTGG + Intergenic
1170676859 20:18490206-18490228 TCAGTTCTAGACTTACAGCTTGG + Intronic
1175139546 20:56850048-56850070 TGCGCTCAATACTGGCAGCTGGG + Intergenic
1175259510 20:57665741-57665763 TGAGCTCAAATCTCCCACCTTGG - Intronic
1177907466 21:26989506-26989528 TGTGCTTAAGACTTACAGCCTGG - Intergenic
1178604452 21:34023521-34023543 TTAGCTCAAAAGTGTCAGCTAGG + Intergenic
1178781353 21:35605698-35605720 TGGGCTCAAAAGTGACAGCATGG + Intronic
1179903845 21:44409953-44409975 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903849 21:44409994-44410016 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903897 21:44410630-44410652 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903916 21:44410917-44410939 TGAGGTCAAAACTTACTACAAGG - Intronic
1184589898 22:45475178-45475200 TGAGCTCTAAACTTGGAGCTGGG + Intergenic
1184711622 22:46253708-46253730 TGAGCTCAGATCTTCCAGCCTGG + Intergenic
1185087525 22:48748897-48748919 TGGGCTCAGAACTTTCAGCAGGG + Intronic
950653965 3:14425240-14425262 TGAGGTCACCACTTGCAGCTGGG + Intronic
952117966 3:30205831-30205853 TGAGTTGAAAACATAGAGCTGGG + Intergenic
953911169 3:46893729-46893751 GGAGCTCACACCTTACAGATGGG - Intronic
955088667 3:55728353-55728375 TGTGCTCAAAAATGTCAGCTTGG + Intronic
957195475 3:77061861-77061883 TGAGCTCAAGACTTTGAGCAAGG + Intronic
957309019 3:78495238-78495260 TAAGCACAAATCTTACATCTCGG - Intergenic
958148018 3:89652641-89652663 TGAGCTCATAATTTCTAGCTTGG - Intergenic
958576493 3:95955452-95955474 TCAGCTCAGAACATACAGATGGG + Intergenic
961910980 3:130316345-130316367 TGAGCTCACCACTTACTGGTTGG + Intergenic
965802383 3:172507982-172508004 TTAGCTCAAAACATGCATCTAGG + Intronic
969311912 4:6357776-6357798 TGAGCTCAGAACCTGCACCTGGG + Intronic
977325505 4:95570675-95570697 TGAGTTCAAACCTTACAGGCTGG - Intergenic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
984093490 4:175405125-175405147 TTTGCTCAATTCTTACAGCTGGG + Intergenic
984292335 4:177811191-177811213 TTTGCTCAAAATTTACACCTAGG - Intronic
989536265 5:42567301-42567323 TGAGCTCTAATCTCTCAGCTGGG - Intronic
990785906 5:59419345-59419367 TGATTTCAAAATTTTCAGCTAGG - Intronic
992065997 5:73109340-73109362 AGAACACAAAACTTACAGCAAGG - Intergenic
994410126 5:99396997-99397019 TGAGCTCAAAAAATCCACCTCGG - Intergenic
994688269 5:102983842-102983864 TCAGCTTAAACCTTACAGATCGG + Intronic
996593484 5:125175226-125175248 TCAGCTCAAAAATCAGAGCTGGG + Intergenic
997229142 5:132230069-132230091 TGAGCCCATTACTTGCAGCTGGG + Intronic
999442744 5:151615193-151615215 TGAGCTGGAAACCGACAGCTTGG + Intergenic
1001093982 5:168762069-168762091 AGAGCTAAAAAATTATAGCTGGG - Intronic
1001648697 5:173300417-173300439 TGAGTTCTAGACTAACAGCTGGG + Intergenic
1001768924 5:174277767-174277789 TGAGCTCAAAGCTCAGATCTAGG + Intergenic
1004893630 6:20125452-20125474 TTAGTTCAAGACATACAGCTGGG - Intronic
1005772469 6:29088058-29088080 TGAGGTCAAGACTAACACCTAGG + Intergenic
1011643359 6:89434528-89434550 GGAGGTCAAAGCTTACAGCCTGG - Intronic
1013719335 6:113004207-113004229 TGAGCTCAAACTTCACAGTTGGG - Intergenic
1015850900 6:137570977-137570999 TGCTTTCAAAACTTAGAGCTTGG - Intergenic
1019209501 6:170393939-170393961 TGAGCTCACAGCTGTCAGCTTGG - Intronic
1023145513 7:37146930-37146952 TGAGGTCAGAACTTGCAACTTGG + Intronic
1027951203 7:84818887-84818909 TAAGCTCAAAAATTCTAGCTAGG - Intergenic
1031927246 7:127650775-127650797 TGACCTCAAAACTTAACCCTGGG + Intergenic
1033810907 7:145009856-145009878 TGTGCTCAAAACATCCACCTTGG - Intergenic
1035274909 7:157742104-157742126 TGTGCTCAATGCTTACAACTAGG + Intronic
1037455240 8:19056909-19056931 TGAGCTCATCACCCACAGCTTGG - Intronic
1038482878 8:27913822-27913844 TCTGCTGCAAACTTACAGCTCGG + Intronic
1046358591 8:113120678-113120700 ACAGCTCAAAATCTACAGCTGGG - Intronic
1049070899 8:140355123-140355145 TCACCTAAAAACATACAGCTTGG + Intronic
1049918654 9:343194-343216 TGAGGTCAAAAATTACAGCGAGG + Intronic
1050969391 9:11849632-11849654 TGAAGTCAAAATTTACAGTTAGG + Intergenic
1058546890 9:106069979-106070001 GGGGCTCAAAATTTGCAGCTTGG - Intergenic
1059483021 9:114606884-114606906 AAAGATCAAAACTTACATCTTGG - Intergenic
1185552879 X:998014-998036 TGAGCTCACAGCTTAGAGCCAGG + Intergenic
1186345252 X:8685339-8685361 TGTGCTTAAAATTTTCAGCTGGG + Intronic
1190784662 X:53633748-53633770 TGAGCTCATAACTTAAACATGGG + Intronic
1192770062 X:74179793-74179815 TGGGGTCAAGACTTACAGCATGG + Intergenic
1193358941 X:80557222-80557244 TGAGCTCTAGAATTTCAGCTTGG - Intergenic
1201422301 Y:13812709-13812731 TGTGCTTAAAATTTTCAGCTGGG + Intergenic
1201892664 Y:18959442-18959464 TGTGGTCAAATTTTACAGCTGGG - Intergenic