ID: 1105791574

View in Genome Browser
Species Human (GRCh38)
Location 13:23805445-23805467
Sequence CAAAGGAATTAGATAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105791574 Original CRISPR CAAAGGAATTAGATAGAGTC TGG Intronic
901310985 1:8269583-8269605 AAAAGGATTTAAATAGAGTGTGG + Intergenic
906811326 1:48829939-48829961 CAAAGGAAAAAGAGAGAGTAGGG + Intronic
906934314 1:50198637-50198659 CAAAGGAATGAGATAGAGCTAGG - Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
907749839 1:57252366-57252388 CAATGGAATCAAATAGACTCAGG - Intronic
910131161 1:83908129-83908151 CACTGGAATTAGATAGGGTCAGG - Intronic
910589109 1:88910401-88910423 AAAAGGAAATAGAAAGAGCCAGG + Intergenic
911656962 1:100454802-100454824 CAAGGGACATACATAGAGTCAGG - Intronic
913232025 1:116747823-116747845 CAAATGAATTAGCTAAATTCTGG + Intergenic
914453361 1:147812816-147812838 CAAAGGAACAAGATAGATCCTGG + Intergenic
914682322 1:149947379-149947401 CAAAGCAATTTGATATAGTTGGG + Intronic
916304437 1:163313488-163313510 CAGAGGAATAAAATAGAGTCAGG + Intronic
919321740 1:196049615-196049637 CAAAGGAAGATGATAGAGTGAGG - Intergenic
922072133 1:222204927-222204949 CAAAGGGCTAAGATAGAGTTAGG + Intergenic
922093093 1:222416338-222416360 CAAAGGATTCAGATAGGGTAAGG + Intergenic
923834497 1:237595044-237595066 CTAAGGACTTTGATAGTGTCTGG + Intronic
924076493 1:240343578-240343600 CTAACCAATTAGATAGAATCAGG - Intronic
1062842622 10:682805-682827 CAATGGAATTAGTTTGGGTCCGG + Intronic
1063111343 10:3040390-3040412 CAAAGGCATTTGATAGAATAAGG + Intergenic
1064632229 10:17328347-17328369 AAAAGGAATAAGAAAGATTCAGG - Intronic
1066576090 10:36826479-36826501 CAAATGAACTAGCTACAGTCAGG + Intergenic
1069272486 10:66547121-66547143 AGAAGGAAGTAGATAGAGTGTGG + Intronic
1071085650 10:81865881-81865903 CAAAGGAATTCCACAGAGTTGGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079975999 11:27092344-27092366 CAAACGGATCAGCTAGAGTCAGG + Intronic
1085131924 11:74047428-74047450 CAAAGGAATTATCTAAAATCTGG + Intronic
1085396212 11:76208440-76208462 CAAAGGATTTGGATACAGGCTGG - Intronic
1087343120 11:96934471-96934493 CAAAGGAACTAGATGGAAGCAGG + Intergenic
1089527088 11:119104263-119104285 AAAAGGAAATAGATACAGACTGG - Intronic
1089746102 11:120618305-120618327 CATAGGAATTAGAAGCAGTCAGG - Intronic
1090544472 11:127747696-127747718 CAAAGGAATTACTTAAAGTTGGG - Intergenic
1090998263 11:131886321-131886343 CACAGGAATTAGAGACAGCCAGG - Intronic
1091307605 11:134547056-134547078 CAAAGGAATTAAATAGAAAAGGG + Intergenic
1091412349 12:252353-252375 GGAAGGAATTAGAAAGAGACAGG + Intronic
1092785068 12:12019084-12019106 CAGAGGAATGAGATCGAGTTTGG - Intergenic
1100005487 12:89890525-89890547 CTAAGGAATTAGCAGGAGTCAGG + Intergenic
1100767639 12:97885352-97885374 CAAAGGACTTGGATTGATTCTGG - Intergenic
1100925778 12:99546725-99546747 GAAAGAAATCAGATGGAGTCTGG + Intronic
1102080534 12:110094354-110094376 TAAATGAATTAGATAGGGTGTGG - Intergenic
1102333922 12:112060692-112060714 CTAAAGAATTAGATGAAGTCAGG - Intronic
1103255887 12:119540961-119540983 AAGAGGAAGTAGGTAGAGTCAGG - Exonic
1103462202 12:121113918-121113940 TAAATGAATTAGATAGGGTGTGG + Intergenic
1104254934 12:127127801-127127823 CAGAGGGATAAGAGAGAGTCTGG - Intergenic
1105523951 13:21157227-21157249 CTAAAGAATCAGATACAGTCAGG + Intronic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1106433080 13:29700493-29700515 AATAGGAATTAGATTGAATCTGG - Intergenic
1107958948 13:45542430-45542452 CAAAGAAATGAGACAGAGCCTGG - Intronic
1108797701 13:54051838-54051860 AACAGGAATAAGATAGAATCAGG - Intergenic
1110703148 13:78572973-78572995 GCTAGGAATTAGATAGATTCAGG + Intergenic
1113983495 13:114295649-114295671 CAAAGGAATAAGATAACCTCAGG - Intronic
1114992915 14:28311030-28311052 AAAAGTAATTTGATAGAGTCAGG - Intergenic
1115464767 14:33703043-33703065 CAAAGGAAATATATTGACTCAGG - Intronic
1115805865 14:37051017-37051039 CAATGGAAAAAGATAGAGTAGGG - Intronic
1116605747 14:46992659-46992681 CATAGTAATTTGATAGAGACCGG + Intronic
1117976762 14:61305922-61305944 TAAAGGAGTTACAGAGAGTCTGG + Intronic
1120031697 14:79649062-79649084 ACAAGGAATTAGATTGAGTGTGG - Intronic
1120129281 14:80786106-80786128 CAAAGAAATGAGATTAAGTCAGG + Intronic
1120306986 14:82783336-82783358 CAATGGAATTAGATAAATTGTGG + Intergenic
1120903802 14:89601549-89601571 CAAAGCAATTAGTTAAACTCAGG + Intronic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1124809122 15:32916696-32916718 CAAATGGACTAGATATAGTCTGG + Intronic
1129280296 15:74480098-74480120 CAGAGCAGTTAGATAGAGTGTGG + Intergenic
1137968782 16:52962770-52962792 AAAAGGAGATAGAGAGAGTCAGG + Intergenic
1138572212 16:57883106-57883128 CATTGGAATTGAATAGAGTCTGG + Exonic
1139093660 16:63679266-63679288 CACAGCAATTACCTAGAGTCTGG - Intergenic
1139178901 16:64722586-64722608 CAAATGAAGGAGATAGAGTAAGG + Intergenic
1140139370 16:72240520-72240542 CAAAGGAATAAAATAGAATATGG - Intergenic
1140601764 16:76485055-76485077 CAAAATAATTAGTTAGAGTAAGG + Intronic
1143350911 17:6287721-6287743 AAAAGGAAGTACATAGACTCTGG - Intergenic
1143639023 17:8184861-8184883 GAAAGGAATGAGATACAGGCAGG + Intergenic
1145269973 17:21399614-21399636 CAAAGGAATGGGAGAGAGGCAGG + Intronic
1149289485 17:55202748-55202770 CAATGGAATCACATAAAGTCAGG - Intergenic
1149419799 17:56498877-56498899 CAAAGCAAATAGATGAAGTCTGG + Intronic
1151545688 17:74791500-74791522 CAAAGGAAGTTGATGGAGGCCGG + Intronic
1156203935 18:34865430-34865452 AAAAGGAATAAAATAGAGTAAGG - Intronic
1158167957 18:54562832-54562854 CAAAGTAATTAAATCCAGTCAGG - Intergenic
1158191361 18:54832218-54832240 CAAGAGAAGTAGATAGATTCAGG + Intronic
1162221878 19:9184095-9184117 TAAAGGAATTAAATAGAGGCCGG + Intergenic
1162660813 19:12167727-12167749 CAAAGGTTTTAGGTAGAGACGGG - Intronic
925795102 2:7532789-7532811 AAATGGAATTAGAAAGAGACAGG + Intergenic
926511162 2:13781034-13781056 CAAAGGAACAAGAAAGAGCCAGG - Intergenic
928078194 2:28284799-28284821 AAAAGAAATTATATAGACTCAGG + Intronic
931676620 2:64702794-64702816 CAAAGGAATTAAATTTACTCTGG + Intronic
932084803 2:68748422-68748444 CAAAGGAATGAGATCGTTTCAGG - Intronic
933110586 2:78395507-78395529 CAAAGGCATTAGAAAAAGACAGG - Intergenic
935550977 2:104453723-104453745 TAAAGGAATGATATAGAGGCAGG + Intergenic
939075508 2:137598034-137598056 AACAGGAATGAGATAGAGTGAGG - Intronic
939377296 2:141385009-141385031 CAAAGGTATTAGAAAGACACAGG - Intronic
939474251 2:142665974-142665996 CAAAGACATTAGAAAGAGTTAGG - Intergenic
939749018 2:146017708-146017730 GACAGGAAATTGATAGAGTCAGG + Intergenic
940319361 2:152359516-152359538 TAAAGGAACTAGGGAGAGTCAGG + Intronic
940889912 2:159025469-159025491 AAAGGGAATTACATAGTGTCTGG - Intronic
941863733 2:170312093-170312115 CAAAGAAATAAGACATAGTCAGG - Intronic
942586696 2:177487567-177487589 CAAATAAATTAGAAGGAGTCAGG + Intronic
944977592 2:205073599-205073621 CAAAGAAAACAGAAAGAGTCTGG - Intronic
945569204 2:211443117-211443139 CAAAGGCAATAGAAAGAGTAAGG - Intronic
946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG + Intergenic
948398645 2:237666442-237666464 CAAAGGTTTTAATTAGAGTCAGG + Intronic
1169069313 20:2713069-2713091 CAAAGGAATCAGATGATGTCTGG + Intronic
1169477589 20:5946667-5946689 CAAAGGAACTAGAGAGAACCTGG + Intronic
1172392390 20:34574680-34574702 CATAGGGAGTAGATAGAGTGAGG - Intronic
1175601364 20:60276409-60276431 CAAAGGAAATAGACAGACCCAGG + Intergenic
1176694269 21:9955428-9955450 TAAAGAAAATAGATAGATTCCGG - Intergenic
1177369773 21:20187126-20187148 CAAATAAAGTAGCTAGAGTCTGG - Intergenic
1182813034 22:33134098-33134120 CAAAGGAACTAGAGAGGTTCAGG + Intergenic
1183994585 22:41623373-41623395 AAAAGAAATCAGATACAGTCTGG - Intronic
1184804960 22:46788846-46788868 GAAAGGAATTCAAAAGAGTCTGG - Intronic
949461660 3:4301328-4301350 CCAAGGAAATAGGTAAAGTCTGG + Intronic
954893574 3:53955481-53955503 CAAAAGAATAAGGTAGAGTTAGG + Intergenic
959251973 3:103960015-103960037 TACAGAAATTAAATAGAGTCAGG - Intergenic
960514146 3:118584344-118584366 CACATTAATTAGACAGAGTCAGG - Intergenic
961073785 3:123962895-123962917 CAAATGAACTAGATAGAGAGTGG + Intergenic
962387145 3:134940746-134940768 CAAATGAATAATATAAAGTCAGG - Intronic
965799249 3:172474725-172474747 CAAAGGGATTAGAAAGGGTGAGG - Intergenic
965979330 3:174668165-174668187 CAAAGGAATTAAATAGACAAAGG - Intronic
971158311 4:24106602-24106624 CAAAGGAAATAGATACAGGGAGG - Intergenic
971532090 4:27701835-27701857 CAAAGGCTTTGGCTAGAGTCTGG + Intergenic
972069583 4:34999759-34999781 CAAAGAAAATAGATAGAGAAAGG - Intergenic
972843350 4:42957119-42957141 CAAAGAAATTAGGTAGAGAGTGG - Intronic
974041292 4:56860088-56860110 AAAAGGAGTTAGAGAGAGGCCGG + Intergenic
974551538 4:63381035-63381057 CCAAAAAAGTAGATAGAGTCAGG - Intergenic
974873046 4:67667244-67667266 CAAAATAATTAGATATAGTCAGG + Intronic
975769946 4:77709997-77710019 CAAAGGCTTTAGATGGATTCTGG + Intergenic
975991569 4:80264429-80264451 CCAAGGGCTTAGAAAGAGTCAGG - Intergenic
976988824 4:91337987-91338009 CAAAGGCATTAGCTATAGTCAGG - Intronic
977258557 4:94769088-94769110 AAAAGGAATTAGAGTAAGTCAGG - Intronic
979342592 4:119544120-119544142 CAAAAGGATTTCATAGAGTCTGG + Intronic
980211093 4:129788958-129788980 CAAAGGATTTAAAAAGATTCAGG - Intergenic
982465716 4:155728444-155728466 CACAGGTAGAAGATAGAGTCTGG - Intronic
982750248 4:159152418-159152440 CAAAAGAATTTCATAGATTCAGG - Intronic
982833500 4:160092651-160092673 CAAAGGGGTGAGAGAGAGTCGGG + Intergenic
984909641 4:184661408-184661430 AAAAGGTATAAGATAGAGGCTGG + Intronic
986214975 5:5711681-5711703 ACAGGGAACTAGATAGAGTCTGG - Intergenic
986596798 5:9431037-9431059 CAAAGGAATGGGATACAGTTTGG + Intronic
990465765 5:56069696-56069718 TAAAGGAATAAAATGGAGTCAGG + Intergenic
990832846 5:59979712-59979734 GAAAGGAAGTAGATGGAGCCGGG - Intronic
993584635 5:89709037-89709059 ACAAGGTAGTAGATAGAGTCGGG + Intergenic
993609690 5:90039145-90039167 CACAGGAAGAAGAAAGAGTCTGG + Intergenic
995498155 5:112771601-112771623 CAAAGGAATAAGATTCAGACTGG - Intronic
996240666 5:121197189-121197211 CAAAGGAAGTACCTAGAGCCTGG + Intergenic
1004118449 6:12794824-12794846 CATAGGGATTAGAGAGAGTGGGG + Intronic
1006581696 6:35081185-35081207 CAGAGGAATGAGGTAGAGCCTGG - Intronic
1008193117 6:48484442-48484464 CAAATTAATTAGATAAATTCTGG + Intergenic
1009748713 6:67855071-67855093 AAAAGGAAATAAATAGAGTAAGG + Intergenic
1009979567 6:70711397-70711419 AAAAGGAATAAAATACAGTCAGG - Intronic
1011098922 6:83699792-83699814 CAAAGGAATTACCTAAAGACAGG + Intronic
1011187554 6:84695683-84695705 GAAAGGAAAGAGAAAGAGTCAGG + Intronic
1011459272 6:87586750-87586772 CAAAGGTATTAAATACAGGCTGG + Intronic
1020492293 7:8802349-8802371 CAAACGAAATAGATTGAGTTGGG + Intergenic
1021503631 7:21356775-21356797 CAAAGAAATAAGATAGAGCTGGG + Intergenic
1033391199 7:140929159-140929181 TAAAGTATTTAGACAGAGTCTGG - Intergenic
1033958884 7:146887691-146887713 CAAAAGAATTAAGTTGAGTCTGG + Intronic
1036948945 8:13122455-13122477 CAAAGGAATTACAGAGAGGTTGG + Intronic
1037809725 8:22080377-22080399 CAAAGGAATCAGAGGCAGTCGGG - Intronic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1039100582 8:33937525-33937547 CAAAGGAATGTGATTAAGTCTGG - Intergenic
1039234122 8:35483138-35483160 CACATGAATTAGAGAGACTCTGG + Intronic
1042483849 8:69330895-69330917 AACAGGAATTAGAGAGAGTGAGG + Intergenic
1044704063 8:94991583-94991605 AAAAGGAAGTAGATAGGGACAGG - Intronic
1046058168 8:109103422-109103444 CAAAGGAATGTGATAGTGTGAGG + Intronic
1048470944 8:134703741-134703763 CAGGGGAATAAGATAGGGTCTGG - Intronic
1049905262 9:210878-210900 AAAAGGAGTTAGAAAGTGTCAGG + Intergenic
1051922072 9:22278591-22278613 CAATGGGATGAGTTAGAGTCTGG + Intergenic
1053774520 9:41521975-41521997 TAAAGAAAATAGATAGATTCCGG + Intergenic
1058206521 9:102115633-102115655 CAAAAGAATTAAATAGGGTAAGG + Intergenic
1059369077 9:113810720-113810742 CAAAGCAATTAACTGGAGTCAGG + Intergenic
1061567143 9:131448567-131448589 AAAAGGAAAGAGAAAGAGTCTGG + Intronic
1187562336 X:20414506-20414528 TAAAGCATTTAGATACAGTCTGG + Intergenic
1188381332 X:29496451-29496473 AAAAGGAATAAGAAAGAGTGTGG - Intronic
1190035502 X:47019543-47019565 AAAATGAACTAGATAGAGTTGGG - Intronic
1194461422 X:94174410-94174432 CAAAAGAAGTAGATAGATCCAGG + Intergenic
1194631455 X:96290532-96290554 CAAAGGGATAAGATAGCTTCTGG + Intergenic
1195211953 X:102658872-102658894 CATAGGGATTTGATTGAGTCAGG + Exonic
1195620643 X:106951123-106951145 CAAATGAATAAGATTGATTCAGG - Intronic
1195949187 X:110249369-110249391 CTTTGGAATTAGATAGAATCAGG + Intronic
1197729802 X:129799770-129799792 CAGAGGACTTATATATAGTCGGG - Intergenic
1198824533 X:140685334-140685356 CAAAGGATAGAGATAGATTCAGG + Intergenic
1199270257 X:145873963-145873985 CAAAGGTGGTAGATACAGTCAGG + Intergenic
1199994256 X:153010081-153010103 CAAAGGAGTTAGAAAGAAGCAGG - Intergenic
1200861962 Y:8002658-8002680 CAAAGTAATTAAATAGAATGTGG + Intergenic