ID: 1105788897

View in Genome Browser
Species Human (GRCh38)
Location 13:23777924-23777946
Sequence GGACATACTAAGTTTTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105788897 Original CRISPR GGACATACTAAGTTTTAAGA GGG Intronic
902892954 1:19458000-19458022 GGTCATAATAATTTTTAAAAAGG + Intronic
908823759 1:68114459-68114481 GCATATAGTAAGTTTTAAAAAGG - Intronic
910663392 1:89697964-89697986 TGACATACTAACTTTTCTGAGGG - Intronic
912137245 1:106676496-106676518 GGACATACTAAAGTTGGAGACGG - Intergenic
913006298 1:114635703-114635725 GGACTTACTAATATTTTAGAGGG - Intronic
915097467 1:153473569-153473591 GGACCTACTGAGTTATAAAATGG - Intergenic
915244400 1:154546076-154546098 AGACAAACTAAGTCTTGAGATGG + Intronic
917728524 1:177850863-177850885 GGTAATACTATGTTTCAAGAGGG - Intergenic
918608325 1:186456883-186456905 GCACATACTATGCTTTGAGATGG + Intronic
921275276 1:213512969-213512991 GGACATGCTCATCTTTAAGAGGG - Intergenic
921371818 1:214431438-214431460 GGAGAAACTGAGTCTTAAGAAGG + Intronic
921682044 1:218045215-218045237 GAAAAAAATAAGTTTTAAGAAGG + Intergenic
1063803247 10:9605684-9605706 GGAAATCCTGAGATTTAAGAAGG + Intergenic
1066449523 10:35515959-35515981 GGACAAAGTAAGTTTTAAAGGGG - Intronic
1067340916 10:45402789-45402811 GGACCTACAAATCTTTAAGAAGG + Intronic
1067922120 10:50469930-50469952 GGAAGTAATAAGTTTTAAAAGGG - Intronic
1071365531 10:84896625-84896647 AGACATACTATGTTCTTAGAAGG - Intergenic
1071727528 10:88214726-88214748 TGACATATTAATTTTTAAAAAGG - Intergenic
1073408541 10:103320102-103320124 GGCCAGCCTAACTTTTAAGATGG + Intronic
1073476571 10:103757531-103757553 GCACATACCAAGTTGTAACAAGG + Intronic
1074957068 10:118401985-118402007 GGCAATACTAAGTGTTGAGAAGG - Intergenic
1080131494 11:28800829-28800851 TTACATACTAAGGTTTAAGCTGG + Intergenic
1082183945 11:49156356-49156378 GGAGATACTAATTTTGAATAAGG + Intronic
1087563198 11:99817471-99817493 GGCCATAGTAAGGTTTAAAAAGG - Intronic
1088787041 11:113191335-113191357 GGATATACTAAGTTTAAACAGGG - Intronic
1090048873 11:123359747-123359769 GGAAATAATAATTTTTAAAAAGG + Intergenic
1091936525 12:4439286-4439308 GGACATACAAAGTTAGAACAGGG - Intronic
1093107894 12:15111597-15111619 GGACATACCAAGTTCTAACATGG + Intronic
1093394656 12:18666428-18666450 GGCTATACTAATTTTTAAAATGG + Intergenic
1096431815 12:51550794-51550816 TGACATACAAAGCTTTAAAATGG + Intergenic
1097773000 12:63611030-63611052 GGCCATCCTAAGTTTTGAGGTGG - Intronic
1099095036 12:78364704-78364726 GAACATACTGAGTTTTAAAGAGG + Intergenic
1099166581 12:79314303-79314325 GGACAGCCTAAGTGTTCAGAAGG + Intronic
1101183885 12:102252323-102252345 GGAAAAACTAAGTTTGAAAATGG - Intergenic
1103510605 12:121471144-121471166 GTACATGCTAAATTTTAAGTTGG - Intronic
1105538128 13:21288875-21288897 GAAGACACTAATTTTTAAGATGG - Intergenic
1105788897 13:23777924-23777946 GGACATACTAAGTTTTAAGAGGG + Intronic
1106583233 13:31035555-31035577 GGAAATAATAAGTTTTAAACTGG + Intergenic
1108488148 13:50949374-50949396 GGACTTACTAAGTCTTAAGTTGG + Intronic
1109864235 13:68241736-68241758 AGTCATACTAAGTTTCAAAATGG - Intergenic
1109903487 13:68806558-68806580 GGAGATTCTGAGTTTTAAGTTGG - Intergenic
1110397654 13:75050107-75050129 GGAGCTACTAAATTATAAGATGG + Intergenic
1112722737 13:102263306-102263328 GGACTTACTCATTTTAAAGATGG + Intronic
1113228009 13:108180145-108180167 GTACATACTAACTTTTAAAAGGG + Intergenic
1115209182 14:30947687-30947709 AGACATACTAAGTTTAAACCTGG + Intronic
1117809638 14:59532990-59533012 GGAAATGCTAAGTTTTAGCAGGG + Intronic
1118750409 14:68803548-68803570 GTATTTACTAAGTCTTAAGATGG + Intergenic
1120501764 14:85306362-85306384 GTACATAGTTAGTTATAAGAAGG - Intergenic
1122150126 14:99721168-99721190 CGACTTACTTAGCTTTAAGAAGG - Intronic
1127191529 15:56536312-56536334 GGCCACACTAACTTGTAAGAAGG + Intergenic
1127313542 15:57773434-57773456 GGAAATTCTTAGTTTTAATATGG + Intronic
1127414606 15:58745805-58745827 GCACATACCCAGTTTAAAGAGGG + Intronic
1131222894 15:90599820-90599842 AGAGATACTGAGTTTAAAGATGG + Intronic
1140311220 16:73850419-73850441 AGACAGACTCAGTTTTCAGAAGG - Intergenic
1141012026 16:80411766-80411788 GAACATACTTATTTCTAAGAAGG + Intergenic
1143814810 17:9504065-9504087 ACACATACTAAGTTTTAAAAAGG + Intronic
1146376555 17:32298523-32298545 GGCCATGTTAAGCTTTAAGAGGG + Intronic
1147249262 17:39143474-39143496 GGACATGCCAAATTTGAAGAAGG - Intronic
1149202920 17:54208726-54208748 GGACATAATCAAATTTAAGAAGG - Intergenic
1151205924 17:72506748-72506770 TGACATGCTGAGTTTTCAGAGGG + Intergenic
1157806684 18:50663668-50663690 AGCCATTCTAAGCTTTAAGAAGG + Exonic
1165455973 19:35910853-35910875 GGACATACTAATTTTTAGCATGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926496449 2:13594345-13594367 AAACATACTAAATTTTAAGAAGG - Intergenic
928568384 2:32577518-32577540 GGAAATACACAGTTTAAAGAAGG - Intronic
930044869 2:47161251-47161273 GTATCTACTAACTTTTAAGATGG - Intronic
935942094 2:108250402-108250424 GGAAATACTAAGTGTTGATAAGG + Intronic
937420374 2:121749337-121749359 GAAGACACTAAGATTTAAGAAGG + Intronic
941097052 2:161250157-161250179 GGAAAAACTGAATTTTAAGAGGG - Intergenic
941202495 2:162529159-162529181 GGAGATACTGATTTTTGAGAGGG + Intronic
942231509 2:173864738-173864760 GGACATTCTATGTTGGAAGAAGG + Intergenic
945949266 2:216023378-216023400 GGACATAGTAATATTTAAGTGGG + Intronic
946530069 2:220561212-220561234 AGACATACTATGTCTAAAGAAGG + Intergenic
947271064 2:228336106-228336128 TAACCCACTAAGTTTTAAGATGG + Intergenic
947368710 2:229423316-229423338 AGATATACTGAGTTTTAAGCCGG + Intronic
1170488652 20:16847227-16847249 GGAGATACTGATTTTTAAGGTGG + Intergenic
1175601784 20:60280307-60280329 TTACATACAAAGTTTTAATATGG + Intergenic
1177447229 21:21213284-21213306 GTTAATACTAAGTTTTAAGGGGG + Intronic
1184575927 22:45365905-45365927 AGACATTCTATGTTTTTAGATGG + Intronic
949181895 3:1142039-1142061 GGACAAACCAAGGTTTAACATGG + Intronic
950824311 3:15800660-15800682 GCACATACTAAGTGTTAATTGGG + Intronic
952649098 3:35701551-35701573 GAAAATACGAAGTTTTAAAAAGG - Intronic
958637086 3:96759380-96759402 GGCAATACTAAGCTGTAAGAAGG + Intergenic
960293994 3:115920003-115920025 GGAAATTCTAAGTTACAAGATGG - Intronic
960582284 3:119291109-119291131 GGACATACTCAACATTAAGAGGG + Intergenic
964562949 3:158018605-158018627 GGTCATTATAAGTTTTAAAAGGG - Intergenic
964656311 3:159069979-159070001 GTGCTTACTGAGTTTTAAGAAGG - Intronic
965792984 3:172409655-172409677 GGAAATACTACATTTTAAAATGG + Intergenic
965875255 3:173309855-173309877 GAACATATTAACTTTTGAGATGG + Intergenic
971533923 4:27723988-27724010 AGAAAAATTAAGTTTTAAGAAGG + Intergenic
980373571 4:131912342-131912364 GGAGATACTAAATTTTGAGCTGG - Intergenic
983782922 4:171695574-171695596 GCACATTCTGAGTTTTAAAAAGG - Intergenic
983868191 4:172793021-172793043 GGATATAGTAAGTTTTCACATGG - Intronic
983904069 4:173167271-173167293 GGCTATCCTAAGTTTTAAGATGG - Intergenic
985311672 4:188608115-188608137 TGACATACTTAGTTGTAATAAGG - Intergenic
986226476 5:5819806-5819828 GGAAACAGTAACTTTTAAGAAGG - Intergenic
986936347 5:12892720-12892742 TGACAAACTAAGCTTTAGGAAGG + Intergenic
991284429 5:64955649-64955671 TGACAAATTAAGTTTTGAGATGG - Intronic
995543173 5:113203865-113203887 GGACATAATAATTTATAAGAAGG + Intronic
996867244 5:128139365-128139387 GGACATACTAAGTTTTACTTAGG + Intronic
999710388 5:154313336-154313358 GGTCATATCTAGTTTTAAGATGG - Intronic
1001087314 5:168709660-168709682 GGACACACTAAAGTTTGAGAGGG + Intronic
1005251678 6:23953126-23953148 AGACAAACTAAATTTTAACAAGG - Intergenic
1007963043 6:45978533-45978555 GGACCTACTGTGTTTTAACAAGG - Intronic
1009619705 6:66058861-66058883 TGAAATAATAAGTTTTAAGGTGG + Intergenic
1014634500 6:123828567-123828589 AGACATAATTAGTTTTAAGCAGG - Intronic
1014989699 6:128058308-128058330 GAAAATACCAAGTCTTAAGAAGG - Intronic
1016200231 6:141397304-141397326 GAAGATACGAAGTTTTAAGATGG - Intergenic
1019890548 7:3942648-3942670 GAAGATACTGAGTTTTCAGATGG + Intronic
1019904029 7:4047128-4047150 GAACATTCTAAATTTTAAAAAGG - Intronic
1020881853 7:13771811-13771833 GGACATAGAAAGTTTAAAAAAGG - Intergenic
1021045436 7:15917463-15917485 GGAATCACTAAGTATTAAGAAGG - Intergenic
1022016949 7:26358366-26358388 GCACATTCTAAATTATAAGAGGG - Intronic
1022260390 7:28698690-28698712 GGAAATGCTATGTTTTATGAAGG + Intronic
1022735196 7:33069650-33069672 GGCCAGATTAACTTTTAAGATGG + Intergenic
1023179645 7:37469215-37469237 GGACATAATATGTTTGAACATGG - Intergenic
1024915414 7:54493554-54493576 GGAAATACTAAGTTATAAGAAGG + Intergenic
1027981454 7:85229111-85229133 AGATATACTAAGTTGTAAAATGG + Intergenic
1030718492 7:112840218-112840240 GGAATTACTAAGATTTAAAAAGG - Intronic
1031690756 7:124784643-124784665 GTAAATACTCAGTCTTAAGACGG + Intronic
1033899545 7:146118134-146118156 GGACATTATAAGTTGTAATAAGG + Intronic
1036158157 8:6361947-6361969 TGACATATTTATTTTTAAGAAGG - Intergenic
1038847797 8:31245828-31245850 GGAAATACTGAGTTTAAAGTAGG - Intergenic
1038972980 8:32658462-32658484 GGACATACTGAGTTGTATTAGGG + Intronic
1039717893 8:40130539-40130561 GGACATAATAACTTTGAAAAAGG + Intergenic
1043116783 8:76265663-76265685 GGACATACCAAGTATTAAACTGG + Intergenic
1045714553 8:105026301-105026323 GGACACACTAGGTATTTAGATGG + Intronic
1046361832 8:113169602-113169624 TAACATATTAAGATTTAAGAAGG - Intronic
1049113557 8:140665790-140665812 GTACATACTAAGATTTTATATGG - Intronic
1053182257 9:35982843-35982865 GGACATACTAATTTTTAACCTGG - Intergenic
1054860223 9:69944409-69944431 GGACACTATAAGTTTTAAGCAGG - Intergenic
1056658344 9:88526878-88526900 GGACTTCCTAAGGTTTCAGAGGG + Intergenic
1186530693 X:10292205-10292227 GGAAATACTAAGTTGGATGAAGG - Intergenic
1188330732 X:28868022-28868044 GAACATATCAAGGTTTAAGAAGG - Intronic
1188409947 X:29859400-29859422 GGAAAAACACAGTTTTAAGAAGG - Intronic
1191599909 X:62991352-62991374 GCAGATACTAAGATTGAAGAGGG - Intergenic
1193636264 X:83952915-83952937 GGAAATACAAAATTTTAAAAGGG + Intergenic
1196432060 X:115637489-115637511 CCACATACTATGTTTTAAGTTGG - Intronic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1198178995 X:134185865-134185887 GGACATATTAAGTTATTTGAGGG + Intergenic
1198582732 X:138084141-138084163 GGAAATACTGAGGTTTAAGAAGG + Intergenic
1199463858 X:148114015-148114037 GAACATTCTTAGATTTAAGAGGG - Intergenic