ID: 1105782053

View in Genome Browser
Species Human (GRCh38)
Location 13:23714352-23714374
Sequence CAGGAGAAGAAAAAAGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1404
Summary {0: 1, 1: 1, 2: 10, 3: 112, 4: 1280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105782053 Original CRISPR CAGGAGAAGAAAAAAGAGGT TGG (reversed) Intergenic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
901255298 1:7820037-7820059 CATGAGAAAAGCAAAGAGGTGGG + Intronic
901809174 1:11756778-11756800 CGGGATAAATAAAAAGAGGTCGG + Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
902809728 1:18881261-18881283 CAGGAGAAGAATATATATGTTGG - Intronic
902883018 1:19385348-19385370 CAAGAGAAGAAAGGAGAGGAGGG + Intronic
903086144 1:20861213-20861235 GTGGAGGAGAAATAAGAGGTAGG + Intronic
903086477 1:20864213-20864235 CAGAAGAAGAAAAAAGAATATGG + Intronic
903128605 1:21263872-21263894 GAGGAGGAAAAAGAAGAGGTGGG - Intronic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
903999957 1:27333308-27333330 CAGGCATAGAAAGAAGAGGTGGG - Intronic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904165291 1:28550712-28550734 AAAGAAAAGAAAAAAGAGGCTGG + Intergenic
904294726 1:29512057-29512079 GAAGAGAAAAAAAAGGAGGTGGG + Intergenic
904390811 1:30184578-30184600 CTAGAGAAGAGAAAAGAGGGTGG - Intergenic
904530584 1:31166056-31166078 CAGGAAAAAAAAAAAAAGGTGGG + Intergenic
904673281 1:32181550-32181572 CAGGAGAAGAAAAAAGCCAAGGG + Exonic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905420275 1:37838150-37838172 CAAGAGAGGAAATGAGAGGTAGG - Intronic
905448404 1:38042434-38042456 GAGGAGAAGAAAAAAGGAGCAGG + Intergenic
905530834 1:38677489-38677511 CAGGAGAAGAGAGAAGCTGTGGG - Intergenic
905687307 1:39917798-39917820 GAGGAGGAGAAAAAAGATTTAGG + Intergenic
905696379 1:39977090-39977112 AAGAAAAAGAAAAAAGGGGTGGG + Intergenic
905811420 1:40916187-40916209 CAGGAAGAGAAAAAAGGGGGTGG - Intergenic
905868888 1:41391731-41391753 CAGGGGAGGAAGACAGAGGTGGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906747636 1:48232814-48232836 GAAGAGAAGAGAAAAGAGGGAGG + Intronic
906941929 1:50263036-50263058 CAAGAGAAGAGAAAAGAGCCAGG + Intergenic
907578845 1:55553780-55553802 GAGGGGGAGAAAAAAGGGGTTGG - Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908030941 1:59998824-59998846 CGAGAGAAGAAAAAAGATATAGG + Intronic
908295272 1:62706825-62706847 CAGGAAAAAAAAAAAAAGGCTGG - Intergenic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
908849816 1:68364458-68364480 TAGGAGAAAAAAAAAATGGTGGG - Intergenic
908867464 1:68566491-68566513 CAGGCGAAAAAAAAATATGTTGG - Intergenic
908919099 1:69168794-69168816 CACGAGAAGATATAGGAGGTGGG - Intergenic
909106567 1:71417363-71417385 GAGCTGAAGAAAAAAGAGATAGG + Intronic
909195112 1:72610424-72610446 AAGAAGAAGAAGAAAGAGATAGG - Intergenic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909479368 1:76114933-76114955 AAGAAAAAGAAAAAAAAGGTAGG + Intronic
909586560 1:77296045-77296067 CAAGGGAAGAAAGAAGAGGGTGG + Intronic
909837713 1:80277360-80277382 CAGAAGAAGCAAAGAGAGGTGGG - Intergenic
910372771 1:86534967-86534989 CAGGCTAAGAAAAAAGAGAGAGG - Intergenic
910474824 1:87595615-87595637 GGGGAGAGGAAAAAAGAGGAAGG - Intergenic
910620510 1:89248439-89248461 GAGGAGAGGAAAAAATAGGGAGG + Intergenic
910985235 1:92998803-92998825 CAGGAGACCAAAAGAGAGTTGGG - Intergenic
911219263 1:95229989-95230011 AAAGAGAAAAAAAAAGAGGTAGG - Intronic
911559460 1:99386076-99386098 CAGTAGGAGATAAGAGAGGTTGG + Intergenic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
912017708 1:105062023-105062045 CAGGAGAAAAATAAAGTGGTGGG + Intergenic
912645778 1:111390465-111390487 TAGGTGAAGAAACTAGAGGTAGG - Intergenic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
913384104 1:118240846-118240868 CAAAAGAAAAAAAAAGATGTTGG + Intergenic
915303384 1:154964028-154964050 AAGGAGGAGAAAAAAATGGTGGG + Intronic
915427819 1:155842063-155842085 CATGACAAGAAACAAGGGGTTGG + Intronic
915723205 1:157999102-157999124 CAGGAGAGGAAAAAAGGCCTAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
915934518 1:160082878-160082900 CATGTGAAGAAAAATCAGGTGGG + Intronic
916199890 1:162260699-162260721 AAGGAGCAGCAAAAAAAGGTGGG - Intronic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916308309 1:163364705-163364727 CAGGAAAAAAAAAAAAAGGATGG - Intergenic
916474235 1:165153345-165153367 CAGGTGAAGAAAAAGGATGGTGG + Intergenic
916857250 1:168762802-168762824 CAGGAAAAGAAAGAAGATGTAGG + Intergenic
916949356 1:169763222-169763244 CAAGTGAGGAAACAAGAGGTAGG + Intronic
916967215 1:169961666-169961688 GAGGAGGAGAAAGAAGAGGAGGG - Intronic
917089764 1:171341391-171341413 CCTGAGAGGAAAAAAGAGGGAGG - Exonic
917311895 1:173687462-173687484 TCAGAGAAGAAAAAAGGGGTGGG - Intergenic
917393465 1:174565200-174565222 CATGAGAACATAAAAGAGCTGGG + Intronic
917463262 1:175250893-175250915 AAGGAAATCAAAAAAGAGGTGGG + Intergenic
917536849 1:175880593-175880615 CTTGACAAAAAAAAAGAGGTGGG - Intergenic
917637379 1:176950127-176950149 CAGGAGAAGACAAAAGGACTTGG + Intronic
917667797 1:177242177-177242199 CAGGGGAAAAGAAAAGAGGCTGG - Intronic
917696275 1:177527489-177527511 GAGGAGAAGAAAGAAGAGTGAGG + Intergenic
917708047 1:177654615-177654637 AAAGAGAAGGAAAAAGAAGTAGG - Intergenic
917884292 1:179367967-179367989 CAGAAGAAAAAAAAAAAAGTTGG - Intronic
917924665 1:179779263-179779285 CAGGAGTAGAAGGAATAGGTTGG + Intronic
918132984 1:181645424-181645446 TATAAGAAGAAAAAAGAGGGTGG - Intronic
918393465 1:184090569-184090591 AAGGAGAAGAAAAGAGAGTTAGG - Intergenic
918445065 1:184609178-184609200 CATGTGGAGAAAGAAGAGGTTGG - Intronic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
919177007 1:194031687-194031709 GAGGAGGAGAAGAAAGAGATGGG - Intergenic
919291519 1:195639509-195639531 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
919363123 1:196620603-196620625 AATGAGAACAAAAAATAGGTGGG - Intergenic
919701374 1:200634723-200634745 CAGGAGAAGGTAGAAGAGGTAGG - Intronic
919804320 1:201372067-201372089 CAAGAGAAGAGAGAAGAGGTGGG + Intronic
919836888 1:201581064-201581086 CAGGAGAAGTTAGCAGAGGTAGG + Intergenic
919858880 1:201725243-201725265 CAGAAGAAGACATAAGAAGTGGG - Intronic
919942980 1:202301080-202301102 TAGGAGAAGAAAGCAGAGATTGG + Intronic
919950788 1:202361410-202361432 CAGGAGAAAGAGAGAGAGGTGGG + Intronic
920131822 1:203738028-203738050 CAGGAGAAGACACAAGAATTTGG - Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920403390 1:205691448-205691470 AAGAAGAAGAAAAAAAACGTGGG - Intergenic
920451877 1:206065587-206065609 GAGAAGATGAAAGAAGAGGTGGG - Intronic
921006642 1:211100318-211100340 CATGAGAAGTAATATGAGGTTGG - Intronic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921850342 1:219927557-219927579 CAGGAGAAAAAAGAAGGGATGGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922595697 1:226811073-226811095 AAGGAGGAGAAGAGAGAGGTGGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922723169 1:227909412-227909434 AAAGAAAAGAAAACAGAGGTGGG + Intergenic
922914391 1:229243941-229243963 CAGGGGGAGAAAAAAGAAATAGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923841441 1:237676046-237676068 CCGAAGAACAAAAATGAGGTAGG + Intronic
924012827 1:239684795-239684817 AAGGAAAAGAAAAGAGAGGATGG + Intronic
924165959 1:241283715-241283737 AAGGAGGAAAATAAAGAGGTTGG - Intronic
924212222 1:241782286-241782308 CAAAAGAAGAAAAAAGAACTAGG + Intronic
924632292 1:245752379-245752401 CAGGAGGGCAAAAAAGAGGCTGG - Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
924877547 1:248122005-248122027 CAGGACCAGAAAGAAGAGGAAGG - Intergenic
924879538 1:248145221-248145243 CAGGACCAGAAAGAAGAGGAAGG - Exonic
924884790 1:248203141-248203163 CAGGACCAGAAAGAAGAGGAAGG - Exonic
924894782 1:248324473-248324495 CAGGACCAGAAAGAAGAGGAAGG + Exonic
924927675 1:248699012-248699034 CAGGAAAAGAACAAAGAAGATGG - Intergenic
1062791905 10:312198-312220 GAGGAGAAGAAAACAGAAGTTGG - Intronic
1062828910 10:592015-592037 CAAGCGAAGAAAACAGTGGTAGG + Intronic
1062922888 10:1293189-1293211 CAGGAATAGAAAAAAGAGGGAGG + Intronic
1063373637 10:5538517-5538539 CAGGAGTAGAAGAAACAGGCCGG - Intergenic
1063824020 10:9873710-9873732 AAAGAGAAGAGAAAACAGGTAGG + Intergenic
1063879507 10:10516927-10516949 CGGAAGGAGAAAAAAGAGGTGGG - Intergenic
1063916590 10:10889045-10889067 CAAGAGAAGAAATAAAAGGAGGG - Intergenic
1063924286 10:10962161-10962183 AAAGAAAAGAAAAAAGAGGGAGG + Intergenic
1063968039 10:11362160-11362182 CAGGAGAGGAAGAGAGAGCTGGG - Intergenic
1064056909 10:12105716-12105738 GAGGAAAAGATAAAAGAGGCTGG - Intronic
1064074100 10:12255167-12255189 TAGGAGGAGAAAACAGAGGGAGG - Intergenic
1064340267 10:14479251-14479273 GAAAAGAAAAAAAAAGAGGTGGG + Intergenic
1064809563 10:19179977-19179999 CAGAAGAAGAAAAAAAAAGAAGG + Intronic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065066148 10:21966991-21967013 AAGAAGAAGAAGAAAAAGGTGGG - Intronic
1065139687 10:22708289-22708311 CAGGAGGAGAAAACAGAGGTCGG - Intronic
1065184252 10:23156865-23156887 AAGGAGAAGGAAAGAGAGGGAGG + Intergenic
1065205360 10:23352292-23352314 CAAGGGAAGAAAAAAGAGTCAGG + Intergenic
1065665997 10:28061582-28061604 AAGGAGAGGAAAAAAGAGATTGG + Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1066129407 10:32377686-32377708 AGGAAGAAAAAAAAAGAGGTGGG - Intronic
1066129736 10:32381298-32381320 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066308287 10:34169374-34169396 CAGGAGATGACAAAAGAAGCTGG + Intronic
1066479252 10:35779554-35779576 GAGAAGAAGAAAAAAGAAATTGG - Intergenic
1066660115 10:37729838-37729860 GATGATAAGAAAAAAGAGATGGG - Intergenic
1067267951 10:44763431-44763453 CAGGTGAAGAAGGGAGAGGTTGG + Intergenic
1067561411 10:47307295-47307317 GAGGGGAAGAAAAGAGAGGAGGG + Intronic
1067878384 10:50024073-50024095 TGGGAGAAGGAAAAAGAGGGTGG - Intergenic
1067893338 10:50153855-50153877 TGGGAGAAGGAAAAAGAGGGTGG + Intergenic
1068168752 10:53365577-53365599 AATGAGAAGATAAAACAGGTTGG + Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1068941788 10:62687946-62687968 CAGGAGAAGCAACAAGAAATTGG + Intergenic
1069263045 10:66423259-66423281 CAGGAGAAGAAAAAAATTATAGG - Intronic
1069321367 10:67175559-67175581 CAAGAGAAGAAACAAGTGGGTGG + Intronic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1069966340 10:72120466-72120488 CAGGAGAAGAAAAAAAGGAATGG + Intronic
1070018639 10:72561247-72561269 CAGGAGTAGAAAATGGAAGTAGG + Intronic
1070166608 10:73903509-73903531 CCGGAGGAGAACACAGAGGTGGG - Intergenic
1070458043 10:76637109-76637131 CAAGATAAGAGAAAAGAAGTAGG - Intergenic
1070489635 10:76964510-76964532 CTGGAGAAGAAAAAAGTAGTTGG - Intronic
1070634962 10:78118055-78118077 CAGAACAAGAAAAAAGTTGTTGG - Intergenic
1070803499 10:79256888-79256910 TAAGAAAATAAAAAAGAGGTGGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071012028 10:80950794-80950816 CAGGAGAAGGAAGGAGATGTTGG + Intergenic
1071069535 10:81675460-81675482 CAGCAAAAGGAAAAAGAGCTTGG + Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071803428 10:89090162-89090184 CAGGAGGAGAAAATAGAGACAGG - Intergenic
1071877816 10:89861501-89861523 CAGAAGAAGAAAGAAGAAGGAGG - Intergenic
1071905778 10:90172062-90172084 CAGCAAAAAAAAAAAGAGGGGGG - Intergenic
1072196925 10:93124023-93124045 CAGGACAAGAGACTAGAGGTGGG + Intergenic
1072358021 10:94631640-94631662 CAGGAGACAGAAAAAGAGATGGG - Intergenic
1072363284 10:94682117-94682139 CAAGAGAAGAAATAAAAGCTAGG - Intergenic
1072380267 10:94860951-94860973 CAAGAAAAAAAAAAAGAGGGAGG + Intergenic
1072381310 10:94874055-94874077 CAAGAGAAGAAACAAAAGATAGG + Intergenic
1072517265 10:96197637-96197659 TATAAGAAGAAAACAGAGGTTGG + Intronic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073286843 10:102394632-102394654 CGGGACAAGAGAAAAGAGGGAGG + Exonic
1073338391 10:102727621-102727643 CAGGGGAGGAAGGAAGAGGTAGG - Intronic
1073748233 10:106494270-106494292 GAGGAGAAGAAAAAAGAAAAAGG - Intergenic
1073990264 10:109254274-109254296 CAGGAGCAAGAAAGAGAGGTGGG + Intergenic
1073999980 10:109361647-109361669 CAGGAGCAGTCAAAAGAGATAGG - Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074256770 10:111810872-111810894 CAAGAGAAGGAAAAAGTGGGTGG + Intergenic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074620236 10:115111530-115111552 CAGGAGAGGAAGCAAGGGGTGGG + Intronic
1074708942 10:116161071-116161093 CAGGAGTAGAAAACAGAGTTGGG + Intronic
1075554313 10:123419161-123419183 GAGGAGAAGAGAAGAGAGGAGGG - Intergenic
1075757584 10:124826695-124826717 GAAGAGAAGAAAGACGAGGTCGG - Exonic
1076068069 10:127464588-127464610 CAGCAGAAGACAAAAAAGGAAGG + Intergenic
1076182785 10:128423467-128423489 CAGGAGAAGTATAAAGACGAAGG + Intergenic
1076249651 10:128975564-128975586 AGGGACCAGAAAAAAGAGGTTGG - Intergenic
1076295325 10:129379279-129379301 CAGCAGAAGAGTAGAGAGGTGGG - Intergenic
1076998222 11:309527-309549 CAAGAGAAGAAAAAAACTGTAGG + Intronic
1077383150 11:2256657-2256679 CAGGGGGACAAAGAAGAGGTTGG + Intergenic
1077726781 11:4682816-4682838 TGGGAGAAGACAAAAGGGGTGGG - Intronic
1078262899 11:9727660-9727682 CAGGAGAGGTAAAAGTAGGTGGG - Intronic
1078449039 11:11426690-11426712 GAGGAAAAGAAACAAGGGGTGGG + Intronic
1078459998 11:11507449-11507471 TAGGAGGAAAAGAAAGAGGTGGG - Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078797853 11:14611233-14611255 CAGGAGAGGAGAAGAGAGTTTGG - Intronic
1078873121 11:15367425-15367447 CAGGAGATCAAAGAAGAGGCGGG + Intergenic
1079620278 11:22545687-22545709 GAGGAGAAGGAAACAGATGTAGG - Intergenic
1079959083 11:26900506-26900528 AAGAAGTAGAAGAAAGAGGTAGG - Intergenic
1080109770 11:28553208-28553230 CAGGAGAAGGAAAAAGCACTGGG - Intergenic
1080297353 11:30745454-30745476 AATCAGAAGGAAAAAGAGGTAGG + Intergenic
1080434177 11:32224573-32224595 CAGAAAAAAAAAAAAGAGGTAGG - Intergenic
1080857296 11:36123385-36123407 CAGGAGAAAGAAAAGCAGGTAGG - Intronic
1081000578 11:37665399-37665421 CAGGAGAGGGAAAAAGAAGGGGG + Intergenic
1081181554 11:39991328-39991350 CAGGAGAAAAGAAAATAGTTGGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081552010 11:44122057-44122079 CAGAAAAAGAATAAACAGGTGGG - Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1081829492 11:46096165-46096187 CAGGAGAGGGTAAGAGAGGTGGG - Intronic
1082094629 11:48119370-48119392 CAGGAGAATAAACAAGAGAAAGG - Intronic
1082143564 11:48638625-48638647 AGGGAGAAGAAAAGAGATGTTGG - Intergenic
1082649635 11:55773368-55773390 CTGGATAGGAAAAAAGAGATAGG - Intergenic
1082756016 11:57077452-57077474 AAGAAGAAGAAAAAAAAGGCAGG + Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083060284 11:59862804-59862826 CAACAGAAGAAAAAAGTGATAGG - Intronic
1083101264 11:60308676-60308698 CAGGAGAAGGAAAAAGGGAGGGG - Exonic
1083378436 11:62244641-62244663 TAGGAAAAGAAAAAAGAAGGTGG - Intronic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084839617 11:71834583-71834605 CTGGAGAAGAAAACACAGGATGG + Intronic
1085259240 11:75194806-75194828 AGGGAGAAGAAAAGAGAGATGGG - Intronic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085823600 11:79819173-79819195 AAAAAGAAAAAAAAAGAGGTGGG + Intergenic
1085841161 11:80013106-80013128 CAGTGGAAGAAAAAAGAGTAAGG + Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086266328 11:85002823-85002845 GAGGAGAAGAAAAGGAAGGTCGG - Intronic
1086294906 11:85354403-85354425 CATGAGAAGAACAAAGGGGAAGG + Intronic
1086846927 11:91761868-91761890 CAGCACAGGAAAAAAGAGGCAGG + Intergenic
1087115061 11:94515746-94515768 CAGGAGAAGAAAGGAAAGGAGGG - Intergenic
1087131738 11:94674572-94674594 AAGGAGAAGAATAAAGGGCTGGG + Intergenic
1087551470 11:99655799-99655821 TAGTAGTAGAATAAAGAGGTAGG + Intronic
1087903957 11:103674195-103674217 CAGAAGAAGAGAAAAGAACTTGG - Intergenic
1088861909 11:113808174-113808196 CAGGAGAAATAAATAGGGGTTGG + Intronic
1088969034 11:114755137-114755159 GAGGAGCAGAAAAATGGGGTTGG + Intergenic
1089054250 11:115572402-115572424 CGGGAGAAAAAAAAGCAGGTTGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089504386 11:118953798-118953820 AAGAAGCAGAAAGAAGAGGTTGG - Intronic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089878976 11:121755163-121755185 CATGAGAATAAAAAAGACATAGG + Intergenic
1089890928 11:121879871-121879893 CAGGAGAAAGAAAGAGCGGTGGG + Intergenic
1089912504 11:122116036-122116058 GATGGGAAGAAAAAAGTGGTGGG + Exonic
1090357884 11:126152220-126152242 CAGGAGAAGAATATAGAGAAAGG - Intergenic
1090392990 11:126401573-126401595 AAGAAGAAAAAAAAAAAGGTGGG + Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1091007546 11:131967148-131967170 CAGGTGAATATAAAAGAGGCTGG + Intronic
1091091382 11:132774481-132774503 CAGGAGATGAAAAGAGAGCGAGG - Intronic
1091284739 11:134402350-134402372 CAGGAGAAGAGAAGAGGGATGGG - Intronic
1091885977 12:4017337-4017359 TAGCAGAAGAAAAGAGAGGTGGG - Intergenic
1091995706 12:4992097-4992119 CAGAAAAAAAAAAAAGAGGGGGG - Intergenic
1092119239 12:6032341-6032363 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1092606015 12:10120233-10120255 CAGGAGAAGGGAAAAAAGATGGG + Intronic
1092694239 12:11151137-11151159 CAAGACAGGAAAAGAGAGGTGGG - Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1093063350 12:14630490-14630512 AATGACAAGAAAAAAAAGGTCGG - Intronic
1093201501 12:16192309-16192331 CAGGAGAAGAGAAAGTAGATAGG + Intronic
1093269738 12:17045389-17045411 CAAAAGAATAAAAAGGAGGTAGG + Intergenic
1093472054 12:19512662-19512684 CAGCAAAAAAAAAAAGAGGGGGG - Intronic
1093760767 12:22906850-22906872 GAGGAGGAGAAATAAGAGGAGGG + Intergenic
1093772549 12:23034458-23034480 GGGAAGAAGAAAAAAGAGGGAGG - Intergenic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094234382 12:28146846-28146868 GAGGAGAAGAAGAAAGAAGGAGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094582460 12:31746651-31746673 GATGAGGAGAAAAAAGAGGCAGG + Intergenic
1095205007 12:39429849-39429871 GAGGAGAAAAAAGAAGAGGAGGG + Intronic
1095237728 12:39818273-39818295 CAGGAAAAAAAAAATGAGTTGGG + Intronic
1095255304 12:40028306-40028328 GAAGAGGAGGAAAAAGAGGTTGG - Exonic
1095256810 12:40047201-40047223 CAGTAGAAGAAAAAAGGGTGTGG - Intronic
1095308094 12:40661918-40661940 CAGTGGAAGAAAGAAGATGTGGG + Intergenic
1095407213 12:41880164-41880186 GAGGAGCAGAAAAGAGAGGGAGG + Intergenic
1095717985 12:45369418-45369440 CAGAAGAAAGAAGAAGAGGTGGG - Intronic
1096217431 12:49805709-49805731 CAAAAGAAAAAAAAAGAAGTGGG + Intronic
1096343369 12:50823037-50823059 CAGAAGAAAAAAAAAAAAGTGGG - Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096381409 12:51161378-51161400 CAGGAAAAAAAAAAAGAAATTGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096628568 12:52910705-52910727 CAGGAAAAGAACAAACAGGAAGG + Intronic
1096838198 12:54364687-54364709 GAGGGGAAGAAAACAGAGTTTGG - Intergenic
1097361910 12:58667559-58667581 GAGGAGAGAAAAAAAGAGGGTGG - Intronic
1097980304 12:65731225-65731247 CAGGAGAAAAAAAAAGAAAAAGG + Intergenic
1098056566 12:66512317-66512339 CAGAAGAAGATAGAAGATGTGGG + Intronic
1098458402 12:70703031-70703053 CAGTAGAAAAAAAAAAAGGAAGG - Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098970950 12:76856455-76856477 CAGGAGTAGAAAAAGGAAATTGG - Intergenic
1099270919 12:80509940-80509962 CTAGACAATAAAAAAGAGGTGGG - Intronic
1099567181 12:84266861-84266883 CATGAGAAGAAAAGAGTGGATGG + Intergenic
1099767671 12:87009423-87009445 GAGGAGGAGAAAAAAGATGGGGG + Intergenic
1100022790 12:90090201-90090223 AAAGAGAAGAGAAAAGAGGCCGG - Intergenic
1100320624 12:93488263-93488285 CAAAAGAAGAAAAAAGAGCCAGG - Intronic
1100585432 12:95975333-95975355 AAAAAAAAGAAAAAAGAGGTTGG - Intronic
1100915610 12:99417487-99417509 AAAGAGAAGAAAAAAGTGGGAGG - Intronic
1101205574 12:102483816-102483838 CTTGAGAAGAAAAAAAAAGTTGG - Intergenic
1101599435 12:106196207-106196229 CATGAGAAGGAAAAAGAGCATGG + Intergenic
1101669269 12:106852282-106852304 TAGAAGAAGAAAAAATAAGTAGG - Intronic
1101689092 12:107058445-107058467 CTGGAGATGAAAAAACAAGTTGG + Intronic
1102049414 12:109851843-109851865 CAAAAAAAAAAAAAAGAGGTGGG - Exonic
1102689560 12:114749779-114749801 CAGCAGAAGAAAAAAGAAAAGGG + Intergenic
1102875780 12:116447522-116447544 AAGGAGAAGAAATAAAAGTTGGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1102983285 12:117259176-117259198 GATGAGGAGAGAAAAGAGGTGGG + Intronic
1103151879 12:118647965-118647987 AAGGAGAAGATAATAGATGTTGG + Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103222476 12:119257362-119257384 CAGGAAAAGAAAGAAAAGGAGGG + Intergenic
1103446396 12:120997690-120997712 CAGGAGATGATGATAGAGGTTGG + Intronic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103840072 12:123855795-123855817 AAGGAGAAGAAAACAGATCTCGG - Intronic
1103875844 12:124126487-124126509 TAGGAGAAGAAGGAAGATGTGGG + Intronic
1103978549 12:124720468-124720490 CAGGAGAGAAAAAAAGCAGTCGG + Intergenic
1104205682 12:126635946-126635968 CAAAAGAAGAAAAAAGTAGTTGG - Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105341426 13:19529625-19529647 CAGGAGAAGAAAGTAGGGGAAGG - Intronic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105806675 13:23955495-23955517 CAGGAGAGGGAAAAAGTGGGTGG + Intergenic
1106038058 13:26063318-26063340 CAGGCAGAGAAGAAAGAGGTGGG + Intergenic
1106452132 13:29892178-29892200 CAGAAGAAGAAAAGGGAGTTTGG + Intergenic
1106535872 13:30642300-30642322 CAGGAAAAAAAAAAAGATCTCGG - Intronic
1106662033 13:31809858-31809880 CAGAAGAAGAAAAAAGACAAGGG + Intergenic
1106849597 13:33775302-33775324 GAGGGGAAGAAAAAAAAGGAGGG - Intergenic
1107142555 13:37017486-37017508 CAGGTAAAGAAAAAACAAGTTGG + Intronic
1107174482 13:37384642-37384664 CAGAAGATGAGAAAGGAGGTTGG + Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107470676 13:40688377-40688399 CAAAAAAAGAAAAAAGAGGCCGG - Intergenic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1108051528 13:46445763-46445785 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1108713382 13:53056005-53056027 CAGGAGAAAACAAAATAGGTTGG + Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1109053619 13:57517090-57517112 CAGGAAAAGAAAACAGATTTGGG - Intergenic
1109121592 13:58464589-58464611 TAAGAGAAGAAATAATAGGTAGG + Intergenic
1109187666 13:59289761-59289783 GCTGAGAAGACAAAAGAGGTAGG - Intergenic
1109290154 13:60464034-60464056 CAGCAAAAGAGAAAAGAGGGAGG - Intronic
1109544081 13:63819388-63819410 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1109784496 13:67156284-67156306 CAGCAGAAGAAGATAGAGGCAGG + Intronic
1109944438 13:69414413-69414435 CAAGAGAGAAAAAAAGAGATGGG - Intergenic
1109971725 13:69779344-69779366 AAGGAAAGGAAAAAAGAGGAGGG - Intronic
1110147839 13:72214445-72214467 CAGGAGAAAAAGACAGAGATTGG - Intergenic
1111193822 13:84845329-84845351 CAGGAAAAAAAAAAAGTGGGGGG + Intergenic
1111379555 13:87429729-87429751 AAGGAGAAGTAAATAGATGTTGG - Intergenic
1112201409 13:97279591-97279613 CATGACAAGAAAAAAGATTTGGG + Intronic
1112839128 13:103553724-103553746 GAGGAGGAGAAAGAAGAGGAGGG - Intergenic
1112900047 13:104346514-104346536 CAGCAGAAGAATTAAGATGTAGG - Intergenic
1113161154 13:107382626-107382648 CAGGAGAAGAAAAAACATGTGGG - Intronic
1113194766 13:107789117-107789139 CAAGAGAAGAAATAAGAATTAGG + Intronic
1113852793 13:113427523-113427545 AAAGAAAAGAAAAAAGAGGCCGG - Intronic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114362337 14:21988517-21988539 GAGTAAAAGAAATAAGAGGTTGG + Intergenic
1114552998 14:23544865-23544887 GAGGAGCAGAAAAAAAAGGTGGG - Intronic
1114557314 14:23569557-23569579 GAGGAGAAGAGAAAAAAGGCAGG + Exonic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1114855652 14:26438245-26438267 CAAGAAAATAAAAAAGATGTGGG - Intergenic
1114915426 14:27258359-27258381 TAGGAGAAGAAAAGACAGCTAGG - Intergenic
1114976301 14:28104864-28104886 CTCTTGAAGAAAAAAGAGGTTGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115031617 14:28802688-28802710 CAAGAGTAGAGCAAAGAGGTAGG - Intronic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115461495 14:33666034-33666056 CTTGAGAAGAAAAATGAGATAGG + Intronic
1115518715 14:34211732-34211754 CAGGAGAGGAAAGATTAGGTAGG - Intronic
1115696758 14:35907697-35907719 AAGGAGAAAAGAAAAGAGGCTGG + Intronic
1115831222 14:37344280-37344302 CAGGGGAATAAAAAAGATGAAGG - Intronic
1115850595 14:37587414-37587436 CAGAAAATGAAAACAGAGGTTGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116368143 14:44095069-44095091 CAAAAGAAGAGAAAAGAGGAAGG + Intergenic
1117157337 14:52953503-52953525 CAAAACAAGAAAAAAAAGGTGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117463620 14:55971235-55971257 CTGGAGAAGGAAGCAGAGGTTGG - Intergenic
1117798575 14:59419809-59419831 CAGGAGAGTAAAAAAGATGTTGG + Intergenic
1118367651 14:65109376-65109398 CAGGAGCTGAAAGATGAGGTTGG - Intergenic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1118903445 14:70005443-70005465 CAGGAGAGGAAAAAAGAGGTTGG - Intronic
1118971053 14:70638346-70638368 AAAGAGAAGAAATTAGAGGTTGG - Intergenic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119132547 14:72187707-72187729 CAGGAAAAGAAAAGAGAATTGGG - Intronic
1119263796 14:73252855-73252877 TAGGTGTAGAACAAAGAGGTGGG + Intronic
1119707515 14:76793444-76793466 GAGGAGAAGGAAGAAGAGGGAGG + Intronic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120848894 14:89150782-89150804 CAGGAGAAGAAGACAAAGGCTGG + Intronic
1120964463 14:90155332-90155354 CTGGAGAAGAATTTAGAGGTAGG + Intronic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121232713 14:92369444-92369466 AATGAGAAGAAGAAAAAGGTTGG + Intronic
1121303449 14:92890065-92890087 GAGGAGCAGTCAAAAGAGGTGGG + Intergenic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121615549 14:95311356-95311378 CAGGAGAGGAAAGCAGGGGTGGG + Intronic
1121748413 14:96322563-96322585 TACGAGAAGAAAAAGGAGATGGG + Exonic
1121793266 14:96714785-96714807 AATGAGAAGAAACAAAAGGTGGG - Intergenic
1122023971 14:98861131-98861153 CACCAGAAGACAAAAGAGGCAGG + Intergenic
1122293910 14:100694348-100694370 GAGGAGGAGAAGAAAGAGATGGG - Intergenic
1122502011 14:102207042-102207064 CAGGAGGATAAAGAGGAGGTGGG + Intronic
1123188995 14:106549998-106550020 CAGGAGAACAGCAAAGAGGAAGG - Intergenic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124507442 15:30290484-30290506 CAGTAGAAGAACAGAGAAGTAGG + Intergenic
1124523930 15:30430681-30430703 AAAGAAAAGAAAAAAAAGGTGGG + Intergenic
1124534736 15:30535535-30535557 AAAGAAAAGAAAAAAAAGGTGGG - Intergenic
1124736113 15:32248175-32248197 CAGTAGAAGAACAGAGAAGTAGG - Intergenic
1124763913 15:32472065-32472087 AAAGAAAAGAAAAAAAAGGTGGG + Intergenic
1124832046 15:33158553-33158575 CAGAGGAAGAAAAAAGAAATGGG + Intronic
1124847813 15:33309389-33309411 CAGGAGAAGAAAAGAGTGGATGG + Intergenic
1125005863 15:34816935-34816957 CTGGAGAAGAGAAAAAAGGGGGG + Intergenic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125090586 15:35787169-35787191 CAGGGGAAATAAAAAGAGGTTGG - Intergenic
1125111155 15:36036218-36036240 CAGAAGAAAAAAAAATAGCTGGG + Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125603471 15:40927800-40927822 AAGGATGAGAAACAAGAGGTTGG - Intergenic
1125647584 15:41285222-41285244 CAGGAGAAGAAAAAAAATATCGG + Intergenic
1125705955 15:41736425-41736447 CACGAGAAGAATAAACAGGAGGG - Exonic
1126059189 15:44762453-44762475 AAGGAGAGGAGAAAAGGGGTTGG - Intronic
1127150569 15:56070676-56070698 AAGGAGAAGAACAAAGATGGAGG + Intergenic
1127176558 15:56364447-56364469 AAAGAAAAGAAAAAAGAGGCTGG - Intronic
1127301464 15:57658217-57658239 CAAGAGGGGAAAAAAGAGGAAGG - Intronic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127593639 15:60454676-60454698 AAAAAAAAGAAAAAAGAGGTTGG - Intronic
1127614481 15:60670194-60670216 AAGAAAAAAAAAAAAGAGGTAGG - Intronic
1127621658 15:60740016-60740038 CAGGTGAGGAGAAGAGAGGTTGG - Intronic
1127977511 15:64009055-64009077 CAGGAGGTGAAAATAGAGGAGGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128231527 15:66038862-66038884 CAGGAGGGGAAAAAAGAAGTGGG + Intronic
1128436869 15:67660890-67660912 CAGGAGTGGAAGAAAGAGCTAGG + Intronic
1128462393 15:67880840-67880862 CAGGAAGGGAAAAAAGAGGAAGG - Intergenic
1128624044 15:69181048-69181070 CAGGGAGAGAAAAAAGAGGGAGG + Intronic
1128957353 15:71962392-71962414 CAGGAGAATAAAGAAGAATTAGG - Intronic
1129106346 15:73310132-73310154 TGGTAGATGAAAAAAGAGGTTGG + Intergenic
1129194454 15:73955775-73955797 CAGGGGAAGAGAAGAGAGGGAGG + Intergenic
1129544371 15:76379292-76379314 CAAAAGAAGAAAAAACAGGAAGG + Intronic
1129735739 15:77961321-77961343 CAAAAGAAGAAAACTGAGGTAGG - Intergenic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130147653 15:81286733-81286755 CATGAGAAGAGAAAAGAGAAGGG + Intronic
1130663097 15:85846394-85846416 CAGAGGAACAAAAAAGAGATAGG + Intergenic
1130807462 15:87341022-87341044 CAGGTAAAGAGGAAAGAGGTGGG + Intergenic
1131000768 15:88938084-88938106 CAGGAGAACAAATAGGAGATAGG + Intergenic
1131580397 15:93637248-93637270 GAGGAGGAGAAAAAAGAAGAGGG - Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131826290 15:96324421-96324443 AAGAAGAAGAAAAAAAAGTTAGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133381492 16:5334556-5334578 CAGGAGAAGAAAAGAGGAGGAGG + Intergenic
1133514870 16:6498805-6498827 CAGGAGAAGAACTAGCAGGTGGG - Intronic
1133535107 16:6694399-6694421 CACAAGAAGAAAAAACTGGTTGG + Intronic
1133994609 16:10739020-10739042 CAGAAAAAAAAAAAAAAGGTTGG - Intergenic
1134210747 16:12274533-12274555 CAAAAAAAAAAAAAAGAGGTGGG - Intronic
1134278119 16:12794769-12794791 TAGGCCAAGAAAAGAGAGGTTGG - Intronic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134867304 16:17619907-17619929 CAGAAGAAGAAAAGAATGGTGGG - Intergenic
1135098370 16:19583846-19583868 CAAGGGGAGAACAAAGAGGTTGG - Intronic
1135264411 16:21010343-21010365 CAGGAGAGGAAAGCAGAGCTGGG - Intronic
1135504651 16:23025897-23025919 CAGGAGAAGAAACAAAGGATTGG + Intergenic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1136401767 16:30023193-30023215 GAGGAGAGGAGAAGAGAGGTTGG - Intronic
1136491885 16:30613939-30613961 AAGGAGAAGAAAGAAGAAGGAGG + Intronic
1136574398 16:31114916-31114938 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137593488 16:49708277-49708299 AAAGAAAAGAAAAAAGTGGTGGG - Intronic
1137602336 16:49764729-49764751 AAAGAAAAGAAAAAAGAGGTGGG - Intronic
1137820391 16:51439125-51439147 GAGAAAAAGAAAAAAGAGGGAGG + Intergenic
1137823552 16:51468288-51468310 TAGGAGAAGCAAGAAGAGTTTGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138294721 16:55876494-55876516 AAGGAGAAGGGAACAGAGGTAGG + Intronic
1138917465 16:61484014-61484036 AAGAAGAAAAAAAAAGAGATAGG - Intergenic
1138994728 16:62435812-62435834 CAGCTTAAGAAATAAGAGGTAGG + Intergenic
1139133425 16:64173585-64173607 CTGGAAAAAAAAAAAGAGGTTGG - Intergenic
1139133671 16:64176702-64176724 CAGGAGAACAAAAAAATGGCTGG - Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139753886 16:69127306-69127328 AGTGAGTAGAAAAAAGAGGTGGG + Intronic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1140210458 16:72965411-72965433 CAAGAGAGGATAAAGGAGGTAGG + Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140318716 16:73926763-73926785 AAGGAGAAGAGAAAAAAGATGGG - Intergenic
1140325262 16:73995322-73995344 CTGGAGAAGAGAAAAGAATTAGG - Intergenic
1140577734 16:76191631-76191653 CAGGACTAGATAAAAGAAGTAGG + Intergenic
1140740335 16:77936042-77936064 GGGGAGAAAAAAAAGGAGGTGGG + Intronic
1140775582 16:78246353-78246375 CAGAAGGGGAAAAAAAAGGTAGG - Intronic
1140788593 16:78367745-78367767 AAGAAAAAAAAAAAAGAGGTTGG - Intronic
1141364152 16:83426800-83426822 CAAGAGAGGAGAAAAGAGATGGG - Intronic
1141517955 16:84559081-84559103 CAGGGGAAAAAAATAGAGATGGG - Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141578474 16:84981162-84981184 CAGGAGCAGAAAAAGGAGTCAGG + Intronic
1142484580 17:238221-238243 AAGGAGAAAAGAAAAGAGGGAGG + Intronic
1142705706 17:1692639-1692661 AAGAAGAACTAAAAAGAGGTGGG - Intergenic
1143800396 17:9374765-9374787 CATTAAAAGAATAAAGAGGTTGG + Intronic
1143910895 17:10247896-10247918 GGGGAGAAGAGAAAAGATGTTGG + Intergenic
1144180951 17:12752285-12752307 AAGAAGTATAAAAAAGAGGTGGG + Intronic
1144186085 17:12796562-12796584 CACTAGAAAATAAAAGAGGTGGG - Intronic
1144378253 17:14667136-14667158 GGGGAGAAGAGAAAAGAGGTAGG + Intergenic
1144596999 17:16578363-16578385 AAAGGGAAGAAAACAGAGGTGGG - Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144734264 17:17546219-17546241 CAGGAGAAGAAAGGAGATGATGG + Intronic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145179043 17:20728788-20728810 CAGGAGAAAAAAAAAAAGAATGG - Intergenic
1145220365 17:21083666-21083688 CAGAAGAAAAAAAAAAAGCTGGG - Intergenic
1145979387 17:29002861-29002883 CTGGAGGAGAAAAGAGAGGAAGG - Intronic
1146051870 17:29560613-29560635 GAGGAGGAGAAACAAGAAGTGGG + Exonic
1146550198 17:33774129-33774151 CAGGGGAAGAAATATGAGCTTGG - Intronic
1147022898 17:37552722-37552744 CAAGAGAAGAAAAAAGGAGAGGG + Intronic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1147756544 17:42772303-42772325 CAGGAGTGAAAAAAAGAGGTGGG + Intergenic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1148808768 17:50277692-50277714 CTGTGGAAGAAAAGAGAGGTCGG - Intronic
1148884296 17:50760329-50760351 CAGAAAAAGAAAAAAGGGTTGGG + Intergenic
1148938465 17:51185136-51185158 AATGAGAAGAAAACAGAGCTAGG + Intronic
1149008587 17:51831608-51831630 AAGGAAAACAAAAAAGAGGAAGG + Intronic
1149081280 17:52660544-52660566 CAGAAGGAGAAGGAAGAGGTAGG + Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149507822 17:57210677-57210699 GTGTAAAAGAAAAAAGAGGTGGG + Intergenic
1149747469 17:59113222-59113244 TAAGAAAAGAAAAAAGAGGCCGG + Intronic
1149911937 17:60574674-60574696 GGGGAGAAGAAAAAAGATGATGG - Intronic
1150225644 17:63523220-63523242 CAGGAAAGGAAAGGAGAGGTGGG + Intergenic
1150273747 17:63882800-63882822 GAGGAGGAGACAAAAGAGGAGGG - Intergenic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150464621 17:65381534-65381556 CAGGAGAAAACAGAAGAGGCTGG + Intergenic
1150465208 17:65386814-65386836 AAAGAAAAGAAAAAAGAGGCAGG - Intergenic
1150755587 17:67909274-67909296 CAGGATAAAAAAAAAAAGGGGGG - Intronic
1150952553 17:69820133-69820155 CAGGAGAAGAAAACAGGTTTGGG - Intergenic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151026821 17:70686645-70686667 CTGGAGAGGGGAAAAGAGGTGGG + Intergenic
1151621192 17:75246125-75246147 CAGCTGAAGAAAAGAGGGGTCGG - Intronic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1151886679 17:76926816-76926838 CTGGAGAAGGAAAGAGAGGGAGG - Intronic
1152084064 17:78206659-78206681 GAGGAGAAGAAAGAAGATGAAGG - Intronic
1152652974 17:81504579-81504601 GAGGAGAGGAGAAAAGAGGGAGG + Intergenic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1153017388 18:596470-596492 CAGGAGGGGAAAAAAGTAGTGGG - Intergenic
1153367639 18:4276008-4276030 GAGGAGCAGAAAAAAGAGAGAGG + Intronic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153850957 18:9093838-9093860 AAGGAGAAAGAAAGAGAGGTGGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1153973746 18:10248564-10248586 AAGAAAAAGAAAAAAGAAGTTGG + Intergenic
1153983917 18:10336191-10336213 AAAAAAAAGAAAAAAGAGGTAGG + Intergenic
1154424164 18:14259311-14259333 CGGTGGAAGAAAAAAGGGGTGGG + Intergenic
1154426835 18:14278513-14278535 CGGTGGAAGAAAAAAGGGGTGGG + Intergenic
1154465645 18:14641261-14641283 CGGGAGAACGAAAAAGAGGATGG - Intergenic
1154975908 18:21457569-21457591 CAAGTGAAAAAAACAGAGGTAGG - Intronic
1155219490 18:23671435-23671457 CTGGAGAAGGAACAAGAAGTGGG + Intergenic
1155815815 18:30307962-30307984 CTGGAGAAAAAGGAAGAGGTGGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155933556 18:31731147-31731169 AAGGAGAAGAAAAAATTGTTTGG + Intergenic
1155956140 18:31958515-31958537 CAAGAAAAGAAAAAACAGCTGGG + Intergenic
1156100542 18:33588970-33588992 GAGTAGAAGAAAAAAGATGAAGG - Intronic
1156697827 18:39788912-39788934 CAGGAGATCAGAAAACAGGTAGG - Intergenic
1157129794 18:44996137-44996159 GAGAAGAAGAGAAAAGAGGGAGG - Intronic
1157244318 18:46040108-46040130 GAAGATAAGACAAAAGAGGTGGG + Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1157793140 18:50550832-50550854 CAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1158001643 18:52626392-52626414 CAGGAGAACAATTAAGAGCTTGG - Intronic
1158143400 18:54281799-54281821 CAGCAGAAAAAAAAGAAGGTTGG - Intronic
1158455554 18:57604100-57604122 CAGCACAAAAGAAAAGAGGTGGG + Intronic
1158783902 18:60685513-60685535 CATGAGAAGACAAGGGAGGTCGG + Intergenic
1158978141 18:62731486-62731508 CAGGAGAGGGAAAAAGATGGGGG - Intronic
1159491502 18:69140749-69140771 CAAGAGAAGAAGAAGGGGGTGGG + Intergenic
1159862377 18:73664098-73664120 CAGCAAAAGAAAAAAGTGGCCGG + Intergenic
1159873321 18:73783207-73783229 TAGGAGAAGAAAAAGGTAGTAGG - Intergenic
1159902439 18:74060222-74060244 CTGGAGAAAAAGAAAGAGCTGGG - Intergenic
1160083864 18:75756013-75756035 CAGGAGAAGAACACAGTTGTGGG - Intergenic
1160161434 18:76474764-76474786 ATCAAGAAGAAAAAAGAGGTTGG + Intronic
1160971250 19:1768745-1768767 GAGGTGAAGAAAACAGAGGAAGG + Intronic
1161042009 19:2115326-2115348 CAAGAGGAGGAAAAAGAGGAAGG - Exonic
1161357162 19:3825529-3825551 CAGGAGGAGAGAAGAGAGGGGGG - Intronic
1162404576 19:10465999-10466021 CAGGAAAAAAAAAAAAAAGTAGG - Intronic
1162875171 19:13616141-13616163 CTGGTGAAGAAAAAAGTGGGTGG - Intronic
1162907694 19:13833382-13833404 CAAGAGAAGAAAAACGGAGTGGG + Intergenic
1163114306 19:15180033-15180055 CAGGAGAGGGAAGAGGAGGTGGG - Intronic
1163194353 19:15704141-15704163 CAGGTAAAAAAAAAAAAGGTTGG + Intergenic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164452327 19:28377527-28377549 AAAGAAAAGAAAAAAGAGGCTGG - Intergenic
1164936621 19:32219925-32219947 GAGGATAAGAAAGAAAAGGTGGG - Intergenic
1165315510 19:35053021-35053043 CAGGAAAAAAAAAGCGAGGTGGG - Intronic
1165397293 19:35571535-35571557 CAGAAGAAGACAACAGGGGTTGG - Intergenic
1165717382 19:38055242-38055264 CATGAGAAGAAAAGGGAGGGAGG + Intronic
1166532552 19:43551810-43551832 TGGGAGAAACAAAAAGAGGTTGG + Intronic
1166665607 19:44678410-44678432 AAGAAGAAGAAAAAAAAGCTTGG - Intronic
1166845759 19:45727260-45727282 AAAGAAAAAAAAAAAGAGGTCGG + Intronic
1167271772 19:48510181-48510203 CAGGAGAGGAGAAGAGGGGTGGG + Intronic
1167835432 19:52064601-52064623 CAGAAGAACAAACAAGAGGGAGG + Exonic
1167907151 19:52670894-52670916 CAGGTTAAGATAAAAGATGTTGG + Intronic
1168101541 19:54144099-54144121 CAGAAGGAGAAGGAAGAGGTTGG + Exonic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1168533083 19:57145594-57145616 AAGGAAAAGAAAAAAGAAATAGG + Intergenic
1168721413 19:58556798-58556820 CAGGAAAAGAAAAGAGAGATGGG + Intronic
925115553 2:1375484-1375506 GGGGAGAAGGAAAAAGAGGGAGG + Intronic
925324395 2:3006233-3006255 CATAGGAAGTAAAAAGAGGTCGG + Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925651427 2:6093687-6093709 GAAGAGGAGAAGAAAGAGGTTGG + Intergenic
925688161 2:6493988-6494010 AAGAAGAAGAAAAAAGATTTAGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926329013 2:11809714-11809736 CAGGAAAGGAAAAAAGATCTAGG - Intronic
926834477 2:17002708-17002730 TAAGAGAAGAAGAAAGTGGTAGG + Intergenic
926960823 2:18356696-18356718 TAAGAGAAGAAAAGAGAGGAGGG + Intronic
927110229 2:19859249-19859271 CACGTGAAGGAAAAGGAGGTAGG + Intergenic
927408868 2:22802603-22802625 CAGTAAAAAAAAAAAGTGGTGGG - Intergenic
927578299 2:24219081-24219103 CAGGAGGAGGAAACAGAAGTGGG - Intronic
927879351 2:26679742-26679764 CAGGTGAACTAAAAAGAGGGAGG + Intergenic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928373777 2:30759162-30759184 AAGGAGGAGAAAAACGAGGGAGG - Intronic
928703691 2:33925031-33925053 CAGGAGCAGGAAAAAGAAGTTGG + Intergenic
928961335 2:36929380-36929402 CAAAAGAAAAAAAAAGGGGTGGG - Intronic
928984185 2:37164617-37164639 CAGCTAAAGAAAAAAGATGTTGG - Intergenic
929564509 2:42976125-42976147 CAGGAAAAGAAAAAAAAGGAAGG + Intergenic
929656153 2:43733706-43733728 GAGGAGAAAAAAGTAGAGGTGGG + Intronic
929996088 2:46827042-46827064 CAGGGGAAGATAAGAGAGGCTGG - Intronic
930012161 2:46945730-46945752 AAGAAGAAGAAAAAAAAAGTGGG - Intronic
930207517 2:48602770-48602792 GAGTAGAAGAAAAAAGAGAATGG + Intronic
930607855 2:53510864-53510886 AAGGAGAAGAGAAGAAAGGTAGG + Intergenic
930778322 2:55197120-55197142 AAGGAGAGGAAAAAATAGGAAGG + Intronic
931208821 2:60173120-60173142 CTGAAGAAGAAAGAAGAGGGAGG + Intergenic
931224472 2:60318003-60318025 CAGCAGAAGTGAGAAGAGGTGGG + Intergenic
931938086 2:67220044-67220066 AAGAAGAAGAAAAAAAAGGTGGG + Intergenic
932098678 2:68876141-68876163 CAATAGAATAAAAAAGAAGTTGG + Intergenic
932442917 2:71749220-71749242 CAGGAGAAGGAAAAGCAGCTGGG + Intergenic
933196676 2:79398127-79398149 AAGGTTAAGAGAAAAGAGGTGGG + Intronic
933248012 2:79997306-79997328 AAGGAGAAAAAAAGAGAGGGAGG + Intronic
933248730 2:80004585-80004607 GAGAGGAAGAGAAAAGAGGTTGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933326339 2:80842952-80842974 CAGGACAAGAAAGAAGTGCTAGG - Intergenic
933844250 2:86312637-86312659 CAAAAAAAGAAAAAAGAGCTGGG + Intronic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935470110 2:103449151-103449173 CAGGAGGAGAAAAGAAATGTGGG + Intergenic
935808165 2:106769452-106769474 CAGCAGCAGAAACAAGAGGCTGG - Intergenic
936002206 2:108844181-108844203 CAGGAAAGGAAAAATCAGGTAGG - Intronic
936004430 2:108870405-108870427 CAGAAGGAGAAAAAAGAGAAAGG + Intronic
936045153 2:109181711-109181733 CTGGAGAAGAAAGAGGAGGCAGG - Intronic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
937546105 2:123022826-123022848 CAGGAGAAGAAAATAGGGATGGG + Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937714977 2:125021907-125021929 GAGAAGAAGAAAACAGGGGTAGG + Intergenic
938295915 2:130179415-130179437 CAAAAAAAGAAAAAAGAGGCTGG - Intronic
938626483 2:133114672-133114694 CAAGGAAGGAAAAAAGAGGTGGG - Intronic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
938757897 2:134397491-134397513 CTGGAGGAGAGAAAGGAGGTGGG + Intronic
939076538 2:137609298-137609320 ATGGAGAAGAAAAAATATGTAGG + Intronic
939592786 2:144086165-144086187 CAGGAGAAGCAAAGAGAACTAGG - Intronic
939658236 2:144854029-144854051 CAGGAGTAAAAAAAAGAAGCAGG - Intergenic
939756984 2:146126390-146126412 GAGGAGGAGAAAAGAGAGGTAGG - Intergenic
939941542 2:148357625-148357647 AAGAACAAGAAAAAAAAGGTGGG - Intronic
939967031 2:148620282-148620304 CAGGAGAAGAAAAACAATGTGGG - Intergenic
940179731 2:150918634-150918656 AAGGAAAAGAAAAGAGAGGAGGG + Intergenic
940400237 2:153240811-153240833 CAGGAGAAGAAAGAAGGCATTGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
940638938 2:156328556-156328578 CAAAAGAAGAAAAAAAATGTTGG - Intronic
940875989 2:158897637-158897659 CAGGAGATGGAAAAAGGGGGTGG - Intergenic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
940953159 2:159699540-159699562 GAGGACAAAAAAAAAGAGCTGGG + Intergenic
941046519 2:160682340-160682362 CAGGAAAAGAACAAACAGGATGG - Intergenic
941309974 2:163914955-163914977 CAGGAGAGTAAAAAAGAGCAAGG - Intergenic
941387849 2:164875069-164875091 CAGGAGGAGGAAGAAGAGGAGGG + Intergenic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941471677 2:165896271-165896293 AAAGAGAAAAAGAAAGAGGTGGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941811273 2:169758118-169758140 TAGGAAAAAAAAAAAGAAGTTGG + Intronic
942153682 2:173104981-173105003 AGGGAGGAGAAACAAGAGGTTGG + Intronic
942278997 2:174342419-174342441 AAGGAGAGGACAAAAGGGGTCGG - Intergenic
942473110 2:176283244-176283266 CAGGTGAAGAACAAAAAGGGAGG - Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
943243512 2:185418140-185418162 CAGCAGAAGAGAAAAATGGTAGG - Intergenic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943301623 2:186209874-186209896 TAGGAGAAGAAAAAAGTTGGAGG - Intergenic
943599809 2:189902264-189902286 CAGGAGGAAAAAAAACAGATAGG - Intronic
943694456 2:190909640-190909662 TAGGAGAAGAAATAGGAGTTTGG + Intronic
944085252 2:195838458-195838480 CAGGAGAAAAAAAAACAGAAAGG + Intronic
944156024 2:196608799-196608821 CAGAAGAAGGAAATAGAAGTTGG - Intergenic
944196610 2:197061505-197061527 CAGGAGAAGAAGAAAATAGTGGG + Intronic
944335737 2:198531624-198531646 AAAGAAAAGAAAAAAAAGGTAGG + Intronic
944357476 2:198808611-198808633 GAGGAGGAGCTAAAAGAGGTGGG - Intergenic
944589711 2:201205529-201205551 CTAGAGAAGGAAAAAGAGGGAGG - Intronic
945128544 2:206540554-206540576 CAGGAGAAGAGAAAACAAGCAGG + Intronic
945274025 2:207970218-207970240 GAGGAGAGGAAAGAGGAGGTAGG + Intronic
945521929 2:210838435-210838457 CAGGAAAAAAAAAAAAAGGGAGG - Intergenic
945744432 2:213703091-213703113 CAGGAGAGGGAAAAAGAGAATGG - Intronic
945908820 2:215623444-215623466 CAAGAGAATATAAAAGAGGTGGG - Intergenic
945966056 2:216188066-216188088 TAGGGGAAGAAAAAAGAGTGAGG - Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946241522 2:218358902-218358924 AAAAAGAAGAAAAAAGATGTAGG + Intronic
946308937 2:218872202-218872224 CAGGAGAATAAAACAAAGGTGGG + Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
946549873 2:220789435-220789457 CATGAGAAAAAAAAAGAAGACGG + Intergenic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
946742020 2:222812157-222812179 AAGGAAAAGAAAAGAGAAGTTGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947476247 2:230450074-230450096 CAGGAGAAGAAAGGAGAAGCAGG + Intronic
947647350 2:231753161-231753183 CTGGAGGAGAAAAATGAGTTGGG - Intronic
947930578 2:233961598-233961620 GAAAAGAAGAAAAAAGAGGCCGG - Intronic
948075078 2:235159603-235159625 CAGGAGAAGAAAAGAGAGTGTGG + Intergenic
948183885 2:236003779-236003801 CAGAAAAAAAAAAAAGTGGTAGG - Intronic
948285006 2:236777369-236777391 GAGGAGAAGAAAGGAAAGGTGGG - Intergenic
948325520 2:237116878-237116900 CATGAGAAGAAAAGATGGGTGGG + Intergenic
948671192 2:239569951-239569973 CAGGAGAAGAAACCAGAAGCTGG - Intergenic
1168999855 20:2160849-2160871 CATGAAAGGAAAAAAAAGGTGGG + Intronic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169153515 20:3309082-3309104 CTGAAGAAGAAAAACAAGGTGGG - Intronic
1169219881 20:3815908-3815930 CAGCACCAGAAAAAACAGGTGGG - Intergenic
1169323982 20:4660514-4660536 CTGGTGAAGAAATAAGATGTGGG + Intergenic
1169674643 20:8139999-8140021 CGTGAGAAGCTAAAAGAGGTGGG + Intronic
1170023255 20:11860438-11860460 CAGGAGAGGAAAAGAGATCTGGG - Intergenic
1170193722 20:13669417-13669439 CAGAAGAAGAAAAAAGAAAAAGG - Intergenic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1171186136 20:23125688-23125710 CAGGAGCAAAAAAAGGAAGTCGG + Intergenic
1171203554 20:23261167-23261189 GAGGAGAAAAAGATAGAGGTAGG + Intergenic
1172073285 20:32274721-32274743 CAGGGGAAAAAAAAATAGGAGGG + Intergenic
1172818523 20:37710913-37710935 GAGGAGACGAAAGCAGAGGTAGG - Intronic
1172931266 20:38588041-38588063 TGGGATGAGAAAAAAGAGGTGGG - Intronic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173317264 20:41956357-41956379 CAGGACAAGGAAAAAGGTGTAGG - Intergenic
1173576276 20:44114802-44114824 CAGGAGGTGAACAAAGAGGATGG + Exonic
1173820868 20:46019557-46019579 CAGGTCAAGAAACAAGAGGCTGG + Intergenic
1173965248 20:47107757-47107779 AAGGAGAAGAAAGAAGAAGTAGG + Intronic
1174209408 20:48865536-48865558 CAAAAGAAACAAAAAGAGGTGGG + Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1176016150 20:62934168-62934190 CAGGAGAGCAGGAAAGAGGTAGG - Intronic
1176041921 20:63070226-63070248 CAGGGGAAGAACAGAGAGGCTGG - Intergenic
1176109317 20:63404317-63404339 CAGGGGAGGAAAGAACAGGTGGG + Intergenic
1176808912 21:13517221-13517243 CGGGAGAACGAAAAAGAGGATGG + Intergenic
1176847933 21:13890926-13890948 CGGTGGAAGAAAAAAGGGGTGGG - Intergenic
1176948986 21:15021402-15021424 CAGGAGAGGAGAACAGAGATTGG + Intronic
1177756598 21:25356147-25356169 CAAGAGAAGACAGAAGAGGAGGG + Intergenic
1177807969 21:25893660-25893682 CTGCAGAAGAAAAAAAAGTTGGG + Intronic
1177916279 21:27091730-27091752 TAGTAGAGGAAAAGAGAGGTAGG - Intergenic
1178084397 21:29098312-29098334 CAGTAGAAAAAAAGAGAAGTGGG - Intronic
1178361025 21:31948598-31948620 AGGGAGGAGAAAAAGGAGGTGGG + Intronic
1178516001 21:33247678-33247700 CAGGGAAAGAAAGAAGGGGTAGG - Intronic
1178566928 21:33695109-33695131 CAAGAGTAGAAAAAAGTGGCCGG - Intronic
1179084849 21:38207579-38207601 GAGGAGAGGAGAAAAGAGGAGGG - Intronic
1179366327 21:40761394-40761416 GAGGAGAGAAAAAAAGAGGGAGG - Intronic
1179531075 21:42020051-42020073 CACAAGAAGAACAAAGAGGAAGG - Intergenic
1180145838 21:45918253-45918275 CAGGAGCAGAAAAGAGGTGTCGG - Intronic
1180689409 22:17698928-17698950 AAAGAGAGGAAAAAAGAGGGAGG - Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181335019 22:22123010-22123032 CAGGAGTGGGGAAAAGAGGTTGG - Intergenic
1181691071 22:24561033-24561055 AAGGAAAAGAAAAAAAAGGCTGG - Intronic
1181761559 22:25062239-25062261 GAGGAGGAGAAAAGAGAGGAAGG - Intronic
1181985020 22:26794398-26794420 CAGAAAAAAAAAAAAGAAGTAGG + Intergenic
1182011146 22:27001715-27001737 TAGGAGAGAAAAAAAAAGGTGGG - Intergenic
1182137820 22:27922282-27922304 TAAAAGAAAAAAAAAGAGGTTGG - Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182210556 22:28673071-28673093 CAGGAGTTAAAAAAAGAAGTTGG + Intronic
1182286327 22:29250352-29250374 CAAGAGAAGAAGAAAAAGGCAGG - Intronic
1182731806 22:32501967-32501989 GAGGAAAAGAAGAAAGTGGTTGG - Intergenic
1182883838 22:33756563-33756585 AGGGAGAAGAAAGAACAGGTGGG + Intronic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183121059 22:35730623-35730645 AAGAAAAAAAAAAAAGAGGTTGG + Intergenic
1184856360 22:47148745-47148767 CAGGAGAAGAACCCAGAGGAGGG - Intronic
1184936962 22:47731694-47731716 CAAGAGAAGAGAAGAGGGGTAGG + Intergenic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949740636 3:7229644-7229666 CTGGAGAAGAAAACAGTGGTAGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949951957 3:9236583-9236605 CAGGAGTAGGAAGAAGAGGGGGG - Intronic
950011693 3:9728757-9728779 GAGGAGAAGAAATGAGATGTGGG - Intronic
950807053 3:15614409-15614431 CAGAAGGAGAAAATAGAGGCTGG - Intronic
950952547 3:17015882-17015904 AAGGGAAAGAAAAAAGACGTTGG + Intronic
951221231 3:20070598-20070620 CAGTATAAGAAAAGAGAGGCCGG - Intronic
951251376 3:20397748-20397770 GAGTATAAGAAAAAGGAGGTTGG + Intergenic
951287590 3:20833897-20833919 CAAGAAAAGAGAAAAGATGTAGG + Intergenic
951585907 3:24214412-24214434 CAAGAGAGGAAAAAATAGGCAGG + Intronic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
951922140 3:27867648-27867670 AATGAAAAGAAAAAAGAAGTTGG - Intergenic
951974354 3:28487828-28487850 TAGGTGAAGAAAAAAAAGGGGGG - Intronic
952001698 3:28793452-28793474 TAAGATAAGAAGAAAGAGGTAGG + Intergenic
952030651 3:29138395-29138417 CAGGAGAGAAAAACAGAGGGTGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952576115 3:34775955-34775977 CAGGAGAAGAAAAAGGAATCAGG + Intergenic
952654258 3:35765273-35765295 CCGAAGAAGAAAAAAGATGAGGG - Intronic
953033765 3:39193927-39193949 CAGGGGAAGAGACAAGAGGGAGG - Intergenic
953086490 3:39673338-39673360 GAGGACAAGAAAGCAGAGGTTGG + Intergenic
953191373 3:40691042-40691064 AAGTAGATGAAAAAGGAGGTGGG + Intergenic
953624637 3:44560813-44560835 CAGGAGATGAAAAAAGATACAGG - Intronic
953899619 3:46832651-46832673 CAGGAGAAGAAGAAACACATGGG - Intronic
954032691 3:47831050-47831072 CAGGAACAGAGAAAAGAGATGGG - Intronic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954039877 3:47877412-47877434 CCAGAGAAGAAAACAAAGGTAGG - Exonic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
954933099 3:54301300-54301322 CAGAAAAAAAAAAAAGAGGCCGG + Intronic
955025375 3:55162542-55162564 CATGAGAAGAACATAGAGGTGGG + Intergenic
955469315 3:59269674-59269696 GAGGAGAAAAAGAAAGAGATAGG - Intergenic
955537643 3:59941378-59941400 CAGGAGAAGAAAACAGTGAGAGG - Intronic
955551669 3:60091750-60091772 CAGGAGAAGAAAGGCAAGGTGGG - Intronic
955777835 3:62452592-62452614 CAGGAGAAGAAAAAAGATATGGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
955990493 3:64621802-64621824 AAGAAAAAGAAAAAAAAGGTAGG + Intronic
956568901 3:70672128-70672150 CGAGAGAAGAAAAAAGGGGCTGG - Intergenic
956846519 3:73188762-73188784 AAAGAGAAGAAAAAAGGGGGAGG - Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957517964 3:81280631-81280653 CAAGACAAAAAAAAAAAGGTGGG + Intergenic
957666829 3:83243292-83243314 CAGGAGAGGAAATGAGATGTAGG + Intergenic
957793173 3:84965019-84965041 AAGGAAAAGAAAAAAATGGTAGG - Intronic
957883191 3:86248601-86248623 CAGAAGAAAAAAAAAAAGGGGGG + Intergenic
958103239 3:89040871-89040893 CAGCAAAAGAAAAAATAGTTTGG + Intergenic
958475641 3:94577517-94577539 AAGGAGAAGAACAAAGATGGAGG + Intergenic
958500371 3:94898866-94898888 CAGTAGAAAAAAAAAGTGTTAGG - Intergenic
958671669 3:97213453-97213475 CAAGAAAAGAAAAAACGGGTGGG + Intronic
958914872 3:100038250-100038272 AATGAGAAGAAAAGAGAGGCCGG - Intronic
959123692 3:102264196-102264218 CAAGAGAAAAAAAAATAGATTGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959385837 3:105705372-105705394 CTGGAGAAGAAAAAGGACATTGG - Intronic
959433345 3:106283008-106283030 CAGAAGAAGAGAAAAAACGTAGG + Intergenic
959434776 3:106301024-106301046 CAGCAGGAGAGAAAAGAGGGAGG - Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959613611 3:108322487-108322509 CAGAAGAGGAAAGAGGAGGTGGG - Intronic
959825222 3:110786341-110786363 CAGAAAAAGAACAAAGTGGTAGG - Intergenic
960303714 3:116035455-116035477 CAAGAGAAGGAAAAGGGGGTGGG + Intronic
960335437 3:116411787-116411809 GAAGAAAAAAAAAAAGAGGTGGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960584611 3:119309456-119309478 TCAGAGAAGAAAATAGAGGTTGG + Intronic
960845082 3:121997484-121997506 CAGGGGAAGACCTAAGAGGTGGG - Intronic
960899661 3:122542219-122542241 GAGGAGGAGAAGAAAGGGGTAGG - Intronic
961095009 3:124146895-124146917 GAAAAGAAAAAAAAAGAGGTGGG + Intronic
961374923 3:126457896-126457918 CAGGAAAAGAAAAAAAACGAAGG + Intronic
961501066 3:127336439-127336461 GAGGAGAATTGAAAAGAGGTGGG + Intergenic
962635868 3:137330796-137330818 CAGGAGCACAGAAAAGAGGTTGG - Intergenic
962991169 3:140578607-140578629 AAAGAGAAAAAAAAAGAGGCTGG - Intergenic
963001516 3:140686056-140686078 CAGGAGGAGAAAAAAGACAGAGG - Intronic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963393878 3:144706575-144706597 TAGGAGTATAGAAAAGAGGTTGG - Intergenic
963455694 3:145543827-145543849 CAGGAGAAAGAAAGAGAGGTGGG - Intergenic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
965056530 3:163723805-163723827 CAGAAGAAGAAAAAAAAAGAGGG - Intergenic
965690289 3:171349023-171349045 TTGGAAAAAAAAAAAGAGGTTGG + Intronic
966173417 3:177109480-177109502 TATGGGAAGAAAGAAGAGGTGGG + Intronic
966213923 3:177481391-177481413 CAGGAGAAGACAATACAGGAGGG - Intergenic
966241636 3:177760796-177760818 TTGGAGAAGGAAAAAGTGGTTGG + Intergenic
966354218 3:179061992-179062014 ATGGAGAGGAAAAAAAAGGTAGG + Intronic
967043065 3:185711701-185711723 CCAGGGAAGGAAAAAGAGGTAGG - Intronic
967154502 3:186680189-186680211 CTGGAGAAGAATGAAGAGTTTGG - Intergenic
967362789 3:188651001-188651023 AAGGAGAAGAAAAAATAAATAGG + Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967423651 3:189301565-189301587 CAGAAGAAGAAAAAAAATGGAGG - Intronic
967433051 3:189410833-189410855 GAAGAGAAGAGAAAAGAGGGAGG - Intergenic
967607326 3:191462984-191463006 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
967644399 3:191903772-191903794 CAAGTGAAGAAGAAAGAGGAAGG - Intergenic
967721278 3:192819164-192819186 AGGGAGAAGAAAAGAGAGATAGG + Intronic
967861998 3:194159453-194159475 AGGGAGGAGACAAAAGAGGTAGG - Intergenic
968440891 4:623911-623933 CCGGAGAGGAAAAAGGAGGTGGG + Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968635759 4:1678009-1678031 CAGGAGAAGAACAAAGTTGGAGG + Intronic
968921375 4:3523904-3523926 CAGGAGGAGGAAACGGAGGTGGG + Intronic
969087554 4:4667679-4667701 CAGAAGAAGAAATAAAAGGTTGG + Intergenic
969561805 4:7953137-7953159 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
969780699 4:9400595-9400617 CTGGAGAAGAAAACACAGGGTGG + Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
970016128 4:11514743-11514765 CAGAAGAAGAAAAGAGATGCAGG + Intergenic
970095399 4:12458338-12458360 GAGGGGAAGAAAAAAGAGTAGGG - Intergenic
970142846 4:13001293-13001315 TAGGAGAAGAAAAATGACCTAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970349571 4:15188546-15188568 CAGAAGAAGACAGAAGATGTGGG - Intergenic
970359187 4:15291013-15291035 CAGGAAAAGAAAATAGGGGTTGG + Intergenic
970365212 4:15351262-15351284 GAGGAGGAGAAAACAGAGGAAGG - Intronic
971098318 4:23434038-23434060 CAGAAGAAGAGAAAAGCTGTAGG + Intergenic
971291909 4:25350419-25350441 CAGGGGAAAAAAAATTAGGTGGG - Intronic
971317727 4:25581317-25581339 CAGGAGAGGAAGAAAGAGTCTGG - Intergenic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971520420 4:27542641-27542663 CAGGAGGAGAAAAGAGAGAGGGG + Intergenic
972047761 4:34690306-34690328 TGGGAGAAGAAAAAAGATTTGGG + Intergenic
972099707 4:35398993-35399015 AAGGGGAGGAAAAAAGAGATAGG - Intergenic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
972792207 4:42384015-42384037 GGGGAGAAAAGAAAAGAGGTTGG - Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973119463 4:46502473-46502495 CAAGAAAAAAAAAAAGAGGATGG + Intergenic
973131815 4:46656967-46656989 CAAGAGAAGAAAAAAATGGAAGG - Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973283427 4:48387201-48387223 CAGAAGAAAAAACAAAAGGTTGG + Intronic
973657125 4:53059607-53059629 CAGGAAAAAAAAAAAGAGAAAGG - Intronic
973694599 4:53477779-53477801 CAGGAGGAGAAAAAAGAGAAAGG + Intronic
973766446 4:54167609-54167631 CAAAAAAAAAAAAAAGAGGTGGG - Intronic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974809504 4:66927827-66927849 AAGGAGAAGAAAAAAGAAAAGGG + Intergenic
974975016 4:68881023-68881045 CAGAAGAAGAAACAAGTGGCTGG - Intergenic
975041868 4:69755018-69755040 CAGGAAACAAAAAATGAGGTCGG + Intronic
975136135 4:70876083-70876105 CAAGAGAGGAAGAAAGAGGTGGG - Intergenic
975579872 4:75896684-75896706 GATGAGAAGACAAGAGAGGTTGG - Intronic
975884723 4:78951397-78951419 GAGGAGCTGAAAAAGGAGGTGGG + Intergenic
976071496 4:81245227-81245249 CGGTAGAAGCAAAAAAAGGTAGG + Intergenic
976118731 4:81757011-81757033 CAGGAGAAGAGAAGAGAGCTAGG - Intronic
976211213 4:82672307-82672329 CAGACTAAGAAAAAAGAGGTAGG + Intronic
976251052 4:83052307-83052329 CAGGAGTAGACAAGAGAGGAAGG + Intronic
976489401 4:85651154-85651176 CAGGAGAGGAGAACAGAGGCAGG + Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976692866 4:87887204-87887226 CAGGAGAAGAAATATGAACTTGG - Intergenic
976777200 4:88719676-88719698 AAGGAGAAGAAAAAAGGAGGAGG - Intergenic
976987892 4:91325794-91325816 CAGACAAAGAAAAAAGAGTTTGG + Intronic
977300147 4:95258436-95258458 CAAGAGAAAGAAAAACAGGTTGG + Intronic
977416890 4:96744243-96744265 GAGGAGGAGAACAAAGAGGGAGG - Intergenic
977627605 4:99204252-99204274 AAGAAGAAGAGAAAAAAGGTTGG + Intronic
977638317 4:99326512-99326534 CAGGCAAAGAAAAAAGAAGTTGG - Intergenic
977782586 4:100996244-100996266 CAGGCTAAGAGAGAAGAGGTAGG + Intergenic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978346755 4:107777998-107778020 GAGGAGAGGAAAAGAGAGGAGGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
979386955 4:120078104-120078126 GAGGAAAAGAAACAAGAGGTAGG + Intergenic
979541280 4:121886097-121886119 TGGGAGAAGAAATAAGATGTGGG + Intronic
979762321 4:124421573-124421595 CAACAGAAGAAAAAAGAAATGGG - Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980021410 4:127714467-127714489 CAGGAGATGGAAACAAAGGTGGG - Intronic
980415297 4:132480506-132480528 AAGAAGAAGAAAAAAAAGGTGGG + Intergenic
980449768 4:132955886-132955908 CCAGGGAAGAAAAAAGAGATGGG + Intergenic
980458083 4:133070794-133070816 CAGGAGAGGAAAAAGGTGATTGG - Intergenic
980581595 4:134761583-134761605 TAGGAGAAGAAAAAAGTGGGAGG + Intergenic
980783926 4:137528217-137528239 TAGGACAAGAAGAAAGGGGTGGG - Intronic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981052496 4:140323242-140323264 CAGGAGCAAAAAAGAGAGGGAGG - Intronic
981187917 4:141826901-141826923 CAGCAGAAGAAAACCAAGGTGGG - Intergenic
981223918 4:142269293-142269315 GAAGAGAGGAAAAAAGAGGGGGG - Intronic
981251836 4:142612123-142612145 CAGGAGAAAAAAATAGAGGAAGG + Intronic
981307315 4:143260477-143260499 CAGGAGAAAAAGAGAGAGATGGG - Intergenic
981358961 4:143825654-143825676 AAGGAGAAGGAAAACGAAGTTGG + Intergenic
981359116 4:143827195-143827217 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981369900 4:143948097-143948119 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981379643 4:144058051-144058073 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981408859 4:144404125-144404147 AAGGAAAGGAAAAAAGAGGGAGG + Intergenic
981735439 4:147945282-147945304 CAGGAAAAAAAAAAGGAGATGGG - Intronic
982114449 4:152086100-152086122 GAGGAGGAGAAGAAAGAGATGGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982308836 4:153962749-153962771 GAGAAGAAGAAAGCAGAGGTTGG + Intergenic
982392309 4:154877950-154877972 CATTAGAAGAAAAAAGAGAATGG - Intergenic
982640432 4:157951474-157951496 CAACAGAAAAAAAAAGAGGGGGG + Intergenic
983214632 4:164991774-164991796 CAAGGGAACCAAAAAGAGGTTGG - Intergenic
983449388 4:167891536-167891558 AAGGAGAGGAAAAAAGAGGTGGG + Intergenic
983884551 4:172965737-172965759 CAGGAGAAGAAAAAAAATATTGG - Intronic
984204247 4:176767346-176767368 GATGTGAAGAAAAAATAGGTTGG + Intronic
984223673 4:177008112-177008134 CAGGCGAAGAAAACAGGGCTGGG + Intergenic
984334512 4:178372399-178372421 GAAGAGGAGGAAAAAGAGGTTGG - Intergenic
984346046 4:178527458-178527480 CAGCAGAAAAAATAGGAGGTAGG + Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
984537196 4:180991154-180991176 AAGAAGAAGAGATAAGAGGTAGG + Intergenic
984538936 4:181013085-181013107 CAGAAGGAGAATAAAGAGGATGG + Intergenic
985157410 4:187004053-187004075 CAGGAGTAGAAAAAACTGTTTGG + Intergenic
986384858 5:7222706-7222728 CAGGAAAAGATAAAGGAAGTAGG - Intergenic
986514833 5:8550438-8550460 CAGGATATGAAAAATGAGATGGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986898588 5:12402874-12402896 CAGGAGGAGAAGAAAGAGAATGG - Intergenic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
987338698 5:16920473-16920495 GAGAAGGAGAAAAAAGAAGTAGG + Intronic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
987474533 5:18374629-18374651 GAAGAGAAGAAAAAGGAGTTAGG - Intergenic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988170639 5:27651626-27651648 CAGAAGAAGACAAAAAATGTGGG + Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988595840 5:32589848-32589870 CAGGAGGAAAAAAAAAAGATAGG - Intronic
988606590 5:32683861-32683883 CAGGAGAAGATAAAAAAGTGAGG + Intergenic
988839268 5:35067057-35067079 GAGGATAAGAAAAAAGAGGCCGG - Intronic
989120178 5:37997282-37997304 CAAGAGGAGAAAAAGGAGGCAGG - Intergenic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
989279023 5:39620822-39620844 GTGGAGAAGAAAAAGGATGTAGG - Intergenic
989331531 5:40265621-40265643 CATGAGAAAAGAAAAGATGTTGG - Intergenic
989556826 5:42806638-42806660 GAGGAGGAGAAAGAAGAGGAAGG + Intronic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
990184161 5:53195091-53195113 CAGGTGAAAAAAAAACGGGTGGG + Intergenic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
990433649 5:55765064-55765086 TAGGAGAAAAAAAGAGAAGTAGG - Intronic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990818170 5:59808351-59808373 TAGGAGAAGAAAATAGATATTGG - Intronic
990942643 5:61218769-61218791 TATCAGAAGAAAAAAGAGATGGG - Intergenic
991007955 5:61849503-61849525 CAGGCTAAGAAAAAAGAGAAAGG + Intergenic
991116673 5:62963168-62963190 CAGGAGAGGAAGAAAAGGGTAGG + Intergenic
991272286 5:64798355-64798377 CAGGACAAGAAGAAAGATGGTGG - Intronic
991516758 5:67444775-67444797 CAGTAGAAGAAAAGATAGGGAGG - Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991595081 5:68296004-68296026 CAGGAGAGGAAAACTCAGGTCGG + Intronic
991942924 5:71871670-71871692 CAGATGAAGAAGAAAGTGGTTGG + Intergenic
992149032 5:73883159-73883181 CAGAAGAAGAAAAAAGGGGTGGG - Intronic
992389332 5:76315789-76315811 AGGGAGAAGAAAAAAGGGATGGG + Intronic
992453191 5:76891766-76891788 CAGGGGAAGAGGAGAGAGGTGGG + Intronic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992750831 5:79859117-79859139 CAGAAGAAGAGAAAAGAGCAAGG + Intergenic
992764694 5:79986784-79986806 CATGAGAATAAAAATGAAGTCGG + Intronic
992787539 5:80184368-80184390 TGGAGGAAGAAAAAAGAGGTAGG - Intronic
993047858 5:82888781-82888803 CAGGAGCAGAAAACTCAGGTTGG - Intergenic
993121097 5:83775030-83775052 CAGAAGAAGAGAAGAGCGGTAGG - Intergenic
993391090 5:87320230-87320252 CAGAAGAAGACAGAAGATGTGGG - Intronic
993416053 5:87633056-87633078 AAGGAGAAGAAAAAAGTTGGAGG + Intergenic
993456575 5:88133987-88134009 GAGGAGGAGAAAGAAGAGGAAGG + Intergenic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
993629068 5:90261623-90261645 AGGGAGAAGAAAAAAGGAGTGGG + Intergenic
994165648 5:96605468-96605490 CAGGAGAAGGCAAAATATGTTGG - Intronic
994187467 5:96831196-96831218 CAGGAGAAGAGAGAGGAGGGAGG + Intronic
994591242 5:101775351-101775373 AAGGAAAAGAAAAAATAGGAAGG - Intergenic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
994979948 5:106861121-106861143 GAGGAGAAAAGAAAAGAAGTAGG + Intergenic
995142637 5:108749627-108749649 CCGGAGGAGAAAGATGAGGTGGG - Intronic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995827542 5:116317487-116317509 CAGGCAGAGAAAAAAGAGGGAGG - Intronic
995979925 5:118089095-118089117 AATGAGAAGGAAAAAGAGATTGG + Intergenic
996022472 5:118606552-118606574 CAACAGAAGAAAAAAAAGGAAGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996069384 5:119117530-119117552 AAGGAGGAGAAACAAGGGGTTGG + Intronic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996596846 5:125213322-125213344 CAGGAGAAGAAATAATAAATAGG - Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997060660 5:130498529-130498551 CAGCTGAAGAATAATGAGGTTGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997286548 5:132683218-132683240 AAGCAGAAGAAAAGAGAGGTGGG + Intergenic
997490080 5:134267987-134268009 CATTAGAAGAAAAAAAAGATAGG + Intergenic
997813022 5:136990547-136990569 CTGGAAAAAAAAAAAGAGGGGGG - Intronic
997941022 5:138157574-138157596 CAGGAGAGTAAAAGAAAGGTAGG + Intronic
998125411 5:139616843-139616865 CAGTAGAGGAAAAAATAGATCGG + Intronic
998700084 5:144688309-144688331 CAGAAGAAGAAAGAAGAGGTAGG - Intergenic
998713907 5:144858993-144859015 TATCAGAAGAATAAAGAGGTTGG - Intergenic
998812077 5:145976440-145976462 AAGGAAAAAAAAAAAAAGGTGGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998894956 5:146789272-146789294 TTGGAAAAGAAAAAAGATGTTGG + Intronic
998978368 5:147673156-147673178 CAAGAGGAGAGAAAAGGGGTGGG + Intronic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000016335 5:157280572-157280594 CAGGAGAAAAAAAGGGAAGTTGG + Intronic
1001171790 5:169426442-169426464 CAAGGCAAGAAAATAGAGGTAGG - Intergenic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001722005 5:173864586-173864608 CAGGAGACGGAAAGTGAGGTTGG + Intergenic
1001965910 5:175909751-175909773 CAGGAAAAAAAAAACAAGGTGGG + Intergenic
1002465632 5:179407016-179407038 AAGGAGAAGAACAAAGAATTAGG + Intergenic
1002788376 6:420904-420926 AAGGAGAAGAACCAAGAGTTTGG + Intergenic
1002971910 6:2031663-2031685 CAGAAGTAAAAAACAGAGGTAGG + Intronic
1003028507 6:2579827-2579849 AAGGAAAAAAAAAAAAAGGTAGG + Intergenic
1003220302 6:4155235-4155257 CAGGGGCAGAAAACAGAGGAAGG + Intergenic
1003383629 6:5647826-5647848 CAGGAGATGAAAAAAGGAGGAGG - Intronic
1003415830 6:5906911-5906933 CAGTAGGAGAAATGAGAGGTTGG - Intergenic
1003610168 6:7606178-7606200 GAGAAGAAGGAAAGAGAGGTGGG + Exonic
1003662834 6:8079191-8079213 GAGGAAAATAAAAAAGAGATGGG - Intronic
1004100804 6:12608996-12609018 CTGGAGAAGAGAAATGGGGTTGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004392346 6:15220397-15220419 CAAGAGAAGGAAAAGGAAGTTGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004442164 6:15663725-15663747 CTGGAGAAGAGAGAAGAGCTGGG - Intergenic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005922212 6:30412147-30412169 AAAGAGAAGAAAAGAGAGTTGGG - Intergenic
1005945428 6:30591845-30591867 AAAGAGAAAAAAAAAGAAGTTGG - Intronic
1005990413 6:30898644-30898666 GAGGAGCAGAAGGAAGAGGTGGG + Intronic
1006105329 6:31712935-31712957 CAGAAGTAGAAAAAATAGCTGGG + Intronic
1006336391 6:33423098-33423120 CAGGAGAAAAACAGAGAAGTTGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006694319 6:35918504-35918526 AAGAAAAAGAAAAAAAAGGTAGG + Intronic
1006904061 6:37521353-37521375 CAGGACAAGACAAGGGAGGTGGG - Intergenic
1006944476 6:37776330-37776352 GAAGAGAGGAAAGAAGAGGTGGG - Intergenic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007546163 6:42696281-42696303 GAGGAGAAGAAAAAATGGCTTGG + Intergenic
1007604639 6:43108393-43108415 AAGGAAAAAAAAAAAAAGGTTGG - Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1007854885 6:44845687-44845709 CAGAAGAAGACACAAGAGGCTGG + Intronic
1007917979 6:45578714-45578736 AAGGAGAAAGAAAAAGAGATGGG - Intronic
1008008967 6:46443530-46443552 AAGGAGAAGAAAAGGGAGATGGG - Intronic
1008036401 6:46749562-46749584 GAGGAAAAGAAAAAAGCGGGGGG - Intronic
1009165376 6:60334929-60334951 CAGGAAAAGAAAAAAAAAATAGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009881183 6:69568085-69568107 GAGGAGAATAACCAAGAGGTGGG + Intergenic
1009969867 6:70615026-70615048 GAGGAGTAAAAAAAAGAAGTGGG - Intergenic
1010280130 6:74013731-74013753 CAGGAAAAAAAAAGAGAGGTAGG - Intergenic
1010289216 6:74115964-74115986 CTGAAGAAGGAAAAAGAGATTGG - Intergenic
1010792966 6:80086153-80086175 CAGGAGGATAGAAAAGAAGTGGG + Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1010991941 6:82489545-82489567 CAGAAGAAACAAAAAGAGATGGG + Intergenic
1011018012 6:82780517-82780539 CAGAAGAAGAAAAGAGCTGTAGG + Intergenic
1011534282 6:88358962-88358984 CAGGAGCAGAGAACAGAGGGAGG + Intergenic
1011854298 6:91669598-91669620 GAGGAGCAGAAAGAAGAGGGTGG - Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1011973515 6:93260802-93260824 CACGAGAAGAAAAGAGAGAGGGG + Intronic
1012449203 6:99337253-99337275 TAGGAAAAAAAAAAAGAGGCAGG + Intronic
1012607757 6:101179205-101179227 CAGGAGAGAAAAAGAGAGGAAGG - Intergenic
1013295669 6:108756294-108756316 CAGGAGAAAAAAACACAGGGAGG - Intergenic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1013641609 6:112088282-112088304 CAGGAGAAGATTAAAAAGTTAGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014099251 6:117491755-117491777 CAGGAAAAGAAAAAGTATGTGGG - Intronic
1014168638 6:118253501-118253523 CAGGAAAGGAAGTAAGAGGTGGG + Intronic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015296332 6:131597534-131597556 CAGGAGAAGAAAAAAACATTTGG + Intronic
1015400695 6:132785055-132785077 AAGGAAAAGAAAAAAGGGGGAGG + Intronic
1015551760 6:134419363-134419385 CATGTGAAGAAACAAGATGTGGG - Intergenic
1015845688 6:137518538-137518560 AAGGAGAAAAAAAAAGTGGGGGG - Intergenic
1016359923 6:143256336-143256358 AAGGAGAGAAAACAAGAGGTTGG - Intronic
1016404341 6:143714724-143714746 CAGGAGAAGAAAAGAAATGAAGG - Intronic
1016890516 6:149002257-149002279 CATGAAAAGAAAAAAGATGCAGG + Intronic
1017059352 6:150467766-150467788 CTGGAGCAGAAAAAAGACATTGG - Intergenic
1017133437 6:151127883-151127905 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1017188215 6:151624002-151624024 GGGGAGAAGAAGACAGAGGTAGG - Intergenic
1017659519 6:156660032-156660054 CAGAAGGAGAAAAAAGAGAAAGG + Intergenic
1017844957 6:158249098-158249120 AAAAAAAAGAAAAAAGAGGTTGG + Intronic
1018301727 6:162410156-162410178 CAGGAGCAGAAAAAACAGCAGGG - Intronic
1018392186 6:163349216-163349238 CAGGTGAAGAACAAAGAATTTGG - Intergenic
1018440970 6:163813061-163813083 CAGGAGTAGGAGAAAGAGTTGGG - Intergenic
1018477542 6:164158387-164158409 GAGGAGAAGATGAAAGAGTTTGG + Intergenic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1018894382 6:168003264-168003286 CAAGAGAAGACAAAAGGGGGTGG + Intronic
1018946717 6:168352400-168352422 CTGGAGCAGGAGAAAGAGGTGGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1020334683 7:7053682-7053704 CAGCAGAAGAAAAGAAAGGAGGG - Intergenic
1020604560 7:10320084-10320106 CAAAAGAAGAACTAAGAGGTAGG - Intergenic
1020810571 7:12845851-12845873 CAGGAGTAGGAAAGAGAGATAGG + Intergenic
1020844350 7:13263738-13263760 CAGGGGAAAAGAGAAGAGGTTGG - Intergenic
1020902254 7:14019594-14019616 AAGGAGAGGAAACAAGTGGTAGG - Intergenic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021017940 7:15558927-15558949 CAGGACAAGAAGAAATGGGTGGG + Intronic
1021289544 7:18825640-18825662 AAGGAGAAGAAGAAAAACGTGGG + Intronic
1021411858 7:20337964-20337986 CAGGAGAGGTAAACAGAGCTTGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022257610 7:28674960-28674982 CAGGAAAAGAAAGAAGACCTTGG - Intronic
1022324558 7:29319366-29319388 GAGGAGGAGAAAAAAGTTGTGGG + Intronic
1022544037 7:31168800-31168822 CTGTGGAAGAAAGAAGAGGTTGG - Intergenic
1022656185 7:32321348-32321370 GAGGAGAAGAATCAAGGGGTTGG + Intergenic
1022673358 7:32476467-32476489 CAGCAGAAGACAAATGATGTGGG - Intergenic
1022745581 7:33168417-33168439 AAGGAGGAGGAAAAAGAGATAGG - Intronic
1023525283 7:41096111-41096133 CAAGAGATGAACAAAGTGGTGGG + Intergenic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023623572 7:42095682-42095704 CAGGAGAGGACACAAGAGGAGGG + Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1024168878 7:46764024-46764046 GAGGAAGAGAAAAAAGAAGTGGG - Intergenic
1024356732 7:48421253-48421275 CAGAAGATGCAAAAACAGGTGGG - Intronic
1024525387 7:50344154-50344176 CAGATGAAGAAAGAGGAGGTAGG - Intronic
1024955136 7:54910519-54910541 TAGGAGCAGGAAAAAGGGGTAGG + Intergenic
1025736331 7:64150455-64150477 CCAGAGAAGAAGAAAGATGTTGG + Intronic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026226889 7:68450156-68450178 CGTGAGAAGAAAAAGGAGGCTGG - Intergenic
1026294248 7:69037448-69037470 CAGGAGGAGGAAAAGCAGGTTGG - Intergenic
1026451173 7:70530873-70530895 AAGAACAAGAAAAAAGAAGTTGG - Intronic
1026500994 7:70943287-70943309 CCTGAGAAGAGCAAAGAGGTTGG + Intergenic
1026509391 7:71015836-71015858 CAGGAGCGGAAAAGAGAGGGAGG + Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026643537 7:72148606-72148628 AAAGAAAAGAAAAAAGAGGCTGG + Intronic
1026841189 7:73670807-73670829 CAGGAAAAAAAAAAAAAAGTGGG + Intronic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1026905094 7:74058337-74058359 AAGGAGAAGAAAGAAGAAGGAGG - Intronic
1027288862 7:76679786-76679808 CAGTGGAAAAAAAAAAAGGTGGG - Intergenic
1027531290 7:79336842-79336864 AAGGAGAAGACAGAAGATGTAGG + Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028210194 7:88064443-88064465 CAGGAGTAGACTAAAGTGGTAGG - Intronic
1028472505 7:91220364-91220386 CAGGAGAAAAAAACTTAGGTAGG - Intergenic
1028509653 7:91610175-91610197 CAGGAGAGGAAAAAGGAGGGGGG + Intergenic
1028618880 7:92801920-92801942 GAGGAGACGAAAAGAGAGGCGGG - Intronic
1028901840 7:96109949-96109971 CACAAAAAGAAAAAAAAGGTAGG - Intronic
1029494150 7:100888189-100888211 TGGGAGAAGAAAACAGAGGATGG + Intronic
1029637013 7:101791432-101791454 CATGAGAAATAAAAAGAGCTGGG + Intergenic
1029703340 7:102262112-102262134 CAGTTGAAAAAATAAGAGGTAGG + Intronic
1029872080 7:103705013-103705035 CAGGAGAAAAATCAAGAGGGTGG - Intronic
1029882261 7:103827338-103827360 CAGGAAAGGAGAAAAGAGGGGGG + Intronic
1030318788 7:108143285-108143307 CAGGAGAAGAAATAACTGATGGG + Intergenic
1030523828 7:110629953-110629975 AAGGAGAAGAAGAGAGAGCTGGG - Intergenic
1030589492 7:111463654-111463676 TGGCAGAAGGAAAAAGAGGTGGG - Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030917275 7:115330954-115330976 CAGGAGCAAGAGAAAGAGGTGGG + Intergenic
1031288220 7:119899840-119899862 CAGGAGAAAAAGAGAGAGATGGG + Intergenic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031697962 7:124884232-124884254 CAGGAAAAGAAAAAAATGTTAGG + Intronic
1031795206 7:126165225-126165247 CAGGAGTAGACATAAGAGATAGG + Intergenic
1032098656 7:128954443-128954465 CATGAGAGAAAAAAAGAGGGAGG - Exonic
1032140394 7:129324421-129324443 AACGAGAACAAAGAAGAGGTGGG - Intronic
1032624339 7:133573644-133573666 CAAAAGAAGAAAAGAGAGGAGGG - Intronic
1032788584 7:135222660-135222682 CACTAGTAGCAAAAAGAGGTGGG + Intergenic
1033019419 7:137707615-137707637 CAGGAGGAAGAAAAAGAGGGTGG - Intronic
1033579688 7:142720801-142720823 GAGGAGAGGAGAAAAGAGCTTGG - Intergenic
1033784356 7:144712895-144712917 GAGGGGAAAAAAATAGAGGTAGG + Intronic
1033840910 7:145371931-145371953 AAGAAGAAGAAAAATAAGGTGGG - Intergenic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034233402 7:149550204-149550226 CTGAAGAAGAAAAGAGGGGTTGG + Intergenic
1034338356 7:150337618-150337640 CAGAAGACGAAGGAAGAGGTGGG - Exonic
1034347445 7:150396314-150396336 CAAAAGAAGAAAAAAGAGTCGGG - Intronic
1034456833 7:151175221-151175243 AAGGAGCAGATAAAAGAGGCAGG + Intergenic
1034851437 7:154497626-154497648 AAAGAAAAGAAAAAAGAGCTAGG + Intronic
1035079834 7:156206739-156206761 CAGGAGAAGAATTTAGAGGTGGG - Intergenic
1035423420 7:158748878-158748900 CAGGAGAAAAAAAATTAGCTGGG - Intronic
1036048064 8:5166110-5166132 CAGGAGAGGAAAAAAAATGATGG + Intergenic
1036088565 8:5639833-5639855 CAGGTGTAGAAAAAAGAGCGTGG + Intergenic
1036278134 8:7374528-7374550 CTGGAGAAGAAAACACAGGATGG + Intronic
1036343388 8:7937363-7937385 CTGGAGAAGAAAACACAGGATGG - Intronic
1036838727 8:12098125-12098147 CTGGAGAAGAAAACACAGGATGG - Intergenic
1036860515 8:12344369-12344391 CTGGAGAAGAAAACACAGGATGG - Intergenic
1037141509 8:15525885-15525907 TAGGAAAAGAAACAAGAGGCAGG + Intronic
1037156760 8:15710111-15710133 AAATAGAAGAAAAAGGAGGTAGG - Intronic
1037323389 8:17664910-17664932 CTAAAGAAGAAAAAAAAGGTGGG + Intronic
1037746072 8:21646002-21646024 CAGGAAAAGAAAAAAGGGAGAGG + Intergenic
1037802371 8:22042761-22042783 GAGGAGGAGAGAAAAGAGGGAGG - Exonic
1038182799 8:25244683-25244705 CAGGATGAGAAAGAAGAGATGGG + Intronic
1038229966 8:25690766-25690788 GAAGAGAAGAAAAAGGAGCTGGG - Intergenic
1038329373 8:26596023-26596045 CAGGGGATGAAAAAGCAGGTAGG + Intronic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1038972894 8:32657357-32657379 CTGGAGAAGAAGGAATAGGTGGG - Intronic
1038999149 8:32960143-32960165 TAGGAAAAGGAAAAACAGGTTGG + Intergenic
1039279405 8:35967155-35967177 CATAAAAAGAGAAAAGAGGTGGG - Intergenic
1039390854 8:37179863-37179885 GAGAAGAAGAAAGAAGAGGGAGG - Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039465580 8:37783155-37783177 AAGAAAAAGAAAAAAAAGGTGGG + Intergenic
1040102268 8:43516340-43516362 GAGTGGAAGAAAAAAGGGGTGGG + Intergenic
1040374194 8:46807153-46807175 CAGAAGAAACAAAAAGAGATGGG - Intergenic
1040413003 8:47173357-47173379 AAGAAGAAGAAAAAAAAGGTGGG + Intergenic
1040441877 8:47451781-47451803 AAGGAGAAGAGAAGAGAGGGAGG + Intronic
1040685866 8:49872296-49872318 CAGGAAAAGAAAGAAGAGAGTGG + Intergenic
1040686465 8:49878945-49878967 AAGGAAAACAAAAAAAAGGTAGG - Intergenic
1040919845 8:52604305-52604327 CAGAAGAAGTAAAAAGGGATAGG + Intergenic
1041066701 8:54089621-54089643 CAAAAAAAAAAAAAAGAGGTTGG - Intronic
1041635794 8:60142005-60142027 AAGAAGAGGAAAAAAGAGTTTGG + Intergenic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042451473 8:68952148-68952170 CAGAAAGAGAAAAAAGAGATAGG + Intergenic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042751015 8:72157774-72157796 CAGAAGAGGCAAGAAGAGGTGGG - Intergenic
1043386861 8:79757478-79757500 CGGGAGAAGAGAAAAGAGGGAGG + Intergenic
1043430755 8:80192283-80192305 CAGAAGAAGAAAATAGATGATGG - Intronic
1043478667 8:80630689-80630711 CAGGATAAGAAAAAATCGCTAGG - Exonic
1043826291 8:84932838-84932860 CAGTGAAAGAAAGAAGAGGTAGG - Intergenic
1043940542 8:86190978-86191000 CAGAAGAAGATAAAAAATGTAGG - Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044289520 8:90451483-90451505 AAGGAAAAGAAAAAAGTGGAAGG - Intergenic
1044877761 8:96688386-96688408 CATTAAAAGAAAAATGAGGTGGG - Intronic
1044942177 8:97354425-97354447 CAGGTTAAGAATAAAGGGGTTGG - Intergenic
1045024111 8:98070358-98070380 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1045478040 8:102569672-102569694 GAGGAGAGGAAAAGAGAGGAGGG - Intergenic
1045543132 8:103105083-103105105 CAGGAGAGGAAAAAGGACTTTGG - Intergenic
1045609446 8:103819004-103819026 CAGGAAAAGAGAAAAGGGTTGGG + Intronic
1045819593 8:106320636-106320658 AAAGAGAAGAGAAAAGAGATGGG - Intronic
1045828091 8:106425213-106425235 AAAGAAAAGAAAAAAGAGGCAGG - Intronic
1045887245 8:107113239-107113261 CAGAAGGAAGAAAAAGAGGTGGG + Intergenic
1045966862 8:108035061-108035083 TAGGAAGAGAAAAAAGAGCTGGG + Intronic
1046208105 8:111030527-111030549 CAAGAGAGGAAGAAAGAGGGAGG + Intergenic
1046339629 8:112836234-112836256 CAGGAGAAGAAAAATGGGTCTGG + Intronic
1046510800 8:115199870-115199892 CAGGAGAAGAGAGAAGATCTTGG + Intergenic
1046673583 8:117084212-117084234 GAGGAGAAGAATAAAGAAATTGG + Intronic
1046801765 8:118436437-118436459 AAGAAGAAGAAAACAGAGATAGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046877512 8:119272161-119272183 CAAGAGAAGAAAAGAGAAGAGGG + Intergenic
1047017639 8:120740543-120740565 CAAATAAAGAAAAAAGAGGTGGG + Intronic
1047464517 8:125099454-125099476 AAGGAGAAGAAAAAGAAGCTTGG + Intronic
1047511616 8:125520280-125520302 GAGGAGAAGAGAAGAGAGGGAGG + Intergenic
1047609683 8:126508933-126508955 CAGGAGATGAAACTGGAGGTTGG - Intergenic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1047780522 8:128107102-128107124 AAGAAGAAGAAAAAAAAGGGGGG + Intergenic
1047930447 8:129723399-129723421 AAGGAGAAGAAAAAATAGCCAGG - Intergenic
1048038648 8:130703569-130703591 CAAGAGATAAAAAAAGAGGGAGG - Intergenic
1048379014 8:133847431-133847453 GAGGAGTTGAAAAAGGAGGTAGG + Intergenic
1048681411 8:136845496-136845518 CAGGAAAAAAAAAAAGATATTGG + Intergenic
1048929802 8:139304811-139304833 CAGGAAAAAAAAAAAAAGCTAGG - Intergenic
1049291715 8:141806839-141806861 CAGGAGCAGGGAAACGAGGTGGG + Intergenic
1049980101 9:896128-896150 CTGGAAAAAAAAAAAGATGTTGG - Intronic
1050202187 9:3157219-3157241 CAGAAGAAGACACAAGTGGTTGG - Intergenic
1050489283 9:6170670-6170692 AAGAAGAAGGAAAAATAGGTAGG - Intergenic
1050603423 9:7275357-7275379 CAGAAGAAGGGAAAAGAGCTGGG - Intergenic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1051352927 9:16215280-16215302 CTGCAGAACAAAAACGAGGTGGG + Intronic
1051432561 9:16994958-16994980 CTAGAGAAGAGAAAAGAAGTGGG - Intergenic
1052244459 9:26317498-26317520 CAGGAGAACAAAGAAGGAGTGGG + Intergenic
1052376266 9:27721227-27721249 AAGTAAAAGAAAAAAAAGGTAGG + Intergenic
1052500643 9:29285195-29285217 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1052594990 9:30545703-30545725 CAAGAGGAAAAAAAGGAGGTGGG - Intergenic
1052607623 9:30724698-30724720 CAGGAGAAGAAAAAAAAGAAAGG + Intergenic
1052615835 9:30840123-30840145 CAGCAGAAGAAAATACAGGGTGG + Intergenic
1053022803 9:34707723-34707745 CAGGAAAAGAAAAAAAAAGGAGG - Intergenic
1053404135 9:37856160-37856182 AAGGAAATGAAAAAAAAGGTTGG + Intronic
1053578968 9:39383261-39383283 GAAGAGAGGAAAAAAGAGATGGG + Intergenic
1053843480 9:42211336-42211358 GAAGAGAGGAAAAAAGAGATGGG + Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054100551 9:60942065-60942087 GAAGAGAGGAAAAAAGAGATGGG + Intergenic
1054121947 9:61217690-61217712 GAAGAGAGGAAAAAAGAGATGGG + Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054585795 9:66964821-66964843 GAAGAGAGGAAAAAAGAGATGGG - Intergenic
1054777589 9:69136887-69136909 CAGGAGGAGAGGGAAGAGGTTGG + Intronic
1055023989 9:71699756-71699778 GAGGAGATGGAAAAAGAAGTGGG - Intronic
1055435485 9:76288146-76288168 CAGGGGAACAAAGAAGAGCTGGG - Intronic
1055529677 9:77171490-77171512 CAGGAGAAGGATGGAGAGGTGGG - Intergenic
1055705008 9:78989340-78989362 CAGGGCATTAAAAAAGAGGTTGG + Intergenic
1055900754 9:81233225-81233247 CAGAAGAACCAAGAAGAGGTGGG - Intergenic
1056244185 9:84677814-84677836 CAGGAGAAGAGGATAGGGGTGGG - Intronic
1057254570 9:93534496-93534518 CAGGAGAACACAAAACAGGATGG + Intronic
1057334450 9:94144849-94144871 CAGCAGGAAAAAAAAAAGGTGGG + Intergenic
1057453083 9:95182904-95182926 AAGGAGTAGAGAAAAAAGGTGGG + Intronic
1057593615 9:96395325-96395347 CAGGGGGAGAAACAAGAGGCCGG - Intronic
1057603052 9:96475679-96475701 CAGGAGAGGGCAAAAGATGTTGG + Intronic
1057706739 9:97400047-97400069 GAGGGAAAGAAGAAAGAGGTTGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057852036 9:98573186-98573208 CAGGAGATGAAGGAAGGGGTGGG + Intronic
1058060677 9:100492631-100492653 TAGGAGAAGGAAAAAGGAGTGGG + Intronic
1058436725 9:104970072-104970094 GTGGAGATGAAAATAGAGGTAGG + Intergenic
1058569611 9:106326496-106326518 CAAGAGAAAAGAAAAGAGGGCGG - Intergenic
1058772676 9:108251882-108251904 AAGGAGAAGAACAAAGTTGTAGG - Intergenic
1059431532 9:114253414-114253436 GAAGAGGAGAAAAAAGAGGAGGG + Intronic
1059489982 9:114658968-114658990 CTGGAAAAGAGAAAGGAGGTTGG - Intergenic
1059812646 9:117873018-117873040 CAGGAGAAGTAAACAAAGGCTGG + Intergenic
1059900418 9:118919784-118919806 CAGGAGATAGAAAAAGAGATAGG - Intergenic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060443312 9:123662271-123662293 CAAAAGAAGAATAAAGAGGCTGG + Intronic
1185597370 X:1315165-1315187 CAGGTGGAGAAAAGAGAGGGAGG + Intergenic
1185804516 X:3045146-3045168 AAAGAGAAAAATAAAGAGGTGGG + Intronic
1185870501 X:3660899-3660921 GAGGGGAAGGAAGAAGAGGTGGG + Intronic
1185999255 X:4989537-4989559 AGGGAGAAGAAAAAAGAAGTAGG - Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1186235726 X:7507429-7507451 CAAAAAATGAAAAAAGAGGTAGG + Intergenic
1186384877 X:9099898-9099920 CAGTAGAACAGAAAAGAGGAAGG + Intronic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186576759 X:10775088-10775110 GAGGAGAATGAAAAAGAGGGAGG + Intronic
1186757262 X:12685082-12685104 CAGGAGCAGAAAAGAGGGGGAGG + Intronic
1187025826 X:15434366-15434388 GAGGAGGAGAAAAAAGAAGGAGG + Intronic
1187278160 X:17834754-17834776 CAGGGTAAGAGAAGAGAGGTGGG + Intronic
1187521258 X:20016206-20016228 GAGGAAAAGAAAAAACAGGAAGG - Exonic
1187558226 X:20373644-20373666 AAGGAAAAGAAAATAGAGGTGGG - Intergenic
1187603666 X:20860699-20860721 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1188331380 X:28875972-28875994 CAAGAGAAGAAGAAAGAGAGAGG - Intronic
1188475732 X:30589665-30589687 CAGGAGAGAAAGCAAGAGGTGGG + Intergenic
1188530927 X:31140032-31140054 GAAGTGAAGAAAAAAGAAGTGGG + Intronic
1188589586 X:31817688-31817710 TAGGAGAAGACAAGAGTGGTGGG + Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188643471 X:32535403-32535425 TTGGAGAAGAAAAAAGACCTTGG - Intronic
1188782302 X:34300545-34300567 AAGGAGAAAAAAAAAAAGATAGG + Intergenic
1188895710 X:35665886-35665908 AAGGGGAGGAAAAAAGAGGTAGG - Intergenic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189165883 X:38860780-38860802 CAGCAGGTGAAATAAGAGGTGGG - Intergenic
1189197089 X:39161989-39162011 CAGAGGAAGAAAAATGAAGTTGG - Intergenic
1189226600 X:39418746-39418768 GAGGGGAAGAAAAGAGAGCTGGG + Intergenic
1189259683 X:39669521-39669543 CAGGAGAGGAGAGGAGAGGTGGG + Intergenic
1189654475 X:43228223-43228245 TAGGATAAGAAAAAAGATCTGGG + Intergenic
1189868087 X:45352288-45352310 CTGGAGTAGAAACAGGAGGTAGG + Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190312979 X:49130267-49130289 CAAAAGAATAAAAAAGAGGGAGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190757452 X:53413227-53413249 AAGCAGGAGAAAGAAGAGGTAGG - Exonic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1190890592 X:54563799-54563821 GAGGAAAACAAAAAAGACGTTGG + Intergenic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191142993 X:57135458-57135480 CAGGGGAAGGAACAAGAGATTGG - Exonic
1191171439 X:57451499-57451521 CAGTAGAAGAAAACAAAGGAAGG + Intronic
1191769064 X:64735522-64735544 CAGGAGCAGAACCGAGAGGTGGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192230747 X:69263260-69263282 CAGGAGTAGATAGAGGAGGTGGG + Intergenic
1192337647 X:70235428-70235450 CAGGAGGAAAAAAAACTGGTGGG + Intronic
1192547620 X:72027025-72027047 GAGGAGAAGAGGAAAGTGGTTGG + Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194573674 X:95584627-95584649 AAGGAGAAGAAAATATAGGTGGG + Intergenic
1194633346 X:96313864-96313886 CAGGAGAAAAGAAAAGGAGTAGG - Intergenic
1194845596 X:98803827-98803849 CAGGATAAGACAATAAAGGTAGG - Intergenic
1195392660 X:104379126-104379148 CAAGAGGAGATAAGAGAGGTAGG - Intergenic
1195470483 X:105224110-105224132 CAGGACAAAAAAACAGAGGAAGG + Intronic
1195637227 X:107131975-107131997 AAGGAGAAGAAAACATAGGTGGG + Intronic
1195692571 X:107639461-107639483 CAGGATAAGAAAGATAAGGTAGG + Exonic
1195737835 X:108032054-108032076 CAGGAAAAGAAAATTGAAGTGGG - Intergenic
1196009660 X:110873183-110873205 CAGGAACAGAAAGAAGAGGCAGG - Intergenic
1196051144 X:111305782-111305804 CAGTAGGAGAAAAAAGGAGTGGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196613205 X:117737235-117737257 TAGGAGAACAAATAAGGGGTAGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1196762508 X:119212191-119212213 GAGGCCAAGAAAAAAGAGGTAGG + Intergenic
1197110638 X:122770198-122770220 AAGGAGAAGATAAAAGAAATGGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198881914 X:141291222-141291244 AAGAAAAAAAAAAAAGAGGTGGG - Intergenic
1199329781 X:146545334-146545356 CTGTAAAAAAAAAAAGAGGTTGG + Intergenic
1199458487 X:148056376-148056398 CAGGACAAGAAAAGAGAATTTGG + Intergenic
1200793543 Y:7320244-7320266 GAGGGGAAGGAAGAAGAGGTGGG - Intergenic
1201247251 Y:12016832-12016854 GAGGGGAAGAAAAAAGACATTGG - Intergenic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201634223 Y:16104434-16104456 CAGGAGAAGAAATAAGACAAAGG - Intergenic
1202101136 Y:21309236-21309258 AAGGAGAAGAAAAAAGGGAAAGG + Intergenic
1202273717 Y:23094990-23095012 CAAAAGAAGAAAAAATATGTAGG - Intergenic
1202292309 Y:23325687-23325709 CAAAAGAAGAAAAAATATGTAGG + Intergenic
1202376099 Y:24238847-24238869 GAGGAAAAGAGAAAAGAGCTTGG + Intergenic
1202426713 Y:24728735-24728757 CAAAAGAAGAAAAAATATGTAGG - Intergenic
1202444078 Y:24941359-24941381 CAAAAGAAGAAAAAATATGTAGG + Intergenic
1202494681 Y:25431271-25431293 GAGGAAAAGAGAAAAGAGCTTGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic