ID: 1105784732

View in Genome Browser
Species Human (GRCh38)
Location 13:23737267-23737289
Sequence GGGACACTCATGACCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105784721_1105784732 21 Left 1105784721 13:23737223-23737245 CCGTAGTCTGGTACTGCCAACGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1105784732 13:23737267-23737289 GGGACACTCATGACCAGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1105784728_1105784732 -10 Left 1105784728 13:23737254-23737276 CCCAGCTGTGACCGGGACACTCA 0: 1
1: 1
2: 0
3: 7
4: 88
Right 1105784732 13:23737267-23737289 GGGACACTCATGACCAGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 146
1105784725_1105784732 5 Left 1105784725 13:23737239-23737261 CCAACGGTGGCTTGGCCCAGCTG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1105784732 13:23737267-23737289 GGGACACTCATGACCAGGACAGG 0: 1
1: 0
2: 1
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105784732 Original CRISPR GGGACACTCATGACCAGGAC AGG Intronic
902628420 1:17690171-17690193 GGGAAACTGAGGCCCAGGACAGG - Intronic
903647808 1:24905387-24905409 GGGCCTCGGATGACCAGGACAGG - Intronic
904356724 1:29945046-29945068 GGGCCACTTTTGACCACGACTGG - Intergenic
904370569 1:30045242-30045264 GGGGCACACAGGACCAGAACGGG + Intergenic
905481302 1:38263957-38263979 GGGACAGTCCTGCCCAGGCCAGG + Intergenic
907250285 1:53133620-53133642 GGAATACTCAAGACCTGGACAGG + Intronic
907915639 1:58866415-58866437 GGGAAACTCAGGACCAGGCCAGG + Intergenic
908073082 1:60485250-60485272 GGGACACTGATGACTCTGACAGG + Intergenic
909306731 1:74090524-74090546 GAGACATCCATAACCAGGACTGG + Intronic
912411233 1:109481981-109482003 AGGAAACTCATGTCCAGGAAAGG - Exonic
912866687 1:113264033-113264055 GGGACACTCACTACAAGGGCAGG - Intergenic
913474362 1:119222905-119222927 GAGGCATTCATGACCAGGACTGG + Intergenic
915053403 1:153102609-153102631 GGGACACTATACACCAGGACTGG + Intronic
915271619 1:154757715-154757737 AGGACACTGATGACCAGGGGAGG + Intronic
915903748 1:159863549-159863571 AGGACCCTCATAACCTGGACTGG + Intronic
916688715 1:167171107-167171129 GGGATTCTCATGACCTGGTCAGG - Intergenic
917902478 1:179556269-179556291 GGGACACCCAGGCCCAGAACTGG - Intronic
924304979 1:242678521-242678543 GGGAAAGTCCTGCCCAGGACAGG + Intergenic
1065751635 10:28892952-28892974 CTGACACTCATGACAAGGCCTGG + Intergenic
1067082016 10:43217322-43217344 GGGACACATGTCACCAGGACAGG - Intronic
1069792915 10:71034640-71034662 AGGACACTGAGGCCCAGGACAGG + Intergenic
1073949512 10:108790277-108790299 GAGACATTCCTGTCCAGGACAGG - Intergenic
1075736997 10:124670156-124670178 GTGACACTCATCACCATGAGAGG + Intronic
1076618348 10:131771315-131771337 GGGAGACTTGTGACCAGGGCTGG + Intergenic
1077097362 11:804792-804814 GGGGGACTCATCTCCAGGACTGG - Intronic
1079077601 11:17393647-17393669 GGGACACCCAGGGACAGGACTGG - Intronic
1079175512 11:18136801-18136823 GACACCCTCATGACCAGGACTGG - Intronic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1079269771 11:18973082-18973104 GACACCCTCATGACTAGGACTGG + Intergenic
1081610725 11:44561650-44561672 GGGGCCCTCATGATGAGGACTGG + Intergenic
1082278831 11:50247766-50247788 GGAACAGTCATCATCAGGACAGG + Intergenic
1084933667 11:72575770-72575792 TGGGCACTCATGACCAGGGCAGG + Intergenic
1087691082 11:101321097-101321119 GGGGACCTCATGACTAGGACTGG + Intergenic
1091278679 11:134369766-134369788 GGGACAGGAATGACCATGACAGG + Intronic
1091686931 12:2569183-2569205 GTGACTCTCAAGACAAGGACAGG + Intronic
1092280813 12:7096505-7096527 GGGACAATCATGCCCATCACTGG - Exonic
1094357642 12:29595470-29595492 GGGAAGGTCATGACCAGGAAGGG - Intronic
1096168077 12:49441957-49441979 GGGAGAGCCATGACCAGGAGTGG + Intronic
1096214700 12:49792667-49792689 TGGACACTCACCATCAGGACAGG + Exonic
1096255230 12:50058317-50058339 GGAATACCCGTGACCAGGACAGG + Intronic
1103937609 12:124484842-124484864 GGGACAGCCATGAACAAGACAGG - Intronic
1105784732 13:23737267-23737289 GGGACACTCATGACCAGGACAGG + Intronic
1111728747 13:92045532-92045554 GTGACAATCATGATCATGACGGG - Intronic
1114589004 14:23842342-23842364 GTGACACACATGACCAGCAGAGG + Intergenic
1115994887 14:39186116-39186138 GGGACAGTCATGGCAAGGAGTGG - Intergenic
1119682845 14:76605734-76605756 GGGACTCTCCTGACCAGGGCTGG - Intergenic
1126486770 15:49189757-49189779 GGAAGACTCATGACCTGGGCAGG + Intronic
1129570731 15:76681623-76681645 GGGATACTGAGAACCAGGACTGG + Intronic
1129947178 15:79549375-79549397 GGGACACACTTGGCCTGGACAGG + Intergenic
1129952788 15:79606931-79606953 GGGACACTCAAGAGCAGGACAGG - Intergenic
1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG + Intergenic
1132461464 16:57295-57317 GGGGCCCTCAGGACTAGGACAGG + Exonic
1132698949 16:1214126-1214148 GGGACACTCACGGCCAGGTTGGG - Intronic
1133816726 16:9203372-9203394 GGGACACTTATGATAAAGACAGG + Intergenic
1136294871 16:29295804-29295826 GGGACACTCCTGACCACCTCAGG - Intergenic
1136717060 16:32289454-32289476 GGGCCGCTCGTGAACAGGACAGG - Intergenic
1136835434 16:33495708-33495730 GGGCCGCTCGTGAACAGGACAGG - Intergenic
1137231560 16:46571711-46571733 GGGACACTGCTGGCCAGGAACGG + Intergenic
1137344057 16:47637984-47638006 GGAACCCTCATGAGCAGGATTGG - Intronic
1139342208 16:66274955-66274977 GGGACACATATGACCAAGATTGG + Intergenic
1139797587 16:69496038-69496060 GGGACACACACGACCAGGGCAGG - Intergenic
1140258258 16:73355507-73355529 GGGACACTAAAGAGCAGGGCAGG + Intergenic
1142100765 16:88269815-88269837 GGGACACTCCTGACCACCTCAGG - Intergenic
1203009369 16_KI270728v1_random:228324-228346 GGGCCGCTCGTGAACAGGACAGG + Intergenic
1203145612 16_KI270728v1_random:1796021-1796043 GGGCCGCTCGTGAACAGGACAGG - Intergenic
1142861509 17:2764973-2764995 GGGACACTCATGCTCAGAATAGG + Intergenic
1143095630 17:4476974-4476996 AGGACAGTCAGGATCAGGACGGG - Intronic
1144466455 17:15501471-15501493 GGGACAGTGATGAACAGGAAGGG - Intronic
1146476296 17:33165197-33165219 GGGCCAGACATGACCAGGATTGG - Intronic
1146915705 17:36676964-36676986 GGGACACTCAGGAGCTGGTCAGG + Intergenic
1149334088 17:55617690-55617712 GGGACACTCATGGCCCGGGGTGG - Intergenic
1150597986 17:66623954-66623976 GGGACTTTCCTGACCAGGGCAGG + Intronic
1151194686 17:72423179-72423201 CTGACACTCAGAACCAGGACTGG + Intergenic
1152585399 17:81187287-81187309 GGGACACTCATGGCCAGAAAAGG - Intergenic
1152928657 17:83099291-83099313 GGGTCACTCAATACCAGGAGGGG + Intergenic
1161709110 19:5837929-5837951 GGGACACTCAGAGCCCGGACTGG + Intronic
1162262659 19:9545366-9545388 GGTTCACCCATGCCCAGGACTGG + Intergenic
1163168084 19:15511369-15511391 GGATCACTCAAGCCCAGGACGGG + Intronic
1163560143 19:18014230-18014252 GGGAAACTGAGGCCCAGGACTGG + Intergenic
1165070589 19:33253059-33253081 GTCACACTCATGGCCAGGATGGG + Intergenic
1165561753 19:36686491-36686513 GGGTCACTGATATCCAGGACTGG + Intergenic
927647931 2:24890655-24890677 AGGACACAAATGACCAGTACCGG - Intronic
929034652 2:37679220-37679242 GGAGCACTCATGAACAGGATTGG + Intronic
931021337 2:58047393-58047415 GGGACACCCCTGACAGGGACGGG + Intronic
934650720 2:96089873-96089895 GGGACTCTCATGGCCAGTGCTGG - Intergenic
935712642 2:105912913-105912935 GGGACATCCATGAGCATGACTGG + Intergenic
936069285 2:109354437-109354459 GGGCCACTCATGGCCAGGCAGGG + Intronic
941732124 2:168930320-168930342 AGGAAACTAATGACCAGGAATGG - Intronic
946343845 2:219091715-219091737 GGGACACTGTTTTCCAGGACTGG + Intronic
948764719 2:240213524-240213546 GGGACTGTCAAGACCAGGAAGGG + Intergenic
1173645263 20:44629327-44629349 GGGAAACTGAGAACCAGGACCGG + Intronic
1173712749 20:45175054-45175076 GGGACACCCTGGGCCAGGACAGG + Intronic
1174058374 20:47815237-47815259 GGGCTGCTCATGACCAGGACGGG + Intergenic
1174160207 20:48545223-48545245 GGGATGCTCATGAGCAGGAAGGG - Intergenic
1174819333 20:53713511-53713533 GGGACAATGATGACCATGACAGG + Intergenic
1175249396 20:57600005-57600027 GGGACACTCATGTTCAGGAATGG - Intergenic
1179854115 21:44154695-44154717 TGGACCCGGATGACCAGGACTGG + Intergenic
1180943256 22:19674205-19674227 TGAACACACATGACCAGGCCAGG - Intergenic
1181349640 22:22245667-22245689 GGGGCATCCATGCCCAGGACAGG + Intergenic
1182050316 22:27308111-27308133 GGGACACTGATGGTCAGAACAGG + Intergenic
1183410936 22:37654769-37654791 GGGAGCCTCGTGACCAGGGCTGG + Intronic
1184035948 22:41918201-41918223 GGGACACTGAGGCCCAGCACAGG - Intergenic
1185202668 22:49517622-49517644 GGGGCAGTAATGACCAGGGCAGG - Intronic
950265275 3:11568770-11568792 GGCACAGTCCTGACCAGGAGCGG - Intronic
953884740 3:46708852-46708874 AAGACCCTCAGGACCAGGACTGG + Intronic
954286774 3:49625055-49625077 GGGGCTCTCATGGCCAGGAGTGG - Exonic
959615947 3:108347460-108347482 GGGACAGACAGGACCAGGAGTGG + Intronic
961433448 3:126899695-126899717 GGCACTCTCAAGACCAGGAAAGG - Intronic
965146998 3:164918342-164918364 GGGCCACTCTTGCCCATGACTGG - Intergenic
967894268 3:194383988-194384010 GGGACACTAAGGCCCAAGACGGG + Intergenic
968970179 4:3789678-3789700 GGGACAGTTCTGAGCAGGACTGG - Intergenic
969098240 4:4750392-4750414 GGGTCACACCTGACCAGGAGGGG - Intergenic
969213049 4:5702220-5702242 GGGGCACTCATGATATGGACAGG - Intronic
972457300 4:39267171-39267193 GGGTCTCTCCTCACCAGGACTGG - Intronic
973859816 4:55052011-55052033 GGGATGGTCATGATCAGGACAGG - Intergenic
973871714 4:55173053-55173075 GGGACACTGCTGATCAGGTCAGG - Intergenic
978850051 4:113324042-113324064 TGGAGACCCATGACCAAGACAGG - Intronic
985008843 4:185561878-185561900 GGGACACTCATCACAATGATGGG - Intergenic
985850082 5:2382395-2382417 GGGACACCCATGACAGGGCCAGG - Intergenic
986167600 5:5289041-5289063 TGGACTCTCATGACCAGTTCTGG - Intronic
986566874 5:9124226-9124248 GGGACATGCATGACCAGCTCTGG + Intronic
986713201 5:10502681-10502703 GGGACAGTCACAGCCAGGACAGG - Intergenic
992774792 5:80079963-80079985 GGGACACCAGTGACCAGGTCAGG + Exonic
993200020 5:84803843-84803865 GGGACACTCTTCTCTAGGACTGG + Intergenic
998153813 5:139772577-139772599 GCCACACTCATGCCCAGCACAGG + Intergenic
999096508 5:148983025-148983047 GGGACACTGAGGCCCAGGAAAGG - Intronic
1002170609 5:177372149-177372171 GGGACACTCATGGCACAGACAGG - Exonic
1003013742 6:2451381-2451403 GGAACAGACATTACCAGGACTGG + Intergenic
1003364928 6:5464330-5464352 TGGACAGTCCTGACCTGGACTGG + Intronic
1005461324 6:26072439-26072461 GGGACACTCATTATCATGAGGGG + Intergenic
1012038854 6:94177874-94177896 GCCACATTCATGCCCAGGACAGG + Intergenic
1017908432 6:158772578-158772600 GGGAAACTCGTGACCATGACTGG + Intronic
1018375687 6:163210075-163210097 GTGACTCTCATGAGCATGACGGG - Intronic
1021388190 7:20058395-20058417 GGTACACTCATTACCCGAACAGG - Intergenic
1022533771 7:31083251-31083273 GAGCCACTCATGTCCAGGGCAGG - Intronic
1023804857 7:43865430-43865452 GTGAGACACATGACCAGGAAGGG + Intergenic
1024323550 7:48091728-48091750 GGGACACTCACACCCAGGAGGGG + Intronic
1025627489 7:63234250-63234272 GGAACAGTCATCATCAGGACAGG + Intergenic
1027976314 7:85160619-85160641 GGGACCCTCCTAAACAGGACTGG + Intronic
1029450701 7:100640647-100640669 GGGACACTCGAGAACAGGATGGG + Intronic
1032278161 7:130477980-130478002 GGGACTCTAATGACCAGGCCTGG - Intergenic
1034043560 7:147904541-147904563 GGGAAATTCATGACCATGACTGG - Intronic
1035058352 7:156051553-156051575 GGGAAACTCCAGACCAGGATGGG - Intergenic
1035243444 7:157547211-157547233 GGGGCACACATTACCAGGAATGG - Intronic
1035961679 8:4145229-4145251 AGGACATTCATGACCTGGACAGG + Intronic
1036667533 8:10757228-10757250 GCTACCCTCCTGACCAGGACTGG + Intronic
1036767609 8:11558620-11558642 GGGACACTGAGGACCAGTCCTGG - Intronic
1044582705 8:93838008-93838030 GGATCCCTCATGACCAGGTCAGG + Intergenic
1046651438 8:116840546-116840568 GGGGCAGTCATGGCCAGGATTGG - Intronic
1047335324 8:123930545-123930567 TGGACACTCATGACTTGGATGGG + Intronic
1047802268 8:128322402-128322424 GATACACTGGTGACCAGGACAGG - Intergenic
1049757519 8:144317322-144317344 GGGACACTCACCACCAGTCCCGG + Exonic
1051858956 9:21601925-21601947 AGGACAATCATGATCAGGAATGG - Intergenic
1054805872 9:69395588-69395610 GGGACACTGATGAAGAGGACTGG + Intergenic
1055985875 9:82056299-82056321 GGGACACATAGGCCCAGGACAGG - Intergenic
1056105133 9:83339667-83339689 GGGACACTCATAGCAGGGACTGG + Intronic
1056203775 9:84300878-84300900 GGGACACTCAGGCCCAGGCTAGG + Intronic
1057116117 9:92523994-92524016 GGGAAACTCATTACCAGTAAAGG + Intronic
1062358655 9:136177167-136177189 GGGACACTCAGGACCTGGGCTGG - Intergenic
1062428212 9:136515767-136515789 GGGACACCCATGACCAGACCTGG + Intronic
1062619663 9:137414460-137414482 GGGACACACATTCCTAGGACTGG + Intronic
1189762739 X:44339234-44339256 GAGACACTCAGGATCAGGATGGG + Intronic
1191825246 X:65357495-65357517 GGGCCACTCAGGGCCTGGACAGG + Intergenic
1197768156 X:130072293-130072315 GTGACACTAGTGACCAGGAGGGG - Exonic