ID: 1105788327

View in Genome Browser
Species Human (GRCh38)
Location 13:23771093-23771115
Sequence CACACTGCAACAAGTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105788325_1105788327 -5 Left 1105788325 13:23771075-23771097 CCGGGATCACTGGACAGTCACAC 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1105788327 13:23771093-23771115 CACACTGCAACAAGTGCTATGGG 0: 1
1: 0
2: 1
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105788327 Original CRISPR CACACTGCAACAAGTGCTAT GGG Intronic
901311491 1:8272461-8272483 AACACTGTAACCAGGGCTATGGG + Intergenic
903042552 1:20542260-20542282 AAGACTGTAACAAGGGCTATGGG + Intergenic
903550251 1:24153099-24153121 CTCACTACAACAAGGGATATTGG + Intergenic
904308129 1:29603766-29603788 CACTCTGCTACAAATGCTCTTGG + Intergenic
905810186 1:40907215-40907237 AAGACTGTAACAAGGGCTATGGG - Intergenic
906482868 1:46211386-46211408 AACACTGTAACAATGGCTATGGG + Intronic
909952154 1:81733671-81733693 CTCACTGCAACATATGTTATGGG - Intronic
910007398 1:82415729-82415751 CTCACTGCAGGAAGTTCTATTGG - Intergenic
910920168 1:92336750-92336772 CACACTGCACCAGGCACTATGGG + Intronic
911048276 1:93647553-93647575 AACACTGCAAAAAGTTCTACGGG + Intronic
911203764 1:95072660-95072682 AACACTCCAAGAAGTGCTAAGGG + Intronic
912549857 1:110478466-110478488 CACAGAGCAACCAGTGCTAAGGG + Intergenic
913171784 1:116239838-116239860 AAGACTGCAACAAGGGCTTTAGG - Intergenic
914004329 1:143719204-143719226 CACACTGCAAGAAATGCAAAAGG - Intergenic
914945999 1:152066815-152066837 CACACTGTAATAAGTGCCACAGG + Intergenic
917754749 1:178088033-178088055 CAGACAGAAACAAATGCTATAGG + Intergenic
920055947 1:203191746-203191768 CATACTTCAACAAGTGGCATTGG + Intergenic
920286289 1:204882169-204882191 CACGCTTTAACAAGTGGTATTGG + Intronic
921068382 1:211638936-211638958 AAGACTGAAACAAGGGCTATGGG + Intergenic
923483535 1:234407175-234407197 AAGACTGTAACAAGGGCTATGGG - Intronic
1065852433 10:29801908-29801930 CACACATCAGCAAGTCCTATGGG - Intergenic
1070892674 10:79953288-79953310 CACCTTGCAAGAAGTGCTAAAGG - Intronic
1071370911 10:84950721-84950743 CTCACTGACACAAGTTCTATTGG + Intergenic
1071849688 10:89556440-89556462 AACATTGTAACAAGGGCTATGGG - Intronic
1071994527 10:91134868-91134890 CATACTGGAATAAATGCTATAGG + Intergenic
1077069559 11:662322-662344 CACACTGCAAGAAGAGGAATTGG - Intronic
1079485253 11:20929459-20929481 CACACTGCACCCATTGCTCTGGG + Intronic
1079769262 11:24438050-24438072 AAGACTGCAACAAGGGCTGTGGG + Intergenic
1080448543 11:32359455-32359477 CACAGTGAATAAAGTGCTATGGG - Intergenic
1080624799 11:34018863-34018885 CAGAATGAAATAAGTGCTATAGG - Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1090609344 11:128456308-128456330 CTCACTGCAAAAAGTGCCAGGGG + Intergenic
1091068591 11:132541952-132541974 CTCAGTGCAACAGGTGCTTTTGG - Intronic
1091250028 11:134136253-134136275 CACACTGAATCCAGTGCTACAGG - Intronic
1092117891 12:6022474-6022496 CCCACTGCAGAAAGTTCTATCGG + Intronic
1093923824 12:24889584-24889606 AAGACTGTAACAAGGGCTATGGG - Intronic
1095043759 12:37474848-37474870 AACACTGTAACAAGTGCTAGGGG + Intergenic
1099421019 12:82460707-82460729 CACACTGCAATTAGTCCTCTTGG - Intronic
1103846450 12:123904925-123904947 CACACTGCAACAGGTAGTATGGG + Intronic
1105788327 13:23771093-23771115 CACACTGCAACAAGTGCTATGGG + Intronic
1105870044 13:24496534-24496556 GACAATGCTACAAGAGCTATGGG + Intronic
1107359876 13:39606840-39606862 AATACTGTAACAAGGGCTATGGG - Intergenic
1110859030 13:80327577-80327599 CACACGGCAAGAAATGCTGTCGG - Intergenic
1113031321 13:105996878-105996900 CACAGAGCAACAAGTGCAGTAGG - Intergenic
1114741765 14:25104926-25104948 CACAGTGTAACAAAGGCTATTGG + Intergenic
1117106467 14:52402113-52402135 CAAATTTCAACAAATGCTATTGG + Intergenic
1118476830 14:66125360-66125382 AACACTGCAAGAAGTTGTATTGG - Intergenic
1118689061 14:68320840-68320862 CACAGTGTAAGAAATGCTATTGG - Intronic
1119507450 14:75185285-75185307 AAAACTGTAACAAGGGCTATGGG - Intergenic
1122554290 14:102568798-102568820 AAGACTGTAACAAGGGCTATGGG - Intergenic
1122584465 14:102795655-102795677 AAGACTGTAACAAGGGCTATGGG - Intronic
1202942292 14_KI270725v1_random:162444-162466 AAGACTGTAACAAGTGCTAGGGG + Intergenic
1123775834 15:23578806-23578828 AAGACTGTAACAAGGGCTATGGG + Intronic
1126465473 15:48957648-48957670 CACATTGCAATAAATGCTCTTGG + Intronic
1126596816 15:50391611-50391633 AAGACTGTAACAAGGGCTATGGG - Intergenic
1128461134 15:67868648-67868670 AAGACTGTAACAAGGGCTATGGG - Intergenic
1130170235 15:81504250-81504272 CACACAGCAATAAGTACAATAGG + Intergenic
1131256961 15:90869353-90869375 CTCATTGCAACAAGTCCTGTGGG - Intronic
1136500159 16:30666067-30666089 TACACTGCTGCAAGTGCTAAGGG - Intronic
1140244637 16:73237034-73237056 CTCACTACAACCAGTGATATCGG + Intergenic
1143236570 17:5406703-5406725 CACACTGGAACAATTGTTTTGGG + Intronic
1143240523 17:5439517-5439539 AACATTGTAACAAGGGCTATAGG - Intronic
1147024433 17:37567690-37567712 CACACTGTAACAAGAACTAAGGG - Intronic
1149268314 17:54951585-54951607 AAGACTGTAACAAGGGCTATGGG + Intronic
1149342954 17:55705606-55705628 CAAACTGCAGGAAGTTCTATGGG + Intergenic
1151192149 17:72406514-72406536 AAGACTGTAACAAGGGCTATGGG - Intergenic
1154125080 18:11685032-11685054 AACACTGCAAAAAGTTGTATTGG + Intergenic
1154971849 18:21417611-21417633 CACACTACAAGAAATGCTAAAGG + Intronic
1156333550 18:36148456-36148478 AAGACTGTAACAAGGGCTATGGG + Intronic
1157290461 18:46406214-46406236 TTCAATGCAACAAGAGCTATTGG - Intronic
1157959078 18:52132215-52132237 AAGACTGTAACAAGGGCTATGGG + Intergenic
1165967189 19:39592345-39592367 CTCACTGCAACAACTGCCTTCGG - Intergenic
925704417 2:6670227-6670249 CCCACTGCTCCATGTGCTATAGG + Intergenic
927666901 2:25039173-25039195 AAGACTGTAACAAGGGCTATGGG - Intergenic
927758961 2:25733370-25733392 CAGTCTTCAACAAGTGCTGTTGG - Intergenic
928716064 2:34062252-34062274 CACACAGCATCACGTGCTACAGG - Intergenic
929672186 2:43885276-43885298 AACACTGCACCTACTGCTATGGG - Intergenic
931435605 2:62243600-62243622 AAGACTGTAACAAGGGCTATGGG - Intergenic
932632322 2:73355482-73355504 AAGACTGTAACAAGGGCTATGGG + Intergenic
933553888 2:83808241-83808263 AAGACTGAAACAAGGGCTATGGG + Intergenic
934983224 2:98864974-98864996 CACACTGAAACAACTGTTACAGG + Intronic
935331532 2:101981006-101981028 CAAACTGCACGAAGTGATATCGG - Intergenic
938606890 2:132903350-132903372 AACACTGCAGAAAGTTCTATTGG + Intronic
939236182 2:139496874-139496896 CACACTGTTATAAGTGATATTGG - Intergenic
943058961 2:183017881-183017903 CACACTGTACTAAGTGCTTTAGG + Intronic
946485427 2:220096570-220096592 CACACTGCAAAAAGCACTTTGGG + Intergenic
1169617726 20:7469213-7469235 CATCCTGCAAGAAATGCTATAGG - Intergenic
1170609223 20:17898446-17898468 AACACGGCAAAAAGTTCTATTGG + Intergenic
1170699385 20:18689700-18689722 AACACTGCAAAAAATTCTATTGG - Intronic
1171802923 20:29643860-29643882 AAGACTGTAACAAGTGCTAGGGG - Intergenic
1176580878 21:8524486-8524508 AAGACTGTAACAAGTGCTAGGGG - Intergenic
1180569326 22:16700888-16700910 CCCACTGCAGAAAGTTCTATCGG + Intergenic
1181099350 22:20528964-20528986 CAGGCTGCACCAAGTGCTCTGGG - Intronic
1181392305 22:22592586-22592608 CACGCAGCAGCAAGTGGTATGGG + Intergenic
950685447 3:14615020-14615042 CACACTGAAAGAAATACTATAGG + Intergenic
950983282 3:17331970-17331992 GATACTGTTACAAGTGCTATGGG + Intronic
951415786 3:22419901-22419923 AATACTGCAAAATGTGCTATGGG - Intergenic
951466117 3:23002187-23002209 CACACTGCTAAAAGTGTTCTGGG + Intergenic
952493298 3:33892694-33892716 AAGACTGCAACAAGGGTTATGGG + Intergenic
953797727 3:45998065-45998087 AAGACTGTAACAAGGGCTATGGG + Intergenic
957938733 3:86977461-86977483 CACACTTTAACAAGGGCTCTGGG - Intronic
963371648 3:144408548-144408570 CACACTGCAAAAAGAGCCCTAGG - Intergenic
964617290 3:158680875-158680897 ATCACTGCACCAAGTTCTATTGG - Intronic
964663783 3:159150557-159150579 GACAATGCAACATATGCTATTGG - Intronic
965131724 3:164708865-164708887 CACACTGCTAAAAGTTTTATAGG + Intergenic
965990586 3:174812357-174812379 CACAGTGCAACAAGTGCTAGTGG + Intronic
966700396 3:182842721-182842743 AAGACTGTAACAAGGGCTATGGG + Intronic
967866147 3:194191666-194191688 CACACTGTAAGCAGAGCTATAGG + Intergenic
967910787 3:194541081-194541103 AATACTGCAACAAGGGTTATGGG - Intergenic
970813889 4:20130003-20130025 AACACTGCAACAAATGCTAAAGG + Intergenic
970814059 4:20132319-20132341 TTCACTACAACAATTGCTATAGG - Intergenic
972958509 4:44422298-44422320 CACACTCCAACAACTGATAATGG - Intronic
973099443 4:46246400-46246422 CACACTGTTACAAGTGGTTTTGG + Intergenic
974774667 4:66464028-66464050 CAAACAGTAACAAGTCCTATAGG + Intergenic
976460345 4:85303326-85303348 AACATTGCACCAAGTGCTGTAGG + Intergenic
979986768 4:127325297-127325319 CACACTGCCAGTAGAGCTATGGG + Intergenic
981073839 4:140571601-140571623 CTCACTGCAACATTTGCTCTTGG + Intergenic
982772907 4:159414613-159414635 AAGACTGTAACAAGGGCTATGGG - Intergenic
987101770 5:14597409-14597431 CATACTGCAGCATGTGATATGGG - Intronic
987868578 5:23579650-23579672 CATATTGCAGCAAGTGCTGTGGG + Intergenic
989069164 5:37492375-37492397 CACCCTACAACAAGAGCTTTGGG - Intronic
989639568 5:43569928-43569950 CACACTGGAACACATGATATAGG + Intergenic
990355566 5:54962743-54962765 AAGACTGGAACAAGGGCTATGGG + Intergenic
990433777 5:55766623-55766645 GAGACTGCAACAAGAGCTTTGGG + Intronic
990604622 5:57396209-57396231 AACACTGTCACAAGCGCTATGGG + Intergenic
995200451 5:109419737-109419759 CTCACTGCAACCTGTGCTTTCGG + Intergenic
999067899 5:148711206-148711228 CAAAAGGCAGCAAGTGCTATTGG + Intergenic
999875856 5:155804940-155804962 GACACTGCAGAAAGTTCTATTGG - Intergenic
999938098 5:156509965-156509987 CACAATGCAAGTAGTGCTTTGGG - Intronic
1000873006 5:166600645-166600667 CACACAGCAACAGGTGTAATTGG + Intergenic
1001467636 5:171982720-171982742 AACACTGTAACAAGGGCTGTGGG - Intronic
1001582624 5:172809298-172809320 AACACTGTAACTAGGGCTATGGG - Intergenic
1004294062 6:14394511-14394533 AAGACTGGAACAAGGGCTATGGG - Intergenic
1007432988 6:41787110-41787132 CGCACTGCACCATGTGCTAGTGG + Exonic
1008662527 6:53682770-53682792 AACTCAGCAACAAGTACTATTGG + Intergenic
1011381189 6:86743792-86743814 AACACTGTAACAAGGACTATGGG + Intergenic
1018195480 6:161353118-161353140 AAGACTGTAACAAGAGCTATGGG - Intronic
1022010992 7:26308126-26308148 AACACTGTAACAAGGGCTATGGG - Intronic
1023551262 7:41372370-41372392 CACACTGAAAGAAGTGCTGAGGG - Intergenic
1024010934 7:45266232-45266254 AAAACTGAAACAAGTGCTACTGG - Intergenic
1024331855 7:48162681-48162703 AAGACTGTAACAAGGGCTATGGG + Intergenic
1025289674 7:57704408-57704430 AAGACTGTAACAAGTGCTAGGGG + Intergenic
1026742878 7:72990122-72990144 CACACAGCAGCTATTGCTATGGG + Intergenic
1026802734 7:73410512-73410534 CACACAGCAGCTATTGCTATGGG + Intergenic
1027028993 7:74874827-74874849 CACACAGCAGCTATTGCTATGGG + Intergenic
1027100857 7:75374956-75374978 CACACAGCAGCTATTGCTATGGG - Intergenic
1027261039 7:76464720-76464742 CACACTGGAACATGTGGAATGGG + Intronic
1027312419 7:76962832-76962854 CACACTGGAACATGTGGAATGGG + Intergenic
1027474739 7:78615321-78615343 CACATTGCAACAAGGGCAGTTGG - Intronic
1027551856 7:79608124-79608146 CACACTGCACCAAGGCCTATTGG + Intergenic
1028731071 7:94148912-94148934 CACCCTGAAACAGGTGGTATTGG + Intergenic
1031778787 7:125936697-125936719 ATCACTGCAGCAAGTTCTATAGG - Intergenic
1033897976 7:146098083-146098105 CACACTGCAACTAGGATTATTGG - Intergenic
1036157292 8:6354516-6354538 GACACTACACTAAGTGCTATGGG + Intergenic
1036573702 8:10004460-10004482 AACTCTGCACCCAGTGCTATGGG - Intergenic
1041350896 8:56946907-56946929 AAGACTGCAACAAGGGCTATGGG - Intergenic
1041863072 8:62535957-62535979 AAGACTGTAACAAGGGCTATGGG + Intronic
1043356343 8:79417085-79417107 CACACTCCAAAATGTGCTCTGGG + Intergenic
1044711669 8:95064599-95064621 AAGACTGTAACAAGGGCTATGGG - Intronic
1044736063 8:95279465-95279487 CACAGTGAAAGAAGTGCTAGGGG - Intergenic
1044791061 8:95847437-95847459 CACATTGGAACAGTTGCTATGGG + Intergenic
1046696297 8:117343657-117343679 CACACTGAAAACAGTGCTATAGG + Intergenic
1047085115 8:121507285-121507307 CACACTGGCTCATGTGCTATGGG + Intergenic
1049327230 8:142029034-142029056 CACACTACAACAAATGCTACAGG + Intergenic
1055962176 9:81831145-81831167 CTCACTGCAACAGGTGATCTCGG + Intergenic
1059623746 9:116038107-116038129 CACTCTGGAACAAGCGCTATAGG + Intergenic
1062139623 9:134948666-134948688 CAAATGGGAACAAGTGCTATGGG - Intergenic
1185956039 X:4490471-4490493 CACACTGCAAGAAGTGGTAAGGG + Intergenic
1187151183 X:16683029-16683051 CCCTCTGGAACATGTGCTATTGG + Intronic
1188312241 X:28631450-28631472 CACACTGTAATAAGTGCTCTAGG + Intronic
1188597722 X:31921987-31922009 AAAACTGTAACAAGGGCTATGGG - Intronic
1188890467 X:35606049-35606071 AAAACTGTAACAAGGGCTATGGG - Intergenic
1189999844 X:46675524-46675546 AAGACTGTAACAAGAGCTATGGG - Intronic
1190414082 X:50164075-50164097 AAGACTGTAACAAGGGCTATGGG + Intergenic
1194679904 X:96840280-96840302 CACACTGTGAATAGTGCTATTGG + Intronic
1194970582 X:100338750-100338772 CACACTGCCAAAATTTCTATGGG - Intronic
1195541388 X:106067463-106067485 CACAATGCAACAAGTACAGTAGG - Intergenic
1197337881 X:125230817-125230839 CAGACTGTAACAAGGGCTATGGG - Intergenic
1197749560 X:129955169-129955191 CACACTGCAACTACTGATACGGG + Intergenic
1198111394 X:133505493-133505515 TACACTGCAACATGAGATATGGG + Intergenic
1198409819 X:136355162-136355184 AAGACTGTAACAAGGGCTATGGG + Intronic
1199549602 X:149044288-149044310 CACACTATAACAGGTGCTCTAGG + Intergenic
1200038798 X:153350716-153350738 CACTATGTAACAAGTGCTTTTGG - Exonic