ID: 1105790583

View in Genome Browser
Species Human (GRCh38)
Location 13:23794376-23794398
Sequence CAGCGTTAGCAATATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105790583_1105790590 10 Left 1105790583 13:23794376-23794398 CCTTCCTCATATTGCTAACGCTG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1105790590 13:23794409-23794431 CTGTTGGTGATAAGGCATAAAGG 0: 1
1: 0
2: 2
3: 37
4: 308
1105790583_1105790585 -6 Left 1105790583 13:23794376-23794398 CCTTCCTCATATTGCTAACGCTG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1105790585 13:23794393-23794415 ACGCTGCCTTAACTCCCTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 51
1105790583_1105790591 18 Left 1105790583 13:23794376-23794398 CCTTCCTCATATTGCTAACGCTG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1105790591 13:23794417-23794439 GATAAGGCATAAAGGTAAAGAGG 0: 1
1: 0
2: 1
3: 20
4: 252
1105790583_1105790587 2 Left 1105790583 13:23794376-23794398 CCTTCCTCATATTGCTAACGCTG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1105790587 13:23794401-23794423 TTAACTCCCTGTTGGTGATAAGG 0: 1
1: 0
2: 1
3: 3
4: 114
1105790583_1105790592 29 Left 1105790583 13:23794376-23794398 CCTTCCTCATATTGCTAACGCTG 0: 1
1: 0
2: 1
3: 5
4: 68
Right 1105790592 13:23794428-23794450 AAGGTAAAGAGGCATCACAATGG 0: 1
1: 0
2: 1
3: 21
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105790583 Original CRISPR CAGCGTTAGCAATATGAGGA AGG (reversed) Intronic
902761593 1:18584311-18584333 GAGAGTGAGCAATTTGAGGAAGG + Intergenic
904374585 1:30072384-30072406 CCGCGTTAGAAAGAAGAGGATGG + Intergenic
912867230 1:113268458-113268480 CAGAGTTAGCTAAGTGAGGATGG - Intergenic
918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG + Intronic
1065473128 10:26103449-26103471 CAGCGTGAGCAACAAGAAGATGG - Intronic
1078438460 11:11344746-11344768 CAGTGTGAGCACTATGTGGATGG + Intronic
1081047831 11:38297806-38297828 CAGTGTTAGCACTTTGAGCAGGG + Intergenic
1081690555 11:45074975-45074997 CAGCATTGCCAATATGAGGAAGG - Intergenic
1083962225 11:66020851-66020873 CAGCGTGAGCAAGGTGAAGAGGG + Exonic
1087321189 11:96660765-96660787 CATGGTTAGCAACATGATGAAGG + Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1092589281 12:9935772-9935794 CATCGTTAGCAAAAGGAGGATGG - Intergenic
1094734979 12:33224002-33224024 CAACAATAGAAATATGAGGAAGG - Intergenic
1105790583 13:23794376-23794398 CAGCGTTAGCAATATGAGGAAGG - Intronic
1107765795 13:43733145-43733167 CACCGTGAGCATTATGAGGCTGG + Intronic
1116053870 14:39839301-39839323 CAGGGATAGGAATATGAGAAGGG + Intergenic
1117756528 14:58980010-58980032 CATGGTTAGCAAGAGGAGGAAGG - Intergenic
1122235448 14:100328635-100328657 CACCGTGAGCAACATGAGGCTGG + Intronic
1125165048 15:36693435-36693457 CAGTGTTAGCAACATAAGGTTGG - Intronic
1128741746 15:70088762-70088784 CAGAATTACCAATATGAGAAAGG + Intronic
1131370235 15:91874989-91875011 CAGCCTTAGCACCATGAGCAGGG - Intronic
1131370425 15:91876477-91876499 CAGCCTTAGCACCATGAGCAGGG + Intronic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1134618919 16:15672950-15672972 CAGCGTTGGAAGGATGAGGAGGG - Intronic
1143069778 17:4281385-4281407 CAGAGTTAGGAATATGAGAAAGG + Intronic
1149081847 17:52667288-52667310 AAGCATTAGCAATGTGAAGACGG - Intergenic
1151748887 17:76025846-76025868 CAGCCTCAGCAATCTGTGGATGG - Intronic
1155012780 18:21797574-21797596 CAGGTTTAGGAATATGAGGAAGG + Intronic
1159705787 18:71685106-71685128 CAGCAATAGCAATACTAGGAGGG + Intergenic
1163048040 19:14659532-14659554 CTGCTTTAGAAATTTGAGGAAGG + Intronic
1164188825 19:22896928-22896950 CAGCCTGAGCAACATGGGGAGGG - Intergenic
1164252380 19:23491317-23491339 AAGCATTACCAATATGAAGAGGG - Intergenic
1167804181 19:51768314-51768336 CAGCCTCAGCATTGTGAGGAAGG - Intronic
943775276 2:191758929-191758951 TAGAGTTAGTAATATGAGAATGG + Intergenic
945799678 2:214411853-214411875 CATCTGTAGCAATATGGGGAGGG + Intronic
946560035 2:220902230-220902252 CAGGGCTAGCAATAAGAGTAAGG + Intergenic
1175954718 20:62603458-62603480 CAGGGTTGGCAAGAAGAGGAAGG - Intergenic
953054558 3:39377649-39377671 CAGCTTTAGCAATCTTAGTAAGG - Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
957774048 3:84732486-84732508 CATAGTTAGCAATATGAGTCTGG + Intergenic
962458692 3:135589189-135589211 CATCGGTAGCTTTATGAGGATGG - Intergenic
967330292 3:188283225-188283247 AAGCTTTTCCAATATGAGGAGGG - Intronic
968170674 3:196507275-196507297 CAGTGATAGCAATAGGAGGCAGG - Exonic
970716476 4:18932084-18932106 TAGAGATAGCAATGTGAGGAAGG + Intergenic
978861046 4:113449499-113449521 CAGCCTTAGGATTATGAGCATGG + Intergenic
991278072 5:64874723-64874745 CAGGGTTTGGAAAATGAGGAGGG - Intronic
991699029 5:69299896-69299918 CATACTTAGCAATTTGAGGATGG - Intronic
991959664 5:72031654-72031676 CAGGGTTAGCAATATGAGCAAGG - Intergenic
992689410 5:79228426-79228448 GAGCATTAGTAATATGATGATGG + Intronic
999120603 5:149206705-149206727 CTTAGTTAGCAATTTGAGGAGGG + Intronic
999436033 5:151564145-151564167 CATCGTAAGCAATTTGTGGAGGG - Intronic
999486400 5:152001141-152001163 TAGGGTTAGCTATATGAGAATGG + Intergenic
1006144305 6:31949148-31949170 CAGGGTGAGCAAGTTGAGGAAGG - Intronic
1006973383 6:38070823-38070845 CAGCATTACCAATATTAGGTGGG + Intronic
1014330180 6:120054779-120054801 TATCGCTAGCAATTTGAGGAAGG + Intergenic
1014865956 6:126530525-126530547 CTTGTTTAGCAATATGAGGAGGG + Intergenic
1015602670 6:134925899-134925921 CAGCGTGAGCAACAAGAGCAAGG + Intronic
1019949924 7:4363126-4363148 CAGAGTAAGGAAGATGAGGAAGG - Intergenic
1021266397 7:18529272-18529294 CAACCTTAGGAAGATGAGGAAGG - Intronic
1024955523 7:54915282-54915304 CAGCTTAAGCAAAATGAGCAAGG - Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1031682643 7:124693298-124693320 CAGTGTTGGCCATGTGAGGAAGG + Intergenic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1040493529 8:47946613-47946635 GAGTGTGAGCAAGATGAGGAGGG - Intronic
1050754280 9:8980965-8980987 CAGCCTCAGCATTATGAGTATGG + Intronic
1060254317 9:122013792-122013814 CAGCATTAGCAAGATGATGATGG + Intronic
1061613341 9:131762963-131762985 CAGTGTTAGAACTATGATGACGG + Intergenic
1061896927 9:133653045-133653067 CAGCCTGAGCCATCTGAGGAAGG + Intronic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1188269413 X:28120182-28120204 CTGCTTTTGCAATATGGGGAAGG + Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1194718809 X:97316689-97316711 CAGCATAAGCAATTTGATGATGG + Intronic
1195222264 X:102756584-102756606 CAGTGTTAGGAATATGCAGAAGG - Intergenic
1202086241 Y:21139801-21139823 CAGCTTTAACAGTAAGAGGACGG + Intergenic