ID: 1105795124

View in Genome Browser
Species Human (GRCh38)
Location 13:23843996-23844018
Sequence CAATGATGGGAGGAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105795124 Original CRISPR CAATGATGGGAGGAGGATGG AGG Intronic
900657219 1:3764524-3764546 GAATGATACGAGGAGGAGGGTGG - Intronic
900888570 1:5432589-5432611 CACTCACGGGAGGTGGATGGCGG + Intergenic
901067508 1:6501308-6501330 CAGCGATGGGAGGATGCTGGGGG - Intronic
901441792 1:9282522-9282544 CAAGGAGGGGAGGGGGAAGGAGG - Intergenic
901659980 1:10793234-10793256 ATATGATGGGGGGAGGAAGGGGG + Intronic
902377658 1:16037387-16037409 CAAAGATGAGAAGAGGATGAAGG + Intergenic
902382834 1:16060646-16060668 CAAAGATGAGAAGAGGATGAAGG + Intronic
902529683 1:17082779-17082801 GTGTGAGGGGAGGAGGATGGGGG - Intronic
903292736 1:22325100-22325122 CACTGATGGGGGTAGAATGGGGG + Intergenic
903836050 1:26203887-26203909 TGCTGATGGGAGGACGATGGGGG - Intergenic
905641202 1:39591163-39591185 AAAGGATGGGAGGAGGATTCTGG + Intergenic
905793372 1:40802006-40802028 CTATGATGGGAGGGGGAAGGGGG + Intronic
906264570 1:44418255-44418277 GAGGGATGGGAGGAGGTTGGGGG + Intronic
906356296 1:45108325-45108347 CAATGTTGGGAGGACAGTGGGGG + Intronic
906880731 1:49586934-49586956 GAAGAATGGGAGGAGGAGGGAGG - Intronic
907225080 1:52938538-52938560 AAATGATGAAAGGAGCATGGCGG - Intronic
907359744 1:53904884-53904906 CAAGGTTGGGAGGTGGAAGGAGG + Intronic
907797004 1:57727922-57727944 CAAGGCTGGGAGTAGGGTGGAGG + Intronic
908291729 1:62673937-62673959 CAAGGAAGGGAGGGGGAAGGGGG + Intronic
908776516 1:67646241-67646263 CAAGGATGCCAGTAGGATGGTGG + Intergenic
909256285 1:73426817-73426839 CAATGAGGGGAGGAAGAAGCAGG + Intergenic
909528237 1:76651567-76651589 CAAGCATGGGAGAAAGATGGAGG + Intergenic
909534473 1:76720755-76720777 CTTTGATGGGAAGAGGATGCAGG - Intergenic
910039117 1:82826432-82826454 CAATTACAGGAGGAGGAAGGTGG + Intergenic
911240675 1:95462477-95462499 TAGTGAAGGGAGGAGAATGGTGG - Intergenic
912250972 1:108012145-108012167 AAAGGATGGGAGGGGGATGAGGG + Intergenic
913941697 1:125115602-125115624 CAATGATGGAGGCAGAATGGAGG - Intergenic
914772223 1:150697977-150697999 AAAGGCTGGTAGGAGGATGGGGG - Intergenic
915444633 1:155967694-155967716 CAAGGTGGGGTGGAGGATGGCGG - Intronic
915543727 1:156584053-156584075 CAAGGGTGGGAGGTGGGTGGGGG + Intronic
917187991 1:172383168-172383190 CAATGATGGGAGGTGGGGGCAGG - Intronic
917253255 1:173086215-173086237 CACTGTTGGCAGGAGAATGGAGG + Intergenic
917572881 1:176287759-176287781 CACTGATGGGAGTGGGGTGGTGG + Intergenic
918202459 1:182279990-182280012 CAATGTTGGGGAGAGGACGGGGG + Intergenic
918345480 1:183603890-183603912 GAATGGTGGAAGGAAGATGGGGG + Intergenic
919493159 1:198230279-198230301 CAAGGTCGGGAGGAGGATGAAGG - Intronic
920308958 1:205037045-205037067 CAAGGAAGGGATGAGGCTGGAGG - Intergenic
920379538 1:205527717-205527739 CAAGGCTGGGACCAGGATGGGGG - Intronic
920557677 1:206915968-206915990 CAATCATGGGAGGGGGAAAGGGG + Intronic
921525736 1:216215484-216215506 AAATGGTGGGATGAGGATGAAGG - Intronic
922243289 1:223771137-223771159 CATGGATGGGGGGAGGCTGGGGG - Intronic
922539014 1:226404966-226404988 TTTTGGTGGGAGGAGGATGGCGG - Intronic
922795031 1:228335620-228335642 CAGTGATGGGAGGAGAACAGGGG - Intronic
922915656 1:229255500-229255522 CAATGATTAGAGAAGGTTGGAGG + Intergenic
924712484 1:246541368-246541390 GAAGGATGGGAGGAGGGTGAAGG + Intronic
1064185494 10:13158531-13158553 CGGCGGTGGGAGGAGGATGGCGG - Intergenic
1064783640 10:18870042-18870064 CAAGCATGGGAGAAAGATGGAGG - Intergenic
1066194535 10:33086140-33086162 CAAGGATGGGATGAGGATTCAGG + Intergenic
1066279983 10:33906908-33906930 ACATGATGGGAAGAGGAAGGAGG - Intergenic
1066422846 10:35278178-35278200 TAATGATAGGATGAGGATGGGGG - Intronic
1066564898 10:36711153-36711175 CAATCATAGGAGGAGGATTAGGG + Intergenic
1066782399 10:38967147-38967169 CAATGATGGAGGCAGAATGGAGG - Intergenic
1067393359 10:45886986-45887008 CTAATATGGGAGGAGGAGGGGGG - Intergenic
1067662101 10:48243806-48243828 GAAGGAAGGGAGGAGGAGGGAGG + Intronic
1067861682 10:49856116-49856138 CTAATATGGGAGGAGGAGGGGGG - Intronic
1068324892 10:55471955-55471977 CCAATATGGAAGGAGGATGGTGG + Intronic
1068525208 10:58120968-58120990 CACTGAAGGGTGCAGGATGGAGG + Intergenic
1069146472 10:64897448-64897470 CCAGAGTGGGAGGAGGATGGTGG - Intergenic
1069594921 10:69664287-69664309 CCATGAAGGGACAAGGATGGTGG + Intergenic
1070389630 10:75958146-75958168 GAAGGATGGGAGGAGGAGGGTGG + Intronic
1070433522 10:76364839-76364861 GAAGGATGGGAGGAGGGTGAGGG - Intronic
1071517077 10:86305280-86305302 CAATGATGGGAAGTTGAGGGAGG - Intronic
1072556306 10:96516571-96516593 CAATGCTGGCATGAGGATGTGGG - Intergenic
1073144211 10:101269304-101269326 CAGGGATGAGAGTAGGATGGTGG + Intergenic
1073788298 10:106914184-106914206 GAAGGAAGGGAGGAGGATGCTGG + Intronic
1075045288 10:119141667-119141689 CAATAATGGGCCAAGGATGGTGG - Intronic
1076265209 10:129104166-129104188 AAATGCTGGCAGGAGGAAGGAGG + Intergenic
1077007998 11:368257-368279 AAGTTAGGGGAGGAGGATGGAGG + Intergenic
1077906421 11:6538323-6538345 CAGTGTTGGGAGGGGGGTGGTGG - Intronic
1078396619 11:10987392-10987414 CACAGATGGGAGGGGGGTGGGGG - Intergenic
1079498993 11:21080998-21081020 TATGGATGGGAGGAGGATGTGGG - Intronic
1080158991 11:29148875-29148897 CCATCATGAGAAGAGGATGGGGG + Intergenic
1080978424 11:37370524-37370546 GGATGGTGGGAGGAGGATGAGGG + Intergenic
1082769434 11:57195422-57195444 TAAAGCTGGGTGGAGGATGGGGG - Intergenic
1084300849 11:68251055-68251077 CTATGATGAGAACAGGATGGGGG - Intergenic
1084465758 11:69322069-69322091 CAATGCTGTGAGCAGGATGCTGG + Intronic
1085816346 11:79741382-79741404 CAATCATGGGAGAAGGGTGAAGG - Intergenic
1086957478 11:92948617-92948639 CCATGATAGGAGGCGGAGGGAGG + Intergenic
1087437714 11:98144103-98144125 CAATGAGGGGAGGGGGACAGGGG + Intergenic
1088175944 11:107052523-107052545 CAATCATGGGAGAAGGAAGGAGG - Intergenic
1088221085 11:107570476-107570498 AAATGCTGGGAGGAGAAGGGCGG - Intergenic
1089128566 11:116194353-116194375 CAAGGAAGGGAGGAGGAGAGAGG - Intergenic
1089331030 11:117689040-117689062 AGATGAGGGGAGGAGGATGGTGG - Intronic
1089659882 11:119978868-119978890 AGATGTTGGGAGGAGGAGGGAGG - Intergenic
1090094167 11:123727296-123727318 AAATGATGGGAGGAGAAAAGAGG + Intronic
1090594745 11:128309363-128309385 CAGTCATGGAAGGAGGCTGGAGG + Intergenic
1090756473 11:129796112-129796134 CAATCATGGCAGAAGGGTGGAGG + Intergenic
1092394514 12:8113906-8113928 CAATGATGGAAGGAAGCTAGTGG - Intergenic
1093693023 12:22128565-22128587 GAATTATTGGAGGAGGTTGGGGG + Intronic
1094402298 12:30075002-30075024 CACTAATGGGAAGAGGAAGGAGG + Intergenic
1095190780 12:39255755-39255777 GAATGATGGGGTGAAGATGGAGG - Intergenic
1095451459 12:42335601-42335623 CAATTATGGGAGGAAATTGGTGG - Intronic
1095667672 12:44820961-44820983 CAGGAATGAGAGGAGGATGGAGG + Intronic
1095947216 12:47760017-47760039 TAATAATTGGTGGAGGATGGGGG - Intronic
1096322564 12:50628082-50628104 CAATGATGGGCCGAGCGTGGAGG + Intronic
1097241414 12:57578111-57578133 TAAGGATAGGAGGAGGATGTGGG - Intronic
1097255769 12:57672908-57672930 CAAGCATGGGAGAAAGATGGAGG + Intergenic
1097644009 12:62214404-62214426 CAATCATGGCAGAAGGAAGGAGG - Intronic
1097858796 12:64496593-64496615 CCATGATGGGAGAAGGAGGGGGG + Intronic
1098038223 12:66328120-66328142 TAAAGAGGGCAGGAGGATGGTGG + Intronic
1099173380 12:79392468-79392490 AAATGAGGACAGGAGGATGGAGG + Intronic
1100165524 12:91913150-91913172 CATTGATGGGAGGTAGATGGTGG - Intergenic
1100517844 12:95345199-95345221 GAATGATGGGCTGAGCATGGTGG + Intergenic
1100859833 12:98793034-98793056 CAATGATGGAAACAGTATGGCGG - Intronic
1101079857 12:101171653-101171675 CAATGATGGGGGAAGAGTGGAGG + Intronic
1101345830 12:103885262-103885284 CCATGGTGGGAGGGGGAGGGTGG + Intergenic
1101375560 12:104168406-104168428 CACAGATGGGAGCAGGATGGGGG - Intergenic
1102156266 12:110731198-110731220 CATTGATGGGTGGGGGGTGGGGG - Intronic
1102510725 12:113413664-113413686 AAATCCTAGGAGGAGGATGGTGG + Intronic
1102669127 12:114602197-114602219 CAATGATGGTAGGAAGTTAGTGG + Intergenic
1102748989 12:115275687-115275709 GAAGGGTGGGAGGAGGATGAGGG + Intergenic
1104467757 12:129004624-129004646 CAATGAGGTGTGGAGGATGCAGG + Intergenic
1105533635 13:21243518-21243540 CAGAGATGGGAGGAGGGTGAGGG + Intergenic
1105629905 13:22152804-22152826 AAATGATGTGAGGCTGATGGAGG - Intergenic
1105795124 13:23843996-23844018 CAATGATGGGAGGAGGATGGAGG + Intronic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1107110146 13:36688649-36688671 AAATGATCAGAGCAGGATGGGGG + Intronic
1107332407 13:39315644-39315666 CAATGAATGGATGAGCATGGAGG - Intergenic
1107351408 13:39518764-39518786 AAATCATGGCAGGGGGATGGCGG - Intronic
1108399635 13:50026724-50026746 CAATAGTGGCAGGAGAATGGAGG - Intergenic
1108709061 13:53015621-53015643 CAATGATGGCAGGAGAAAAGAGG - Intergenic
1109042793 13:57361547-57361569 GAAAGGTGGGAGGAGGATGAGGG + Intergenic
1109068476 13:57732965-57732987 CAATGATGGAAGTAGGAGGCCGG + Intergenic
1109311637 13:60701565-60701587 AAAAGATGGGAGGAGGAGAGGGG + Intergenic
1110706565 13:78605931-78605953 CCATGGTGGGAGGGGGAGGGAGG - Intergenic
1111277724 13:85972542-85972564 CAGTGATGGGGGGAGGGGGGAGG + Intergenic
1111679559 13:91426662-91426684 CCATCATGGGAGAAAGATGGAGG + Intronic
1112285963 13:98104632-98104654 CAATTAGGGGAGGGGGATAGAGG + Intergenic
1113364118 13:109660664-109660686 GAAGGCTGGGAGGAGGATGAGGG + Intergenic
1115036390 14:28861975-28861997 GAAAGGTGGGAGGAGGATGAAGG - Intergenic
1115462106 14:33673127-33673149 CCATGAAGGGAGGAGGCTGAGGG - Intronic
1116809005 14:49521470-49521492 CAATCCAGGAAGGAGGATGGTGG + Intergenic
1116919768 14:50560555-50560577 AAATGCTGGGAGGAGGCGGGAGG - Intronic
1118323438 14:64766592-64766614 CAGGGATGTGGGGAGGATGGAGG + Intronic
1118844614 14:69537758-69537780 CACTGATGGCAGGAAGAAGGTGG + Intergenic
1119725999 14:76922223-76922245 GGATGAAGGGTGGAGGATGGTGG + Intergenic
1119826441 14:77660856-77660878 CTATGATGAGAGGAGGGTGCAGG + Intergenic
1119900854 14:78258431-78258453 CATTGGCGGGGGGAGGATGGGGG + Intronic
1119945585 14:78690213-78690235 CTAAGATGGGAGAAGGTTGGAGG - Intronic
1121199942 14:92108446-92108468 CAGTTATAGGAGGAGGATGCAGG + Intergenic
1121532892 14:94671016-94671038 GAATGAGGGGAGAGGGATGGTGG + Intergenic
1121592351 14:95125656-95125678 CAGAGATGGGGGGAGGAGGGAGG + Intronic
1122210557 14:100171145-100171167 CACTGATGGGAAGAAGATGTTGG + Intergenic
1122778642 14:104134381-104134403 CACTGAAGGGACGTGGATGGGGG + Intergenic
1122826286 14:104372389-104372411 CAAGGATAGGAGGGGGATGGGGG + Intergenic
1123155525 14:106221195-106221217 GAAGGATGGGAGGTGGAAGGTGG - Intergenic
1123402180 15:19998333-19998355 GAAGGATGGGAGGTGGAAGGTGG - Intergenic
1123511521 15:21004999-21005021 GAAGGATGGGAGGTGGAAGGTGG - Intergenic
1123812768 15:23945668-23945690 CAAGGGTGGGAGGAGGGTGATGG - Intergenic
1124410085 15:29429825-29429847 CCATGATGGGGTGAGGATGAGGG + Intronic
1125966742 15:43880894-43880916 CAATGGGAGGAGGAGGCTGGAGG + Intronic
1126176065 15:45736775-45736797 CAATGATAGGAGGACGATGAGGG - Intergenic
1126220580 15:46208468-46208490 CATAGATTGAAGGAGGATGGAGG + Intergenic
1126485895 15:49180666-49180688 AAAGGAGGGGAGGAGGTTGGAGG - Intronic
1126687228 15:51258986-51259008 CAATGATGGTGGAGGGATGGGGG - Intronic
1126739065 15:51759800-51759822 CAAAGATGGGGGGAGGATTTAGG + Intronic
1127788536 15:62377920-62377942 GAAAGTTGGCAGGAGGATGGGGG - Intergenic
1128169882 15:65502135-65502157 CAATGCTGGGAGGCGGAGGTGGG - Intronic
1128847053 15:70908305-70908327 CAGTCAAGTGAGGAGGATGGAGG + Intronic
1129273060 15:74429434-74429456 CAGAGATGGAAGGAGCATGGAGG - Intronic
1129837128 15:78716075-78716097 CAATCAAGGGAGATGGATGGGGG + Intronic
1131500527 15:92960376-92960398 AAATGGTGGGAGCAGGATGTTGG + Intronic
1132131500 15:99284735-99284757 CCATGAAGGGAGGACAATGGTGG - Intronic
1132176837 15:99722545-99722567 CTATAATGGGAGGCAGATGGAGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133388764 16:5392133-5392155 AAAGGATGGGAGGAGGATGAGGG + Intergenic
1133690894 16:8213898-8213920 GAATGATGGCGAGAGGATGGTGG - Intergenic
1135078709 16:19415769-19415791 AAATGAGAGGAGGAGGGTGGTGG - Intronic
1135278747 16:21136018-21136040 CAGTGATGGTAGGGGGATGCAGG + Intronic
1136696862 16:32088519-32088541 CAATGATGGAGGCAGAATGGAGG + Intergenic
1136797363 16:33031809-33031831 CAATGATGGAGGCAGAATGGAGG + Intergenic
1137084756 16:36105218-36105240 CAATGATGGAGGCAGAATGGAGG + Intergenic
1137624453 16:49899003-49899025 CCATGAAGGGAGCAGGTTGGAGG - Intergenic
1138110957 16:54323448-54323470 CAAAGCTGGGAAGAGCATGGAGG - Intergenic
1138191557 16:55017743-55017765 GAATGAGGGGAGGAGTACGGGGG + Intergenic
1138630912 16:58293539-58293561 GAATCATGGGACGTGGATGGAGG - Intronic
1138893242 16:61170753-61170775 CTATCATGAGAGCAGGATGGGGG + Intergenic
1139327692 16:66164811-66164833 CAGGGAGGGGAGGAGGGTGGTGG - Intergenic
1140306411 16:73806962-73806984 TGATGAGGTGAGGAGGATGGAGG + Intergenic
1141128388 16:81417400-81417422 CAGGGCTGGGTGGAGGATGGTGG + Intergenic
1141493911 16:84393689-84393711 CAAAGAGGGGAGGAGGATAGAGG + Intronic
1142008506 16:87701775-87701797 CACAGACGGGAGAAGGATGGCGG - Intronic
1142112427 16:88339621-88339643 ACATGGTGGCAGGAGGATGGGGG + Intergenic
1142141460 16:88474529-88474551 CAGGGATGGGAGGAGGCGGGTGG - Intronic
1143751067 17:9028228-9028250 CAAAGAGAGGAGGTGGATGGGGG + Intronic
1143766719 17:9142553-9142575 AGATGATGGGAGGGGGGTGGAGG + Intronic
1143860384 17:9886242-9886264 CACTGATAGCAGGAGGCTGGTGG - Intronic
1143932346 17:10442550-10442572 CAATTATGGCAGCAGTATGGAGG - Intergenic
1143997183 17:11016968-11016990 CCTTGATGGGAGGAGGATTCTGG + Intergenic
1144120481 17:12147833-12147855 AAAAGATGGGAGTAGGATGAGGG + Intergenic
1144243109 17:13333893-13333915 CAATGATGTGATGATGATGGTGG - Intergenic
1144572323 17:16407701-16407723 CAAGGGTGGGAGGGAGATGGGGG + Intergenic
1145326844 17:21839307-21839329 CAATGATGGAAGCAGAATGGAGG - Intergenic
1145689817 17:26728485-26728507 CAATGATGGAGGCAGAATGGAGG - Intergenic
1145821642 17:27841343-27841365 CAAGGATGGCAAGAGGAAGGAGG - Intronic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146459268 17:33032980-33033002 CAATGTTGGGCTGAGCATGGTGG + Intronic
1146767893 17:35540543-35540565 GAAGGGTGGGAGGAGGATGAGGG - Intergenic
1146829823 17:36058774-36058796 CAATAGGGGGAGGAGAATGGTGG + Intergenic
1146941210 17:36845579-36845601 CAGTGCTGAGAGGAGGAAGGTGG + Intergenic
1147123489 17:38350540-38350562 CATTGAGGGGAAGAGGGTGGAGG - Intergenic
1147154022 17:38534153-38534175 CGAAGGTGGGAGGAGGATGAGGG - Intronic
1148190075 17:45672207-45672229 CAATGGTGGGAGGAGGAAGTGGG + Intergenic
1148236753 17:45974283-45974305 CAATGCAGGGAGGAGGAGTGAGG - Intronic
1148506458 17:48131210-48131232 GAAGGATGGGCGGGGGATGGAGG + Intergenic
1149470425 17:56911653-56911675 CTAAGATGGGAGAAGGATTGAGG + Intronic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1149970913 17:61217551-61217573 CCATGAGGGGAGGTGGGTGGGGG - Intronic
1150226460 17:63527224-63527246 TAAACATGGGAGGAGGGTGGGGG - Intronic
1151101890 17:71565242-71565264 CCTTGGTGGGAGGAGGAGGGAGG + Intergenic
1151345854 17:73500744-73500766 GAAGGATGGATGGAGGATGGAGG - Intronic
1151730812 17:75910120-75910142 CAATGCTGGGAATAGGGTGGGGG + Intronic
1152239414 17:79153748-79153770 CAAAGGTGGGAGGAGGAGGTGGG - Intronic
1152243046 17:79170146-79170168 GAAGGAAGGGAGGAGGAAGGAGG + Intronic
1152370740 17:79887035-79887057 GAATGAGGAGAGGAGGCTGGGGG + Intergenic
1152370757 17:79887091-79887113 GAATGAGGAGAGGAGGCTGGGGG + Intergenic
1152541194 17:80976885-80976907 CTATGATGTCATGAGGATGGAGG - Intergenic
1152617188 17:81343395-81343417 GAACAAAGGGAGGAGGATGGGGG + Intergenic
1152791632 17:82283302-82283324 CATTGGTGGGAGGGGAATGGGGG - Intergenic
1152913208 17:83017193-83017215 CAGTGGCGGGAGGAGGAAGGGGG + Intronic
1203191023 17_KI270729v1_random:189888-189910 CAATGATGGAAGCAGAATGGAGG - Intergenic
1153163000 18:2229726-2229748 AAAGGATGGGAGGGGGATGAGGG + Intergenic
1153337407 18:3938792-3938814 GAATAATGGGAGGTGGCTGGAGG + Intronic
1153468358 18:5415295-5415317 CAATGATGAGCAGAGGGTGGTGG + Intronic
1153564272 18:6404097-6404119 GAAGGGTGGGAGGAGGGTGGGGG + Intronic
1154426378 18:14275283-14275305 CATGGATGGGAGGGGGCTGGGGG + Intergenic
1154516173 18:15167869-15167891 CAATGATGGAGGCAGAATGGAGG + Intergenic
1154962515 18:21324026-21324048 GAAGGATGGGAGGGGGATGAGGG + Intronic
1156057054 18:33019224-33019246 CAATGTTGGCAGAAGGCTGGTGG + Intronic
1156460828 18:37320465-37320487 CCATAGTGGGAGGAGGCTGGAGG + Intronic
1157687484 18:49654073-49654095 CCAGCATGGGAGGAAGATGGAGG + Intergenic
1157772457 18:50361214-50361236 CATAGGTGGGAGGAGAATGGAGG + Intergenic
1157936156 18:51874947-51874969 GATTGAGGAGAGGAGGATGGTGG - Intergenic
1158011674 18:52735677-52735699 CCAGCATGGGAGAAGGATGGAGG + Intronic
1158492576 18:57923627-57923649 CCATGATGTGAGGAGAAGGGAGG + Intergenic
1160773982 19:846414-846436 CCATGAGGGGAGGAGGGCGGCGG + Intronic
1161322323 19:3646987-3647009 GAAGGATGGGAGGAGGGTGCAGG + Intronic
1161350778 19:3790309-3790331 CAAGGATGAGAGGTGGAGGGTGG - Intronic
1161652034 19:5491465-5491487 CAATGCCGGGGAGAGGATGGGGG + Intergenic
1161719789 19:5896411-5896433 CCAGGCTGGGAGGAGGGTGGGGG + Intronic
1161816571 19:6502853-6502875 CAATCATGGGAGGAAAATCGTGG - Intergenic
1163611543 19:18304426-18304448 GGATGAGTGGAGGAGGATGGAGG + Intergenic
1164451645 19:28371223-28371245 GGATCATGGGAGGAGGATGAGGG - Intergenic
1164591827 19:29511710-29511732 GAAGGATGGGAGGTGGAGGGAGG + Intergenic
1164766781 19:30778479-30778501 CAATGAGCTGAGGAGGACGGAGG - Intergenic
1164947062 19:32304673-32304695 CAATGATGTCAGCAAGATGGTGG - Intergenic
1165111254 19:33503751-33503773 CAATGAAGGGAGGGGGCTAGAGG - Intronic
1165410626 19:35658674-35658696 CCATCCTGGGAGAAGGATGGAGG - Exonic
1167045934 19:47048597-47048619 GAATCATGGGAGGCGGCTGGTGG - Exonic
1167104211 19:47420759-47420781 AATTGATTGGGGGAGGATGGAGG + Intergenic
1167353906 19:48992099-48992121 CCAGGATGGGAGGAGGCTGGGGG - Intronic
1168143884 19:54408460-54408482 CAATGAAGGAAGAAGGAAGGAGG + Intergenic
1168289772 19:55351952-55351974 GGATGATGGGAGGAGGAGGAAGG + Intronic
1168433890 19:56302622-56302644 AAAGGAAGGGAGGAGGAGGGAGG - Intronic
925077038 2:1025395-1025417 CTATGATGAGAAGAGCATGGGGG + Intronic
925497953 2:4473164-4473186 CCATCATGGGAGAAAGATGGAGG + Intergenic
925559010 2:5167577-5167599 CAATCATGGCAGGAGGATGAAGG + Intergenic
925615688 2:5742692-5742714 CAATGATAGGAGAATGATAGAGG - Intergenic
925626239 2:5844200-5844222 CTATGATGGGACCAGGATGAAGG + Intergenic
926772572 2:16391539-16391561 AAAAGGTGGGAGGAGGATGAGGG - Intergenic
927316946 2:21694645-21694667 AAATGATGGCAGGATGATGTGGG - Intergenic
927730378 2:25465709-25465731 GAATGATGTGAGGAGGAAAGAGG - Intronic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
928053539 2:28027060-28027082 TAATGATGGATGGAAGATGGTGG - Intronic
928603468 2:32923371-32923393 CATGCATGGGAGGAGGAAGGAGG + Intergenic
929109546 2:38395234-38395256 GGATGGTGGGAAGAGGATGGTGG + Intergenic
929658727 2:43760792-43760814 CAGGGCTGGGAGGAGGAGGGAGG - Intronic
930092842 2:47543904-47543926 CACTGATGGGAGGAGGATTGAGG + Intronic
930732296 2:54739714-54739736 CATTCATGGGAGGCGGTTGGTGG + Intronic
931662691 2:64582294-64582316 CCATGATGGGCTGTGGATGGGGG + Intronic
931801722 2:65765356-65765378 TAATCATGTGAGGGGGATGGTGG - Intergenic
931944505 2:67289916-67289938 CTATCATGAGAGCAGGATGGGGG - Intergenic
932208146 2:69902217-69902239 GAAAGAAGGGAGGAGGAAGGAGG - Intronic
932271361 2:70413059-70413081 CTCTGTAGGGAGGAGGATGGAGG + Intergenic
932434525 2:71695273-71695295 CATGGATGGGAGGAGGGAGGAGG + Intergenic
932892946 2:75611805-75611827 CGAAGATGGTTGGAGGATGGTGG - Intergenic
933902910 2:86862038-86862060 CAATGCTAGGAGGATGAGGGCGG - Intergenic
934112494 2:88756517-88756539 CAGTGTTGGGGGGAGGCTGGTGG + Intergenic
934252029 2:90363523-90363545 CAATGATGGAGGCAGAATGGAGG + Intergenic
934257412 2:91439433-91439455 CAATGATGGAGGCAGAATGGAGG - Intergenic
934554130 2:95278490-95278512 CAATGGTGGGAGAGGGATGGGGG + Intronic
934940260 2:98496161-98496183 CTATGATGGGAAGAGGAGGTTGG - Intronic
935044174 2:99464955-99464977 CCATGAGGCGAGGTGGATGGAGG - Exonic
935371555 2:102352119-102352141 AAATGGTGGCTGGAGGATGGTGG - Intronic
935504904 2:103888752-103888774 CAGTGGTGGGAAGAAGATGGTGG - Intergenic
935607753 2:104987335-104987357 GAATAATGGGAAGAGAATGGGGG + Intergenic
935777635 2:106487231-106487253 CAATGCTAGGAGGATGAGGGCGG + Intergenic
936516603 2:113185218-113185240 CCTGGGTGGGAGGAGGATGGAGG + Intronic
936583368 2:113727076-113727098 CTATGATGGGAACAGCATGGGGG - Intronic
936769961 2:115900308-115900330 AAAGGATGGGAGTAGGCTGGTGG - Intergenic
937023076 2:118676274-118676296 CAATAATGTGAGGAGGGTGCTGG - Intergenic
938584209 2:132672958-132672980 AAATGATGGGTGGGGGGTGGGGG - Exonic
939958828 2:148548364-148548386 TAATGAAGGGAGTGGGATGGGGG + Intergenic
940264771 2:151825286-151825308 TAATGGGGGGAGGAGGAGGGAGG + Intronic
941741359 2:169038935-169038957 CATTGGAGGGTGGAGGATGGGGG - Intergenic
942731754 2:179067641-179067663 CAATGATGGCAGAAGGCAGGGGG - Intergenic
942892536 2:181008660-181008682 TAGTGGTGAGAGGAGGATGGAGG + Intronic
943343659 2:186711411-186711433 CAAATATGGAAGGATGATGGTGG - Intronic
944796517 2:203191214-203191236 CGATGATGTCATGAGGATGGCGG - Intronic
944926832 2:204474182-204474204 CAATAACGGGCGGAGGTTGGAGG - Intergenic
945690164 2:213024119-213024141 CAATGATGGGATGAAGAGGAAGG - Intronic
946695235 2:222350297-222350319 CAATGATTGGTTGAGGGTGGGGG - Intergenic
1168974358 20:1953080-1953102 CAAATATGAGAGGGGGATGGAGG + Intergenic
1169246380 20:4028345-4028367 GAAGGAAGGGAGGAGGAAGGAGG - Intergenic
1172197834 20:33104307-33104329 CAAGGATGCGGTGAGGATGGTGG - Intronic
1172612745 20:36263973-36263995 CAAGGAGGGGATGAGGATGGAGG - Intronic
1172934082 20:38607232-38607254 CAATGATGAGTGGAGGATTTAGG - Intronic
1173438823 20:43057259-43057281 GAATGAAGGAAGGAGGAAGGGGG + Intronic
1174273255 20:49384789-49384811 CAAAGATGGAAAGAGGATGGAGG + Intronic
1174660562 20:52209252-52209274 CAGTTATAGGAGGAGGCTGGAGG + Intergenic
1175120271 20:56711143-56711165 CAAGGAGGAGAGGAGGAGGGAGG - Intergenic
1175667943 20:60876390-60876412 CCAGGATTGGAGGATGATGGTGG - Intergenic
1177325477 21:19582897-19582919 AAAGGATGGATGGAGGATGGAGG - Intergenic
1177521902 21:22237736-22237758 CTATGATGAGAACAGGATGGGGG - Intergenic
1177893139 21:26831463-26831485 CAATGAGGATAGGAGGTTGGTGG - Intergenic
1178100717 21:29265966-29265988 CAATCATGGCAGAAGGGTGGAGG - Intronic
1178598354 21:33974788-33974810 TAATGATGGAAGAAGGAAGGAGG - Intergenic
1179156796 21:38858003-38858025 AAAGGATGAAAGGAGGATGGAGG + Intergenic
1180082373 21:45492848-45492870 AAATGATGGGAGTGGGATGTGGG + Intronic
1180764253 22:18234429-18234451 CAAGGATGGGAGGAAGGTGTAGG - Intergenic
1180771388 22:18390112-18390134 CAAGGATGGGAGGAAGGTGTAGG + Intergenic
1180802770 22:18639727-18639749 CAAGGATGGGAGGAAGGTGTAGG + Intergenic
1180854011 22:19035283-19035305 CAAGGATGGGAGGAAGGTGTAGG + Intergenic
1181218948 22:21355534-21355556 CAAGGATGGGAGGAAGGTGTAGG - Intergenic
1181359443 22:22323384-22323406 GAGTGATGGGAGGAGGGTGAGGG - Intergenic
1181369530 22:22405127-22405149 GAGTGATGGGAGGAGGGTGACGG - Intergenic
1181879909 22:25970220-25970242 TAATGATGTGATGATGATGGCGG - Intronic
1182566910 22:31206862-31206884 CAAGGGTGGCAGGAGGAGGGTGG - Exonic
1182746916 22:32613087-32613109 CAATCATGGTAGGAGGGTGAAGG - Intronic
1183343694 22:37295553-37295575 CAATGCTGGGAGGCAGGTGGTGG + Intronic
1183533866 22:38383324-38383346 GCATGATGGGTGAAGGATGGAGG - Intronic
1183770630 22:39922622-39922644 CAATGAGGAGGGGAGAATGGAGG + Intronic
1185023250 22:48392915-48392937 CACTGATGGGTGGAGGAGGGAGG + Intergenic
1185061944 22:48611727-48611749 AAAAGGTGGGAGGAGGAAGGAGG - Intronic
1185170140 22:49288492-49288514 GTATGATGGGTGGTGGATGGGGG + Intergenic
1203233228 22_KI270731v1_random:131103-131125 CAAGGATGGGAGGAAGGTGTAGG + Intergenic
949494703 3:4620580-4620602 TAAAGATGGAAAGAGGATGGAGG - Intronic
949768908 3:7556813-7556835 CATTGAAGGCTGGAGGATGGAGG + Intronic
950136714 3:10586262-10586284 CAAGGATGAGAGAAGGATGCTGG + Intronic
950231750 3:11282115-11282137 CAATAATGCCAGGAAGATGGAGG - Intronic
950469337 3:13174838-13174860 CAGTGGTGGGAGGAGGTGGGGGG - Intergenic
950565038 3:13764338-13764360 CAAGGAAGGGCGGGGGATGGAGG - Intergenic
951251031 3:20394527-20394549 CCATGAGGGGTGGAGCATGGTGG + Intergenic
951487377 3:23229000-23229022 GAATGTTGGGAGGGGGATGCTGG - Intronic
951537126 3:23750443-23750465 AAATGATGGGCTGAGAATGGTGG + Intergenic
951865831 3:27306250-27306272 CAAGGATGGGAGGAGCAGTGGGG - Intronic
951990516 3:28671339-28671361 CAATGGTGGGAGGACTCTGGGGG - Intergenic
952234662 3:31466587-31466609 CAAGGAAGGGATGAGGAGGGGGG + Intergenic
952627765 3:35427527-35427549 CAAAGATGGGAGGAAGATGAGGG + Intergenic
953843197 3:46406453-46406475 GAATGGTGGGAGGAGGCTGTGGG - Intergenic
954760617 3:52871044-52871066 CGATGAAGGGAGCAGGATGTGGG - Intronic
954827373 3:53385891-53385913 TAATGATAGGAAGAAGATGGTGG - Intergenic
954842486 3:53524118-53524140 CCATGGTGAGGGGAGGATGGGGG + Intronic
955032542 3:55234794-55234816 GGATGGTGGGAGGAGGATGTGGG - Intergenic
955459191 3:59161751-59161773 CAGTGGTAGGAGGAGAATGGTGG + Intergenic
956068124 3:65418606-65418628 TAATGATTGGAGGAGAAAGGAGG - Intronic
956473211 3:69591288-69591310 CAAGGGTGGGAGGAGCTTGGAGG - Intergenic
956693360 3:71898171-71898193 CAATGATGGAAGCAAGCTGGAGG + Intergenic
958967982 3:100580036-100580058 CAAAGAAGGGATGGGGATGGAGG + Intergenic
959053039 3:101542592-101542614 CCATGATGGGAAGTGGAGGGTGG - Intergenic
960410239 3:117314191-117314213 CCATGATGGGAAGAGGAGGTTGG + Intergenic
961648105 3:128403374-128403396 CAGTGCAGGGAGGAAGATGGGGG + Intronic
961796036 3:129409529-129409551 CTAAGATAGGAGGAGGCTGGCGG + Intronic
963427084 3:145144242-145144264 CAATGGAGGTAGGAGGAAGGGGG + Intergenic
964389190 3:156180051-156180073 CAATTATAGAAGGAGGATGATGG - Intronic
964612796 3:158631842-158631864 CCAGGATGGGAGAAAGATGGAGG + Intergenic
965098526 3:164267831-164267853 CTATCATGAGAGCAGGATGGAGG + Intergenic
965749657 3:171962721-171962743 CCATGATCGGAGCAGGAAGGAGG + Intergenic
966400818 3:179545446-179545468 CACTGCTGGAAGGAAGATGGGGG - Intergenic
966983853 3:185162053-185162075 GAATGATGGGGGTAGGAAGGAGG + Intergenic
967266821 3:187698772-187698794 CAGTGCTACGAGGAGGATGGTGG - Exonic
967420619 3:189268298-189268320 CAAGGATGGGTGGCTGATGGGGG + Intronic
967651196 3:191989461-191989483 CAATCATGGTAGGATCATGGTGG + Intergenic
967822967 3:193855264-193855286 CAATAGTGGGAGAAGGATGCAGG - Intergenic
968046677 3:195627987-195628009 CTAGGGTGGGAGGAGGAGGGCGG + Intergenic
968307977 3:197662057-197662079 CTAGGGTGGGAGGAGGAGGGCGG - Intergenic
968324583 3:197802025-197802047 CAATGCTGGCTTGAGGATGGAGG - Intronic
968332775 3:197885663-197885685 CAATGATGGGTGGAGGAAAAGGG + Intronic
969392849 4:6902370-6902392 TAGGGATGAGAGGAGGATGGGGG + Intergenic
969604715 4:8196711-8196733 CCCTGATGGGAGAAGGAAGGTGG + Intronic
969951992 4:10846543-10846565 GGAGGGTGGGAGGAGGATGGGGG + Intergenic
970432476 4:16001484-16001506 CAAAGATGGGTGGTGGAAGGAGG + Intronic
970826816 4:20286282-20286304 AAATGATGGGATGAGGGTGGGGG - Intronic
971224185 4:24736088-24736110 TCATGCTGGGTGGAGGATGGGGG + Intergenic
974324950 4:60402103-60402125 CAATGATGGGCTGGGGGTGGTGG + Intergenic
975146519 4:70973315-70973337 TAATGATGGGCTGGGGATGGTGG + Intronic
975512076 4:75205248-75205270 CAATGTTGGGACTAGGAAGGTGG - Intergenic
975571226 4:75820266-75820288 CAATAATTGGAGTAGGATGTGGG + Intergenic
976191115 4:82488078-82488100 AAAGGATGGGAGGGGGATGAGGG - Intronic
976295560 4:83467774-83467796 CGAGGATGGGCGGGGGATGGGGG + Intronic
976296694 4:83479677-83479699 GAATGATGGGCCGAGTATGGTGG + Intronic
977027357 4:91835292-91835314 AGAGGGTGGGAGGAGGATGGGGG + Intergenic
978414702 4:108463366-108463388 AAATGCTGGGAGGAGAAGGGTGG + Intergenic
979483137 4:121241012-121241034 CAAGGGTGGGAGGAGGGTGAGGG - Intergenic
979558251 4:122075542-122075564 CAAGGGTGGCAGGAGGAGGGTGG + Intergenic
979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
981819609 4:148870502-148870524 CAATGATGGTAGCAGGAAGTGGG + Intergenic
982400722 4:154964849-154964871 CAAAGATGTGAGTAGGGTGGGGG - Intergenic
983786043 4:171730236-171730258 CAATCATGGCAGAAGGAAGGAGG - Intergenic
983954056 4:173676368-173676390 TGATTATGGGGGGAGGATGGAGG + Intergenic
984987639 4:185346911-185346933 CAGCGATGGGAGGAAGCTGGGGG - Intronic
985744958 5:1641196-1641218 CTAGGGTGGGAGGAGGAGGGCGG - Intergenic
986274749 5:6263850-6263872 CCATGATGAGAACAGGATGGGGG - Intergenic
987089563 5:14498871-14498893 TGTTGCTGGGAGGAGGATGGGGG + Intronic
987122391 5:14779250-14779272 CAAAAATGAGAGGAAGATGGTGG - Intronic
987123511 5:14790150-14790172 GAATGATGTGAGGAGGGAGGCGG - Intronic
988148738 5:27347529-27347551 CAATCATGGCAGAAGGAAGGAGG - Intergenic
988731824 5:33980209-33980231 CACTGATTGGAGTAGGAGGGGGG - Intronic
989249141 5:39287829-39287851 CGAGGATGGGAGGGGGATGAGGG + Intronic
989306215 5:39959763-39959785 CAATGATAGCAGAAGGATGAAGG - Intergenic
989396285 5:40960487-40960509 CTATGGTGGGAAGAGGATGCTGG + Intronic
992751969 5:79870326-79870348 CAATGATGGGGTGGGGCTGGGGG + Intergenic
993289449 5:86046397-86046419 CAATGATGGCGGTAGGCTGGTGG - Intergenic
993864687 5:93178336-93178358 TCAGGATGAGAGGAGGATGGAGG - Intergenic
994397860 5:99240986-99241008 AAATGATGAGAGGAGCAAGGAGG + Intergenic
994458861 5:100049016-100049038 AAGGGATAGGAGGAGGATGGGGG + Intergenic
995469414 5:112484630-112484652 CAAAGATGTGAAGAGGATGTAGG - Intergenic
995812224 5:116120351-116120373 CAAGGTTGGGAGGAAGATGAGGG + Intronic
996215277 5:120858423-120858445 TAATGTTGGGAGGTGGAAGGAGG + Intergenic
996240493 5:121194505-121194527 CAATGGAGGGAAGAGTATGGAGG - Intergenic
996388556 5:122934853-122934875 CAATGAAGGGTGGGGGAGGGTGG - Intronic
996576265 5:124979373-124979395 GAGGGATGGGAGGAGGAAGGGGG + Intergenic
996832484 5:127755132-127755154 CAGTGAAGGGAAAAGGATGGAGG + Intergenic
998119170 5:139561773-139561795 CCATGGTGGGAGGCGGGTGGCGG - Exonic
998240614 5:140440375-140440397 CAAAAAGGGAAGGAGGATGGGGG - Intronic
998946195 5:147341918-147341940 CAATGAAGGGAGTAGTCTGGTGG + Intronic
999242831 5:150137484-150137506 AAGGGATGGGAGGAGGAGGGGGG + Intronic
999605461 5:153309297-153309319 CAATGCTGGCAGGAAGCTGGAGG + Intergenic
1000225258 5:159255157-159255179 CAATCATGAGAGCAGCATGGGGG - Intergenic
1000311803 5:160052168-160052190 CAAAAAAGGGAGGGGGATGGGGG + Intronic
1001711757 5:173784513-173784535 GAATGATGGGGGGAGAATGCTGG - Intergenic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1001955084 5:175843525-175843547 CAAAGATGTGAGCAGGAAGGAGG - Intronic
1001979329 5:176028040-176028062 AAAGGATGGGAGGGGGATGAGGG + Intronic
1001980701 5:176035539-176035561 CCACGATGGGAGCAGGTTGGGGG - Intergenic
1002035607 5:176467029-176467051 CTCTGAAGGGAGGAGGAAGGAGG + Intronic
1002181152 5:177431726-177431748 CAATGCAGGGAGGTGGATGGAGG + Intronic
1002236760 5:177808526-177808548 CCACGATGGGAGCAGGTTGGGGG + Intergenic
1002238087 5:177815721-177815743 AAAGGATGGGAGGGGGATGAGGG - Intergenic
1002380457 5:178824400-178824422 AAAGGATGGGAGGGGGATGAGGG + Intergenic
1002381352 5:178832009-178832031 CTGTGATGGGAGCAGGTTGGGGG - Intergenic
1002887779 6:1311860-1311882 CATTGGCGGGAGGAGGAAGGCGG + Intergenic
1002899529 6:1399386-1399408 CAAAGATGGGTGGAGGGTGTGGG + Intergenic
1002938164 6:1692089-1692111 CTAGCATGGGAGGAAGATGGAGG - Intronic
1003377451 6:5593025-5593047 CAGAGATGGGAGGAGGGTGAGGG - Intronic
1003727957 6:8787416-8787438 TAAAGATGGGAGTAGGGTGGGGG + Intergenic
1005518619 6:26578278-26578300 GGATGATGGGAGGAGGATGAGGG - Intergenic
1005816241 6:29554872-29554894 AAATGGAGGGAGGAAGATGGAGG + Intergenic
1006781990 6:36638151-36638173 CAGTGATGGTAGGAGATTGGAGG - Intergenic
1007176785 6:39902605-39902627 CAATGTTGGAAGGATGATGCAGG + Exonic
1007512359 6:42383424-42383446 CAGGGTTGGGAGGAGGAAGGGGG - Intronic
1007766669 6:44164714-44164736 CAAGGATGGGAAGAGGAATGAGG + Intronic
1008260432 6:49359613-49359635 CAATTATGGGAGAAAGATGGAGG + Intergenic
1008466479 6:51836932-51836954 GGATGATAGGAGGAGGATAGGGG - Intronic
1008674716 6:53807270-53807292 GAATGAGGGAAGGAGGAGGGAGG - Intronic
1010882149 6:81190743-81190765 GGATGATGGGAGGAGGGTGAGGG + Intergenic
1011104915 6:83768826-83768848 CAGTGATGGGAGTAGGAGGTTGG - Intergenic
1012319075 6:97820077-97820099 CAAGGATTGCAGGAGGATGGGGG - Intergenic
1012527245 6:100192811-100192833 CAATGATGTGAGAAGGAGGTTGG - Intergenic
1013141566 6:107341200-107341222 GAATGATGGCAGTAGCATGGAGG + Intronic
1013327949 6:109067137-109067159 CAGTGAGGGCTGGAGGATGGTGG - Intronic
1013834502 6:114317782-114317804 TAATGATGGGAGGCGGGGGGCGG + Intronic
1014384676 6:120785949-120785971 CAAGCATGAGAGGAGGCTGGGGG + Intergenic
1015113162 6:129617244-129617266 CAGTGATGGGGGCAGGGTGGAGG - Intronic
1015845516 6:137516398-137516420 AAATTATGGGAGGATGAGGGAGG - Intergenic
1016199371 6:141388933-141388955 CAATGATGGGAATGGGTTGGTGG - Intergenic
1016734965 6:147468261-147468283 CTAATTTGGGAGGAGGATGGGGG + Intergenic
1017195226 6:151693432-151693454 GAATGATGGAAGAATGATGGAGG - Intronic
1018831661 6:167448353-167448375 CAATGCAGGGAGGTGGAAGGCGG - Intergenic
1020381779 7:7555582-7555604 TAAGGATGGGAGGAGGAAGAAGG - Intergenic
1021567153 7:22027043-22027065 CAAGGAGAGGAGGAGGCTGGGGG + Intergenic
1022097152 7:27148136-27148158 CAAAAAGGGGAGGAGGAAGGAGG - Intronic
1022323715 7:29310745-29310767 ACATGGTGGGAGGAGGAAGGTGG + Intronic
1023348586 7:39296638-39296660 CAATGAGGTGGGGAGGAAGGAGG - Intronic
1024231603 7:47367709-47367731 CAGTGATGGGAGGGGCTTGGGGG - Intronic
1025009030 7:55380800-55380822 GTATGATTGGAGGAGGAGGGAGG + Intronic
1025319778 7:58083873-58083895 CAATGATGGAGGCAGAATGGAGG - Intergenic
1025553936 7:62279600-62279622 CAATGATGGAGGCAGAATGGAGG + Intergenic
1025669240 7:63604996-63605018 CCATGATGGGTGGCGGCTGGTGG - Intergenic
1026024788 7:66735734-66735756 CAATCATGGCAGAAGGATGAAGG - Intronic
1027621398 7:80491085-80491107 CAATGAAGGGAAGAGAAGGGAGG + Intronic
1028009492 7:85622902-85622924 GAATGATGGGAAGAGTATGTGGG - Intergenic
1028418007 7:90599621-90599643 CAATGAAGAAAGGAGGATGATGG - Intronic
1028438454 7:90831380-90831402 CCATTATGAGAGCAGGATGGGGG + Intronic
1029090014 7:98040694-98040716 CAAGGAAAGGAGGATGATGGAGG + Intergenic
1029657381 7:101936229-101936251 GAAGGATGGGAGGAGGGAGGAGG + Intronic
1029799094 7:102926979-102927001 CAATGCTGGGAGTAGGGTGGGGG + Intronic
1030649453 7:112101785-112101807 AAATGATGGGTGGAGGATAAGGG - Intronic
1031920490 7:127596528-127596550 AAATGATGAGAGGATGATGTGGG + Intronic
1032023101 7:128421111-128421133 CAATGCAGGGACCAGGATGGGGG - Intergenic
1032402532 7:131633760-131633782 CAGTGCTTGGAGGAGGATGCTGG - Intergenic
1032598227 7:133264035-133264057 CAATGCTTGGAGAAGGATGTGGG + Intronic
1033339095 7:140478597-140478619 CACAGTTGGGCGGAGGATGGGGG + Intronic
1033498876 7:141927428-141927450 CAATAAAGGGAGAAGGATGAAGG + Exonic
1033659532 7:143393960-143393982 CTAGGATGGGAGGAGGTGGGAGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034598702 7:152225998-152226020 CTATATTGGGAGAAGGATGGAGG + Intronic
1034941405 7:155232659-155232681 CAAAGCTGGGAAGAGGAAGGAGG + Intergenic
1035235516 7:157495312-157495334 GTATGATCAGAGGAGGATGGTGG - Intergenic
1035285316 7:157802265-157802287 CGAAGAAGAGAGGAGGATGGAGG - Intronic
1035418715 7:158709683-158709705 CAGTGAGGGGAGGGGAATGGTGG + Intergenic
1037825777 8:22159876-22159898 CAATGTTGCCAGGATGATGGGGG + Intronic
1037943299 8:22971051-22971073 TCATGTTGGGAGGAAGATGGAGG - Intronic
1038238786 8:25788338-25788360 TGAGGATGGGAGGAGGATGGAGG + Intergenic
1038613680 8:29074345-29074367 CAAAGCAGGGAGCAGGATGGTGG + Intronic
1038848447 8:31251478-31251500 CAGTGGTGGGTGGAGGTTGGCGG + Intergenic
1038971145 8:32636891-32636913 TAGTGATGGGTGGAGGCTGGGGG + Intronic
1039382657 8:37100381-37100403 CAATGTAGGGAGATGGATGGGGG - Intergenic
1041932938 8:63307333-63307355 CAATCAGGGGAAGAGGATGAAGG - Intergenic
1043363997 8:79510363-79510385 CAATGTCGGGAGAGGGATGGGGG + Intergenic
1044491976 8:92830246-92830268 CAATAATGGGAGTAGACTGGTGG + Intergenic
1045160275 8:99533905-99533927 AAAAGTTGGGAGGAGGAAGGAGG - Intronic
1047364831 8:124202208-124202230 CAATGATGGGAGGCTGGAGGTGG - Intergenic
1048353662 8:133635866-133635888 CAATTGTGGGAGGAGGAAGTTGG + Intergenic
1050018735 9:1262120-1262142 CAATGATGTGCAGTGGATGGTGG + Intergenic
1050516402 9:6448610-6448632 TAATTATAAGAGGAGGATGGAGG + Intronic
1052108501 9:24549430-24549452 GAATGAGGGGAGGAGGGTAGCGG + Intergenic
1052511006 9:29420561-29420583 CAATGATATGAGGAGAATGAAGG + Intergenic
1052583933 9:30399566-30399588 CAATGAAGGAAGGAGAATGTTGG + Intergenic
1052740613 9:32388909-32388931 TAATTGGGGGAGGAGGATGGTGG - Intronic
1052836531 9:33254301-33254323 CAATGATGGGGTGGGGGTGGGGG + Exonic
1052877993 9:33581722-33581744 CCTGGATGGGAGGAGGGTGGGGG + Intergenic
1052879729 9:33594091-33594113 CATGGATGGGAGGGGGTTGGGGG + Intergenic
1053003332 9:34589756-34589778 CGAGGGAGGGAGGAGGATGGGGG - Intronic
1053218476 9:36292429-36292451 CAATGTTAGGAGAAGGATGAAGG - Intronic
1053583824 9:39435837-39435859 CCATGAGGGGTGGAGCATGGCGG - Intergenic
1054105405 9:60994581-60994603 CCATGAGGGGTGGAGCATGGCGG - Intergenic
1055283320 9:74699802-74699824 CAGTGATGGAGGGAGAATGGAGG + Intergenic
1056586353 9:87929922-87929944 CATGGATGGGAGGTGGGTGGAGG - Intergenic
1056610529 9:88123021-88123043 CATGGATGGGAGGTGGGTGGGGG + Intergenic
1057161174 9:92889370-92889392 CATGAATGGGAGGAGGGTGGGGG - Intergenic
1057307005 9:93918307-93918329 CATTGAGGGGAGGAGGCGGGTGG - Intergenic
1057676176 9:97137677-97137699 CATGGATGGGAGGGGGTTGGGGG - Intergenic
1058322955 9:103657499-103657521 CAATCATGGGAGAAGGAAAGGGG - Intergenic
1059958818 9:119545371-119545393 CAATGCCAGGAGGATGATGGAGG - Intergenic
1059959683 9:119552902-119552924 CAATCATGGCAGAAGGATGAAGG + Intergenic
1060924678 9:127447912-127447934 CGATGATGTCATGAGGATGGCGG + Exonic
1061118081 9:128627255-128627277 CAAAGATGAGAGGAGGAGGCTGG - Intronic
1061656484 9:132095199-132095221 AAAGGATGGGAGGGGGATGAGGG - Intergenic
1062008279 9:134252675-134252697 CACTGCTGGGAGGAGGAAAGCGG + Intergenic
1185449515 X:275082-275104 CAGTGAAGGGAGGAGGGAGGAGG + Intergenic
1186171342 X:6880243-6880265 AAATGCTGGGAGGGGGATGAGGG - Intergenic
1186986224 X:15016819-15016841 CAATGATGGGTGGGAGCTGGAGG - Intergenic
1187573717 X:20532122-20532144 CAAAGGTGGGAGGAGGAGTGGGG + Intergenic
1187643113 X:21316456-21316478 AAATGATGGTAGAAAGATGGTGG + Intergenic
1188019990 X:25146551-25146573 CAAAGATGGAGAGAGGATGGGGG - Intergenic
1188229185 X:27640078-27640100 CATTGGTGGGAGGAGGGGGGAGG - Intronic
1188816672 X:34723524-34723546 TGAGGATGGGAGGAGGATGAGGG - Intergenic
1189707853 X:43777516-43777538 CAATGGTGGGGCGAGGAGGGAGG + Intronic
1191105410 X:56769175-56769197 CAGTGGTGGGAGGAGCATGCCGG + Intergenic
1191106403 X:56774577-56774599 CAGTGGTGGGAGGAGCATGCCGG + Intergenic
1191107396 X:56779979-56780001 CAGTGGTGGGAGGAGCATGCCGG + Intergenic
1192421801 X:71039101-71039123 CAATAGTGGGTGGATGATGGAGG + Intergenic
1192439459 X:71164095-71164117 CAATGAAGGCAGAGGGATGGAGG - Intronic
1192442030 X:71181754-71181776 AAAGGATGGGAGGAGGGTGGGGG - Intergenic
1193119377 X:77807492-77807514 AAAGGATGGGAGAGGGATGGGGG - Intergenic
1194013978 X:88597065-88597087 AAAGGTTGGGAGGAGGATGAGGG - Intergenic
1194793521 X:98181186-98181208 AAAAGAAAGGAGGAGGATGGAGG - Intergenic
1196172035 X:112599316-112599338 GAAGAATGGGAGGGGGATGGGGG + Intergenic
1196238821 X:113316410-113316432 GAATGATGTCAGGAAGATGGCGG + Intergenic
1197308284 X:124871148-124871170 CAAACAGGGGAGGAGGAAGGGGG - Intronic
1197418801 X:126210333-126210355 CATTGATGGGGGGAGGGGGGAGG + Intergenic
1197863873 X:130997736-130997758 CATTGATGGAAGGAGGCTGATGG + Intergenic
1199295748 X:146156531-146156553 CAAAGAAGGAGGGAGGATGGGGG - Intergenic
1199512523 X:148638422-148638444 CAATCATGAGAGCAGCATGGGGG + Intronic
1199833424 X:151565417-151565439 CAGTGATGGAGGGAGGATGTGGG + Intronic
1200046695 X:153406924-153406946 GAATGATGGGAGGTGGAGGGTGG + Intergenic
1200975213 Y:9205049-9205071 CAATGAAGGGACTAGCATGGTGG + Intergenic
1201604116 Y:15766210-15766232 TAAAGATGGGAAGAGGAAGGAGG - Intergenic
1201623035 Y:15981177-15981199 CCATGATAGGAGGTGGAGGGAGG + Intergenic
1202135938 Y:21661470-21661492 CAATGAAGGGACTAGCATGGTGG - Intergenic