ID: 1105784853

View in Genome Browser
Species Human (GRCh38)
Location 13:23738556-23738578
Sequence CTGAGGAAGGCGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7902
Summary {0: 1, 1: 0, 2: 10, 3: 355, 4: 7536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105784853_1105784860 -10 Left 1105784853 13:23738556-23738578 CCTTCCACCTCCGCCTTCCTCAG 0: 1
1: 0
2: 10
3: 355
4: 7536
Right 1105784860 13:23738569-23738591 CCTTCCTCAGCTGGGACTATAGG 0: 1
1: 6
2: 77
3: 279
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105784853 Original CRISPR CTGAGGAAGGCGGAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr