ID: 1105790675

View in Genome Browser
Species Human (GRCh38)
Location 13:23795444-23795466
Sequence AAGGACTCCCCATATGATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105790673_1105790675 -6 Left 1105790673 13:23795427-23795449 CCCTAAGATTTCTGTATAAGGAC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1105790675 13:23795444-23795466 AAGGACTCCCCATATGATCACGG 0: 1
1: 0
2: 0
3: 7
4: 72
1105790670_1105790675 10 Left 1105790670 13:23795411-23795433 CCAAGGTCCAAAGCAACCCTAAG 0: 1
1: 0
2: 2
3: 14
4: 172
Right 1105790675 13:23795444-23795466 AAGGACTCCCCATATGATCACGG 0: 1
1: 0
2: 0
3: 7
4: 72
1105790674_1105790675 -7 Left 1105790674 13:23795428-23795450 CCTAAGATTTCTGTATAAGGACT 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1105790675 13:23795444-23795466 AAGGACTCCCCATATGATCACGG 0: 1
1: 0
2: 0
3: 7
4: 72
1105790671_1105790675 3 Left 1105790671 13:23795418-23795440 CCAAAGCAACCCTAAGATTTCTG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 1105790675 13:23795444-23795466 AAGGACTCCCCATATGATCACGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105790675 Original CRISPR AAGGACTCCCCATATGATCA CGG Intronic
901088765 1:6627891-6627913 AGGGACTCCCCAGCTGCTCAGGG + Intronic
904202950 1:28833536-28833558 AAGGCCAACCCAGATGATCAAGG + Intronic
904341649 1:29838871-29838893 AGGAGCTCCCCATCTGATCAGGG + Intergenic
905473041 1:38207385-38207407 AAGCACTCCCCAGATGGGCAGGG - Intergenic
913230502 1:116737000-116737022 AAGGACTACAGATATGAACAAGG - Intergenic
924942796 1:248824171-248824193 AAAGAAACCCCATATGTTCAAGG - Intronic
1065371730 10:24993884-24993906 AAAGACTTTTCATATGATCATGG + Intronic
1079845536 11:25462067-25462089 AAGGACTCCCTATTTAATAAAGG - Intergenic
1083245998 11:61429129-61429151 AATGATTCCTCAGATGATCAAGG + Intronic
1085952465 11:81348792-81348814 AAGGACTCTTCATAGGGTCAAGG - Intergenic
1088543429 11:110936773-110936795 AAGGACTCCCTGTAAGATGAAGG + Intergenic
1088919054 11:114248548-114248570 AAAGACGCCCCCTCTGATCAGGG + Intronic
1091674479 12:2478917-2478939 AAGTTTTCCCCAGATGATCAAGG - Intronic
1095608484 12:44098964-44098986 AAAGACATCCCATAAGATCATGG - Intronic
1097566690 12:61279349-61279371 AAGGACTCCCTATTTAATAATGG + Intergenic
1099853868 12:88139945-88139967 AAGGACTCACTATATTATCCAGG + Intronic
1100559123 12:95730063-95730085 AAGTACTCCCCAAATATTCAAGG - Intronic
1102706876 12:114888999-114889021 AAGGCCACTCCATATGATCGAGG - Intergenic
1105790675 13:23795444-23795466 AAGGACTCCCCATATGATCACGG + Intronic
1115109205 14:29801244-29801266 GAGGCCTCCCCACATTATCAAGG + Intronic
1118369741 14:65127510-65127532 AAGAACTCCCCACTTGCTCATGG - Intergenic
1119905346 14:78297127-78297149 AAGGCCTCCACACTTGATCAGGG - Intronic
1120718331 14:87864281-87864303 ATGGACTCACCATATGATCCTGG + Intronic
1125086510 15:35736551-35736573 AAGGACTCCCCATATAAAACAGG + Intergenic
1125968762 15:43894973-43894995 AAGGTCTCACCATATGGCCAAGG + Intronic
1128052388 15:64675513-64675535 AAAGACTCACCATATTACCAAGG + Exonic
1139005987 16:62572253-62572275 GAGGACTCCCCATACTTTCATGG + Intergenic
1141541839 16:84729521-84729543 GAGTATTCCCCATATGCTCATGG - Intronic
1146836676 17:36116578-36116600 AAGGATTGCCCAAATGATCAGGG + Intergenic
1148390774 17:47270828-47270850 AAGGATTCCGCATATAATCTAGG + Intronic
1152733145 17:81983356-81983378 CAGGAGGCCCCATATGATCGGGG + Intronic
1155447997 18:25932383-25932405 AATGACTCCCCAAATGCTTAGGG + Intergenic
1159345663 18:67200109-67200131 AAGGACTCCGCATGTAATCAGGG - Intergenic
927273677 2:21241928-21241950 AAGGACTCCCCAAATCAGGAGGG - Intergenic
927608554 2:24512539-24512561 AATGACTACCCATTTTATCAAGG + Intronic
932132215 2:69197880-69197902 AATGACACGCCATATCATCATGG - Intronic
935357838 2:102221071-102221093 AAGGATTCCCCATGTGCTCAGGG - Intronic
940449914 2:153824466-153824488 AAGGAATCCACATTTGTTCAGGG + Intergenic
940912162 2:159218413-159218435 AAGGATTAGCCAGATGATCAAGG - Intronic
941187381 2:162333994-162334016 AAGGAGACACCATATCATCAAGG - Intronic
941324716 2:164099538-164099560 AAGGACTCCCAGTGTGAGCATGG - Intergenic
946656925 2:221958383-221958405 AAGGACTCCCCAGAAAGTCAAGG + Intergenic
1168935294 20:1659868-1659890 AATAATTCCCCATGTGATCATGG - Intergenic
1169365921 20:4992271-4992293 AAGGATTCAGCATATGATTAAGG + Intronic
953207894 3:40848115-40848137 AAGGGCTCCCCACATGGGCATGG - Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
957831009 3:85518789-85518811 AAGGCCTACCCAGATGATCTGGG + Intronic
960990020 3:123304240-123304262 AAGGACTCCACAAATGGTCCCGG + Intronic
965109706 3:164405004-164405026 AAGGACCTGCAATATGATCAGGG - Intergenic
966268866 3:178081091-178081113 AAGGATGCCCCATATGATTTTGG - Intergenic
971026671 4:22595426-22595448 AAGGATGCCCCATAAGATCAGGG - Intergenic
972522425 4:39872034-39872056 AAAGACTCCCCAAATGATTTCGG - Intronic
980499791 4:133634133-133634155 CAGGACTCCCAGTATTATCAAGG + Intergenic
987764611 5:22208998-22209020 AATGACTACAAATATGATCAAGG - Intronic
990295140 5:54394072-54394094 AAGGACTCCCTATTTAATAAAGG - Intergenic
994535345 5:101023602-101023624 CAGGACTCCACATATGAGAAAGG + Intergenic
995927616 5:117394328-117394350 AAGGACTCCCAAAGTTATCAGGG - Intergenic
996590020 5:125136391-125136413 GATGACTCCCCTTATGGTCATGG - Intergenic
999925844 5:156376212-156376234 AATGGCTCCCCATATCATCTTGG + Intronic
1000277377 5:159750369-159750391 AAGCACTACCCAGATGAGCAGGG - Intergenic
1001998898 5:176184806-176184828 AAGATCTCCCGATATGACCAAGG + Intergenic
1004023630 6:11797650-11797672 AGAGAGTCCCCATATGATAATGG - Intronic
1005775081 6:29122376-29122398 AAGGACTCCCCATTTTATAAAGG + Intergenic
1005781139 6:29193611-29193633 AAGGACTCCCCATTTTATAAAGG + Intergenic
1008897008 6:56567624-56567646 AGGGACTACCCATATTATAATGG - Intronic
1010315042 6:74438017-74438039 AACCAATCCCAATATGATCAAGG - Intergenic
1013887815 6:114991175-114991197 ACAGACTGCACATATGATCATGG + Intergenic
1019477299 7:1250041-1250063 AGGGACTCCCCATGTGGCCATGG - Intergenic
1027685305 7:81273463-81273485 CAGTACTCCCCATAGGCTCATGG - Intergenic
1029004236 7:97190842-97190864 AAGGACTCCCCATAAGTAAATGG + Intergenic
1031279794 7:119783841-119783863 AAGGTCTACCCAGATTATCAAGG - Intergenic
1035178938 7:157075451-157075473 AAGGACTGCCCAAATGTGCAAGG - Intergenic
1048946883 8:139456861-139456883 TAGGACTACCCACATGATCCAGG + Intergenic
1055109708 9:72547656-72547678 AAGGACTTTACATTTGATCAGGG + Intronic
1187141039 X:16593937-16593959 AAGGAGTCTCCATTTGAGCAGGG - Intronic
1193322346 X:80137617-80137639 TAAGACTCCCCTTATGATTATGG - Intergenic
1200080930 X:153575977-153575999 GAGGACTCCCCATCTCATCCGGG - Intronic
1201547780 Y:15184823-15184845 AAAGTCTCCCCAAATTATCAGGG - Intergenic
1201555840 Y:15264055-15264077 CAGGACTCCCCAGATGGTAACGG - Intergenic
1202134949 Y:21651733-21651755 ATGGACTTCCCATTTGACCAAGG - Intergenic