ID: 1105779089

View in Genome Browser
Species Human (GRCh38)
Location 13:23690733-23690755
Sequence CTATGTTTATCCCAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105779084_1105779089 15 Left 1105779084 13:23690695-23690717 CCTGGTCGGGGGGGCACTGGGAC 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 146
1105779083_1105779089 16 Left 1105779083 13:23690694-23690716 CCCTGGTCGGGGGGGCACTGGGA 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 146
1105779085_1105779089 -7 Left 1105779085 13:23690717-23690739 CCCTCCTGCATGTGCTCTATGTT 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 146
1105779074_1105779089 29 Left 1105779074 13:23690681-23690703 CCTAAATCTTACTCCCTGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 146
1105779086_1105779089 -8 Left 1105779086 13:23690718-23690740 CCTCCTGCATGTGCTCTATGTTT 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105779089 Original CRISPR CTATGTTTATCCCAGGAAGC TGG Intergenic
901472393 1:9466696-9466718 CCATGTCTAGCCCAGCAAGCAGG - Intergenic
904255233 1:29250381-29250403 CTATCTTTATTCCAGGAGACTGG - Intronic
907751690 1:57269244-57269266 TTCTGTATATCCCAGGGAGCTGG - Intronic
910963726 1:92786896-92786918 CTCTGTTGAGGCCAGGAAGCCGG - Intronic
914359948 1:146925847-146925869 CTATGTAATTCCTAGGAAGCAGG - Intergenic
914493803 1:148174048-148174070 CTATGTAATTCCTAGGAAGCAGG + Intergenic
916285040 1:163097376-163097398 CTATGTTCTTCTCAGGGAGCAGG + Intergenic
917150462 1:171938292-171938314 CTCTGTTTATGCCTGGAAGGTGG - Intronic
917531522 1:175840349-175840371 CTGTGTACATCACAGGAAGCAGG + Intergenic
919169587 1:193937311-193937333 CTATGTCTTTCCCAGGATCCAGG + Intergenic
922130660 1:222774103-222774125 CTCTTTTTTTCCCAGGAAACTGG - Intergenic
923349992 1:233094954-233094976 CTGTGTGTTTCCCAGGAAACAGG - Intronic
924428384 1:243974643-243974665 CTCTGTATATCACAGGAGGCTGG - Intergenic
1065596172 10:27314094-27314116 CTATGTTTATCCCATGGATGGGG - Intergenic
1065598055 10:27336600-27336622 CTATGTTTATCCCATGCATAGGG + Intergenic
1067318177 10:45189881-45189903 CTATGTTTATCCCATGCATAGGG + Intergenic
1067790468 10:49283786-49283808 CTATGTTTTTACCAGCAAGAGGG - Intergenic
1068084493 10:52358439-52358461 CTCTGCTGTTCCCAGGAAGCAGG + Intergenic
1068420833 10:56790142-56790164 CTTTGTTTATCCAAGGAAATGGG - Intergenic
1070446239 10:76506448-76506470 ATATCTGTATCCCAGGAGGCTGG + Intronic
1070998435 10:80807552-80807574 GGAGGTTTATCCCAGGAAGATGG - Intergenic
1073830834 10:107380987-107381009 CTAAGATTTTCCCAGAAAGCTGG - Intergenic
1075805811 10:125188027-125188049 CTATCTCTATCCAAGGAAGCAGG - Intergenic
1075881349 10:125854666-125854688 CTAAGTGGCTCCCAGGAAGCTGG + Intronic
1076184632 10:128436697-128436719 CTCTATTTATCCTGGGAAGCTGG - Intergenic
1076502711 10:130949742-130949764 CTCTGATCAGCCCAGGAAGCGGG - Intergenic
1078369861 11:10735700-10735722 CTAAGTTTCTCCAAGGAGGCGGG - Intergenic
1081412606 11:42777408-42777430 TTCTGTTTATCCCAGGACTCTGG - Intergenic
1084219848 11:67671166-67671188 TGATGTTCATCCCAGGAACCTGG + Intronic
1085634898 11:78151131-78151153 CTGTGCTGATCTCAGGAAGCAGG + Intergenic
1085759092 11:79226453-79226475 CAATGGTTATTCCAGGAGGCTGG - Intronic
1090906002 11:131075145-131075167 GTATTTATATCTCAGGAAGCTGG + Intergenic
1094298216 12:28931737-28931759 CTATGTGTAACACAGGAAGATGG + Intergenic
1095508719 12:42926247-42926269 ATATGTTTATCCCAGGGAGCTGG + Intergenic
1095937428 12:47700762-47700784 CTATCTTGATCCTAGGAAGTTGG - Intronic
1101051808 12:100871703-100871725 CTATGTATGAACCAGGAAGCTGG - Intronic
1105779089 13:23690733-23690755 CTATGTTTATCCCAGGAAGCTGG + Intergenic
1108901768 13:55419350-55419372 CTCTCTTTATCACAAGAAGCAGG - Intergenic
1110851735 13:80253812-80253834 CAATGTTTATCAAAGGAAGATGG - Intergenic
1112639493 13:101256656-101256678 TTCTGTTTTTCCCAGGAAGTAGG - Intronic
1115255478 14:31396509-31396531 ATATCTATATCCCAGGAAGTTGG + Intronic
1116859632 14:49983515-49983537 ATATCTTGAACCCAGGAAGCAGG - Intronic
1121513468 14:94532727-94532749 AGAGGTTTCTCCCAGGAAGCTGG + Intergenic
1126435227 15:48630622-48630644 TTATTTTTTTCCCAGGAAGTCGG + Intronic
1126811779 15:52413881-52413903 TTATGTTCATCCCAGCAAGCAGG + Intronic
1128052176 15:64674273-64674295 CTACCTTTGTCCCAGGAAGGGGG - Exonic
1129857783 15:78837377-78837399 CTATTTTTTTCCCAGGCACCTGG - Intronic
1129942852 15:79513253-79513275 CTATCTTTCTCCCAGGCTGCTGG + Intergenic
1132152417 15:99472177-99472199 CTATCTATAAACCAGGAAGCTGG - Intergenic
1132804645 16:1769828-1769850 CTCTGTTGCTCCCTGGAAGCAGG - Exonic
1135395247 16:22126409-22126431 CGATGGCTATCCTAGGAAGCCGG - Intronic
1137782104 16:51106219-51106241 CTATGGTTTTCCTAGCAAGCGGG - Intergenic
1142391973 16:89807156-89807178 ATGTGTATATCCTAGGAAGCAGG + Intronic
1143176302 17:4957096-4957118 CAGTGTTTATTTCAGGAAGCAGG - Exonic
1143876866 17:9998219-9998241 CAAGGTTTATGCCAGGGAGCTGG + Intronic
1149157354 17:53647799-53647821 CTCTGATTTTCCCAAGAAGCAGG + Intergenic
1152016742 17:77755947-77755969 CTGTGGTGTTCCCAGGAAGCAGG - Intergenic
1152086588 17:78223303-78223325 GGATGTTTGTCCCAGGTAGCTGG + Intronic
1152397466 17:80042999-80043021 CTGTGTTTATCTCAGAATGCGGG - Intronic
1154329815 18:13420764-13420786 CTCTGTGAAGCCCAGGAAGCAGG - Intronic
1160598931 18:79997764-79997786 CTATCTTCCTCCCAGGAAGATGG + Intronic
1160602886 18:80027699-80027721 CTATCTTCCTCCCAGGAAGATGG + Intronic
1165490475 19:36120450-36120472 CGATGTTGATGCCAGCAAGCGGG + Intronic
926076663 2:9948676-9948698 CTATGTATATACCAGGCACCAGG + Intergenic
927770435 2:25856390-25856412 CAGTGTTTATTTCAGGAAGCAGG + Intronic
928361913 2:30670481-30670503 TTGTGTTTATGCCAGGAAGTAGG + Intergenic
929072627 2:38049094-38049116 CCATTTGTTTCCCAGGAAGCTGG + Intronic
931166807 2:59757586-59757608 CCATGTTTCTTCCATGAAGCAGG + Intergenic
932119506 2:69085259-69085281 CTATGTTTTTCCCAAGAAAAGGG + Intronic
933377260 2:81495793-81495815 CAAGGTTTAAACCAGGAAGCAGG - Intergenic
935538390 2:104321363-104321385 CTGTGTCTGTCCCAGGAACCAGG + Intergenic
939037947 2:137155595-137155617 ATACATTTATCCCAGGAAGTGGG - Intronic
939137925 2:138318990-138319012 TTATCTTTATTCCAGCAAGCAGG + Intergenic
939680165 2:145120919-145120941 CTATGCTTATCTCAGAAAGCAGG - Intergenic
940476661 2:154170485-154170507 TTATAGTTATTCCAGGAAGCAGG - Intronic
942996785 2:182272036-182272058 CAATTTCTATCCCAGGAAGTGGG + Intronic
943139278 2:183958729-183958751 CTTTGATTTTCCCAGGAAGTAGG + Intergenic
944544788 2:200788546-200788568 ATATGTTTGTCCCAGGATGCAGG + Intergenic
944544944 2:200789934-200789956 ATACGTTTGTCCCAGGATGCAGG + Intergenic
946440515 2:219691317-219691339 CTATGTTTTATCCAGGAAACTGG - Intergenic
947673126 2:231954074-231954096 TTATGTTCATCCCAGGAGTCCGG - Intergenic
1169763526 20:9123545-9123567 TATTGTTTATCCCAGCAAGCAGG - Intronic
1170909621 20:20552534-20552556 ATCTGTTTATCCCAGTAATCTGG + Intronic
1172328032 20:34052584-34052606 ATGTGTTTATCCCAGTAGGCAGG + Intronic
1174060495 20:47829516-47829538 ATACGCTTATTCCAGGAAGCAGG + Intergenic
1174071403 20:47901854-47901876 ATACGCTTATTCCAGGAAGCAGG - Intergenic
1174099696 20:48117889-48117911 ATATGCTTATTCCAGGAAGCAGG + Intergenic
1174127041 20:48314267-48314289 CTGTATTTAGCCCAGGAAGGGGG + Intergenic
1174152650 20:48496807-48496829 ATACGCTTATTCCAGGAAGCAGG + Intergenic
1175076580 20:56380036-56380058 CAATGATTTTCCCAGGAACCTGG + Intronic
1175609692 20:60340309-60340331 CTTTGTTTATTCCAGAGAGCTGG - Intergenic
1177464587 21:21458589-21458611 ATATGTATAAACCAGGAAGCAGG + Intronic
1179243553 21:39611683-39611705 GTATGGTTACCCCAGGAAACGGG + Intronic
1180837567 22:18937944-18937966 CTCTGTAAATCCTAGGAAGCAGG + Intergenic
1181063499 22:20293574-20293596 CTCTGTAAATCCTAGGAAGCAGG - Intergenic
1181299498 22:21869345-21869367 ATATATTTAGCCCATGAAGCAGG + Intergenic
1181381292 22:22506895-22506917 CTATGTGAATTCCAGGAAGTGGG - Intronic
1182896991 22:33867287-33867309 CCATGTTTATCCCAGGCATTTGG - Intronic
1183524088 22:38313734-38313756 ATATCCTTCTCCCAGGAAGCAGG + Intronic
1203287660 22_KI270734v1_random:163243-163265 CTCTGTAAATCCTAGGAAGCAGG + Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950172717 3:10850787-10850809 CTATTTTCATCCCTGCAAGCTGG + Intronic
953949852 3:47180900-47180922 GTATGTTTCTCCCATGTAGCTGG - Intergenic
954801998 3:53192731-53192753 ACACGTTTGTCCCAGGAAGCTGG + Intergenic
956021120 3:64934239-64934261 CTATAATTAACCCAAGAAGCTGG + Intergenic
963706906 3:148698824-148698846 CTCTGTTTAGTCCTGGAAGCAGG - Intronic
964786869 3:160405933-160405955 CTTTGATTATCCCAGGATGACGG - Intronic
970574906 4:17417731-17417753 TTATCTTTATGCCAGGAAGATGG - Intergenic
971432721 4:26584912-26584934 CTGTGTTAATGCCAGAAAGCAGG - Intronic
974194234 4:58550889-58550911 CTATTTATAAACCAGGAAGCAGG + Intergenic
976277516 4:83292364-83292386 CTTTGTTTATACCTGGAAACAGG - Intergenic
982755261 4:159210562-159210584 CCATGTTTCTTCCAAGAAGCAGG + Intronic
989193530 5:38693972-38693994 CTCTGTTTATCCCTGGAGGATGG - Intergenic
992683241 5:79174199-79174221 CTAAGTTAAACCCAGGAGGCTGG + Intronic
993760105 5:91784551-91784573 TTATGGTTCTCCCAGGTAGCTGG + Intergenic
996273841 5:121640556-121640578 CCCTGATTATCCAAGGAAGCAGG - Intergenic
1003979815 6:11379076-11379098 TTTTGGATATCCCAGGAAGCAGG - Intronic
1004288815 6:14348082-14348104 ATAGGTTTATCCCAAGATGCAGG - Intergenic
1004997480 6:21207707-21207729 CCATGTATATCCTATGAAGCAGG - Intronic
1007211866 6:40198726-40198748 CCATGTTCCTCCCAAGAAGCTGG + Intergenic
1008201539 6:48597258-48597280 AATTGTGTATCCCAGGAAGCTGG - Intergenic
1008948526 6:57127905-57127927 CTTTGTTTATAGCAGGCAGCAGG - Intronic
1011541308 6:88433296-88433318 CTATGTGTGTCTCAAGAAGCAGG - Intergenic
1019543419 7:1561382-1561404 CAAGGTTTAGCCCAGGAAGGGGG - Intergenic
1026883592 7:73922570-73922592 CTCTCTTCATCCCTGGAAGCTGG + Intergenic
1028786921 7:94805641-94805663 CTATCTTTAAGCAAGGAAGCAGG + Intergenic
1028799526 7:94947208-94947230 CAATGTCTGTCCCTGGAAGCAGG - Intronic
1029904494 7:104077382-104077404 CTAAGCTGATCTCAGGAAGCAGG + Intergenic
1030142075 7:106314852-106314874 CTATGTCTTACCCAGGAAGTAGG - Intergenic
1030496195 7:110303989-110304011 CTGGGTTTATCTCAGGAAACAGG - Intergenic
1030520438 7:110591057-110591079 CTGTGTCTACCCCAGAAAGCAGG + Intergenic
1033832733 7:145272868-145272890 CTATCTATAAACCAGGAAGCAGG + Intergenic
1039445546 8:37628926-37628948 TTATGTTTAGCCCAGGAGTCTGG + Intergenic
1039780976 8:40785108-40785130 ATATGTGTATCCCAGGAACTGGG - Intronic
1040633629 8:49245901-49245923 CTAAGTTTATCACTGGAACCAGG + Intergenic
1041384669 8:57288296-57288318 CTATGTTTATCCCATGCATTGGG - Intergenic
1041543626 8:59014848-59014870 CTATGGTTATCAAAGGAAACAGG + Intronic
1049025278 8:139984202-139984224 CCATGTTAATTCCAGGAATCTGG + Intronic
1049359747 8:142206861-142206883 CTATGTTGAGCCCAGGTAGGTGG + Intergenic
1051038430 9:12776668-12776690 CTATTTTGATCCCAGGGAGCAGG + Intronic
1058704362 9:107626475-107626497 CTCTGATTATCCAAAGAAGCTGG + Intergenic
1058904808 9:109474152-109474174 CTATTTTTCTCCCAGGAGGCAGG - Intronic
1061773517 9:132945220-132945242 AAATGTTTAGCCCAGGAAGGAGG - Intergenic
1186000087 X:4999973-4999995 CTATCTATGTACCAGGAAGCAGG - Intergenic
1186161155 X:6778502-6778524 CCATGTTTCTCCCAGGCTGCAGG - Intergenic
1186452122 X:9682768-9682790 ATCTGCTTATCCCAGGAGGCAGG - Intronic
1188846512 X:35078438-35078460 CTATGTTTGTTCTAAGAAGCTGG + Intergenic
1188948766 X:36342130-36342152 ATATGTGTTTACCAGGAAGCTGG - Intronic
1190154128 X:47973845-47973867 CCATTTGTGTCCCAGGAAGCAGG + Intronic
1192365431 X:70468607-70468629 CTATGACTAACCCAGAAAGCTGG - Intronic
1194607732 X:96002522-96002544 TTATGTTTCTCTAAGGAAGCTGG - Intergenic
1194746310 X:97632249-97632271 CTGTGTTTCTTCCAGGAAGCTGG - Intergenic
1196668850 X:118345287-118345309 CTATTTTTATCACCGGACGCTGG + Intergenic
1198308331 X:135404585-135404607 CCATGTTTGAACCAGGAAGCAGG - Intergenic
1198556710 X:137801376-137801398 CAATGATTATTTCAGGAAGCAGG - Intergenic
1201554457 Y:15254182-15254204 CCATGTTTCTCCCAGGCTGCAGG - Intergenic